The Cellular Protein SPT6 Is Required for ... - Journal of Virology

2 downloads 0 Views 2MB Size Report
Nov 9, 2011 - The human cytomegalovirus tegument protein UL69 has been shown to be ... is the human homolog of the suppressor of Ty6 (SPT6) (25).

The Cellular Protein SPT6 Is Required for Efficient Replication of Human Cytomegalovirus Daniel Cygnar,a Stacy Hagemeier,a* Daniel Kronemann,a and Wade A. Bresnahana,b Department of Microbiologya and Institute for Molecular Virology,b University of Minnesota, Minneapolis, Minnesota, USA

The human cytomegalovirus tegument protein UL69 has been shown to be required for efficient viral replication at low multiplicities of infection. Several functions have been associated with UL69, including its ability to regulate cell cycle progression, translation, and the export of viral transcripts from the nucleus to the cytoplasm. However, it remains unclear which, if any, of these activities contribute to the phenotype observed with the UL69 deletion mutant. UL69 has been shown to interact with the cellular protein SPT6. The functional significance of this interaction has never been examined in the context of an infection. To address this, we generated UL69 mutant viruses that were unable to interact with SPT6 and determined what effect these mutations had on virus replication. Abolishing UL69’s ability to interact with the SPT6 protein inhibited virus replication to levels indistinguishable from those observed following infection with the UL69 deletion mutant. Surprisingly, abolishing UL69’s interaction with SPT6 also resulted in the impairment of UL69 shuttling activity. Finally, we demonstrate that inhibition of SPT6 expression by short hairpin RNA (shRNA) knockdown inhibits wild-type virus replication. Taken together, our results demonstrate that UL69’s ability to interact with SPT6 plays a critical role in viral replication.

H

uman cytomegalovirus (HCMV) belongs to the betaherpesvirus family and is a ubiquitous human pathogen. HCMV infection is generally asymptomatic in healthy individuals. However, considerable complications can arise in newborns or individuals that are immunocompromised, such as transplant recipients and HIV/AIDS patients (18). Like all herpesviruses, the HCMV virion contains a tegument layer that is composed of a number of virally encoded proteins that are packaged in the virion and delivered to the host cell upon infection. A number of these tegument proteins have been shown to play important roles in viral entry, gene regulation, immune evasion, DNA replication, and viral assembly (10, 11). The UL69-encoded tegument protein has previously been shown to be required for efficient viral replication (9). Infection with a UL69 deletion mutant results in a severe growth defect that is multiplicity dependent. Even though the growth phenotype of the UL69 deletion mutant has been known for years, the mechanism whereby UL69 contributes to viral replication has remained elusive. Several activities have been associated with UL69, including its ability to regulate viral gene expression (9, 26), regulate translation (2), shuttle between the nucleus and cytoplasm (14, 16), interact with RNA (24), and regulate cell cycle progression (9, 17). It is thought that many, if not all, of these activities are regulated by UL69’s interaction with host cell proteins (2, 16, 20, 23, 25). One of the proteins that has been shown to interact with UL69 is the human homolog of the suppressor of Ty6 (SPT6) (25). SPT6 is a highly conserved multifunctional protein that has been shown to interact with the C-terminal domain (CTD) of RNA polymerase (Pol) II and be involved in chromatin remodeling, transcriptional elongation, and mRNA export (3, 5, 7, 8, 12, 27). SPT6 regulates chromatin structure by functioning as a putative histone chaperone that interacts with histone H3 and promotes the reassembly of nucleosomes in the wake of RNA Pol II. In addition, SPT6 has been identified as a classical transcription elongation factor (7, 12) that can either individually or in conjunction with SPT4 and SPT5 (DRB sensitivity-inducing factor [DSIF]) stimulate the rate of RNA Pol II elongation both in vitro and in vivo.

0022-538X/12/$12.00

Journal of Virology

p. 2011–2020

Interestingly, SPT6’s ability to function as a transcriptional elongation factor is independent from its chromatin remodeling activity since SPT6-enhanced transcriptional elongation occurs on naked DNA (7). Finally, SPT6 can regulate mRNA export through its interaction with a cellular protein termed Iws1 (interacts with SPT6-1). Iws1 directly interacts with the nuclear export factor Aly/REF, and depletion of Iws1 has been shown to lead to splicing defects and nuclear retention of bulk poly(A) mRNAs (27). Given that UL69 has been implicated in regulating the export of viral mRNAs and other aspects of viral gene expression, we asked if UL69’s interaction with SPT6 is required for efficient HCMV replication. We demonstrate that viral mutants that are unable to interact with SPT6 display a growth phenotype identical to that of the UL69 deletion virus. In addition, UL69 mutants that are unable to bind SPT6 also display a defect in UL69’s nucleocytoplasmic shuttling activity. Finally, we show that short hairpin RNA (shRNA)-mediated knockdown of SPT6 inhibits the replication of wild-type (WT) HCMV. Taken together, our results demonstrate that UL69’s interaction with SPT6 is important for efficient viral replication and also provide further insight into the mechanism by which UL69 functions. MATERIALS AND METHODS Generation of allelic exchange shuttle vectors and mutant BACs. Primers UL69FR1 (5=-CGCCAAGCTCGATTCGAACC-3=) and UL69FR2 (5=CGTGCAGGTGGTCATCGACC-3=) were used to amplify the genomic region corresponding to nucleotides 97887 to 100698 of the AD169 ge-

Received 9 November 2011 Accepted 2 December 2011 Published ahead of print 14 December 2011 Address correspondence to Wade A. Bresnahan, [email protected] * Present address: University of Wisconsin, McArdle Laboratory for Cancer Research, Madison, Wisconsin, USA. Copyright © 2012, American Society for Microbiology. All Rights Reserved. doi:10.1128/JVI.06776-11

jvi.asm.org

2011

Cygnar et al.

nome which contains the UL69 open reading frame (ORF) and ⬃300 bp of flanking sequence on both the 5= and 3= ends of the UL69 ORF. The PCR product was TA cloned into the pGEM-T Easy vector (Promega) to generate the pGEMT-UL69FR plasmid. To create the UL69-C496A, PP602/603AA, and E617A alanine substitution mutants, site-directed mutagenesis (Stratagene QuikChange kit) was performed according to the manufacturer’s instructions with the C496A-S (5=-CCTGCAGTGCC ACGAGGCTCAGAACGAGATGTGC-3=) and C496A-AS (5=-GCACAT CTCGTTCTGAGCCTCGTGGCACTGCAGG-3=), PP602/603AA-S (5=CCTCCCGCCCAGGCAGCGTCGCAACC-3=) and PP602/603AA-AS (5=-GGTTGCGACGCTGCCTGGGCGGGAGG-3=), and E617A-S (5=-G CGAGCTGGAAGCGGACGAAGACAGTG-3=) and E617A-AS (5=-CAC TGTCTTCGTCCGCTTCCAGCTCGC-3=) primer sets, respectively, using pGEMT-UL69FR as a template. The resulting constructs, termed pGEMT-UL69FR-C496A, pGEMT-UL69FR-PP602/03AA, and pGEMTUL69FR-E617A, were subsequently sequenced to verify the incorporation of the proper mutations. The individual pGEMT-UL69FR constructs were then digested with NotI and ligated into the pGS284 shuttling vector (21) that was also digested with NotI to generate the shuttle vectors pGS284-C496A, pGS284-PP602/603AA, and pGS284-E617A. Bacterial artificial chromosomes (BACs) containing the UL69-C496A, PP602/ 603AA, and E617A mutations were generated by standard allelic exchange protocols (21) using the pADCREGFP⌬UL69 BAC (4, 13) and shuttle vectors pGS284-C496A, PP602/603AA, and E617A, respectively. All BACs were screened by restriction enzyme digestion, and the UL69 ORFs were sequenced to verify proper incorporation of the specific mutations. Cell culture and virus propagation. Human foreskin fibroblast (HFF) cells and human embryonic kidney 293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (HyClone), 100 units/ml penicillin, and 100 ␮g/ml streptomycin in an atmosphere containing 5% CO2 at 37°C. Recombinant viruses were generated by cotransfecting purified BAC DNA and pCGNpp71 into UL69-complementing HFF cells as previously described (13) and harvesting the virus when the cells displayed a 100% cytopathic effect (CPE). Viral stocks were then generated by infecting noncomplementing cells at a high multiplicity, as described previously (9). The UL69 open reading frame was subsequently sequenced from the corresponding virus stocks to confirm that the proper mutations were incorporated and that no other mutations were present within the open reading frame. Expression plasmids. The URH49-HA expression vector was previously described (13). Hemagglutinin (HA)- and Flag-tagged UL69 and Flag-tagged eIF4a1 expression plasmids were generated using the pENTR/ D-TOPO kit (Invitrogen) to construct appropriate entry vectors. Each ORF was PCR amplified with gene-specific primers using Advantage HD polymerase (Clontech) with either wild-type or mutant pGEMT-UL69FR plasmids or the pOTB7-eIF4a1 cDNA plasmid (Open Biosystems) as the template. The PCR product was purified and cloned into the pENTR entry vector according to the manufacturer’s instructions. ORFs were then transferred to HA or Flag pCI-Neo Gateway-compatible destination vectors using LR Clonase II (Invitrogen) as previously described (19). The vectors were then sequenced to confirm the fidelity of each open reading frame. Immunoprecipitation and Western blotting. Immunoprecipitations and Western blotting were performed as previously described (13, 19). Briefly, 293T cells were transfected by the calcium phosphate method (Promega) or HFF cells were infected with virus as indicated below. Cells were lysed in NP-40 lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 10 mM EDTA [pH 8.0], 0.75% NP-40), and cellular debris was removed by centrifugation. Immunoprecipitations were performed by incubating 300 ␮g of total protein with the indicated antibodies for 3 h at 4°C. Protein complexes were collected on protein A/G agarose beads, washed three times with NP-40 lysis buffer, and separated by SDS-PAGE. Proteins were transferred to a nitrocellulose membrane (Optitran; Schleicher & Schuell) and probed with primary and secondary antibodies. Immunoreactive proteins

2012

jvi.asm.org

were detected by an enhanced chemiluminescence (ECL) system (Thermo Scientific). Heterokaryon shuttling assay. Heterokaryon assays were performed as previously described (13). Briefly, HFF cells were infected at a multiplicity of 0.5 PFU/cell with the indicated viruses. Murine 3T3 cells were overlaid on the infected HFF cells at 72 h postinfection and allowed to attach for 4 h. Cells were then incubated with DMEM containing cycloheximide (50 ␮g/ml) for 30 min and then fused with a 50% (wt/vol) solution of PEG-8000 in Hanks balanced salt solution (lacking Mg2⫹ and Ca2⫹) for 2 min. Cells were washed several times with phosphate-buffered saline (PBS) and incubated for 3 h with complete DMEM containing 50 ␮g/ml cycloheximide. Cells were then fixed in 4% paraformaldehyde, permeabilized, and stained for UL69 (T. Shenk, Princeton University) and UL44 (1202S; Rumbaugh Goodwin Institute). Immunofluorescence. HFF cells or heterokaryons on glass coverslips were washed in PBS and fixed with 4% paraformaldehyde at room temperature for 20 min. Cells were washed once with PBS and permeabilized with PBS-T (PBS, 0.1% Triton X-100, 0.05% Tween 20). Coverslips were incubated with blocking solution (PBS, 0.05% Tween 20, 0.5% bovine serum albumin [BSA], 1% goat serum) for 30 min at room temperature. Primary and secondary antibody incubations were performed in a humidified chamber at 37°C for 1 h each. Cells were stained with Hoechst, and coverslips were mounted onto slides with 90% glycerol. Images were captured on a Zeiss Axiovert 40 CFL microscope with a Jenoptik ProgRes C10 camera running ProgRes CapturePro v. 2.8.0 software. Lentivirus generation, shRNA knockdown, and cell viability assays. An SPT6 shRNA lentivirus vector was obtained from Open Biosystems (clone ID TRCN0000019732; full hairpin sequence, CCGGCGCCTTG TACTGTGAATTTATCTCGAGATAAATTCACAGTACAAGGCGTTT TT). Lentivirus was generated by cotransfecting lentivirus plasmid into HEK293T cells using Arrest-In transfection reagent and a proprietary packaging mixture (Open Biosytems) according to the manufacturer’s instructions. At 48 and 72 h posttransfection, lentivirus particles were collected from the cell supernatant, cleared of cell debris by centrifugation, filtered through a 0.45-␮m syringe filter, and stored at ⫺80°C. HFF cells were then transduced two times with lentivirus supplemented with 8 ␮g/ml Polybrene at 37°C for 3 h each time. Cells were washed with PBS, and the complete culture medium was placed back on the cells. Medium containing 1.5 ␮g/ml puromycin was added to the cells 24 h after transduction. Following 72 h of selection, the medium was replaced and the cells were used for the indicated experiments. To quantify SPT6 mRNA and protein levels, cell lysates were collected at 7 days posttransduction and assayed. Total RNA was isolated using TRIzol reagent. RNA was reverse transcribed using an oligo(dT) primer and Superscript II Reverse Transcriptase (RT) (Invitrogen) according to the manufacturer’s instructions. Transcript levels were quantitated by a QuantiFast Sybr green (Qiagen) quantitative PCR (qPCR) with SPT6-specific primers SPT6 RT-Fwd (TAGACAATGGTGTCACCGGCTTCA) and SPT6 RT-Rev (CATGATG CGGCAGTGAACACTCAT) on a Bio-Rad IQ5 real-time thermal cycler and analyzed using the IQ5 software. Protein lysates were collected and analyzed by Western blotting as described above. Cell viability of knockdown cells was examined by incubating knockdown cells (either 72 h or 7 days posttransduction) with 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl2H-tetrazolium bromide (MTT) reagent (Invitrogen) for 4 h at 37°C. Cells were then lysed with a 10% SDS and 0.01 M HCl solution and incubated for 2 h at 37°C. Absorbance values were read on a Molecular Devices plate reader set at 595 nm. Antibodies. The following antibodies were obtained from commercial sources and used for immunoprecipitations: rabbit polyclonal anti-SPT6 (803A; Bethyl Laboratories), mouse monoclonal anti-HA (16B12; Covance), and rabbit polyclonal anti-Flag (F7425; Sigma). The following antibodies were used for Western blotting: mouse monoclonal anti-IE1/2 (1203), mouse monoclonal anti-UL44 (1202S), and mouse monoclonal anti-UL99 (1207) (all from the Rumbaugh-Goodwin Institute), mouse monoclonal anti-HA (16B12; Covance), mouse monoclonal anti-Flag

Journal of Virology

UL69/SPT6 Interaction Required for HCMV Replication

(F1804; Sigma), rabbit polyclonal anti-SPT6 (801A; Bethyl Laboratories), and mouse anti-tubulin (TU-02) and mouse monoclonal anti-green fluorescent protein (GFP) (sc-9996) (both from Santa Cruz Biotechnology). The mouse monoclonal anti-UL69 antibody was provided by T. Shenk (Princeton University). Alexa Fluor 546-conjugated Fab2 goat antimouse or Alexa Fluor 488-conjugated Fab2 goat anti-rabbit antibodies (Molecular Probes) were used for immunofluorescence.

RESULTS

Previous reports have suggested that the interaction between UL69 and the cellular protein SPT6 is important for UL69 function (25). However, to date, there have been no studies examining what role UL69’s interaction with SPT6 plays during a productive HCMV infection. Therefore, we tested several UL69 mutants for their ability to bind SPT6 and determined if these mutants would support virus replication. To begin, we screened a panel of seven different UL69 mutants for their ability to interact with SPT6. The first mutant, termed C496A, contains a cysteine-to-alanine substitution at position 496 and has previously been described as an SPT6-binding mutant (25). We also tested two mutants termed PP602/603AA and E617A, which are alanine substitution mutants that have previously been described as nucleocytoplasmic shuttling mutants (14). In addition, we tested a mutant termed mUAP which contains 4 alanine substitutions at positions 22, 23, 25, and 26 and has previously been shown to abolish UL69’s ability to bind the cellular UAP56 and URH49 proteins (16). Finally, we tested three control mutants termed L503A, PP598/599AA, and ED619/ 620AA, all of which represent alanine substitution mutants at sites adjacent to the other mutations described (14). To assay for SPT6 binding, cells were transfected with expression constructs that express either HA-tagged wild-type UL69 or one of the UL69 mutants. Forty-eight hours posttransfection, cell lysates were harvested and immunoprecipitations were performed with an SPT6 antibody. Immune complexes were separated by SDS gel electrophoresis, transferred to nitrocellulose membranes, and analyzed by Western blotting using an anti-HA antibody to detect UL69. As shown in Fig. 1A, we identified two UL69 mutants that were unable to interact with SPT6. As expected, the C496A mutant was unable to bind SPT6 (lane 3). In addition, the previously described PP602/603AA shuttling mutant was also unable to bind SPT6 (lane 6). All other UL69 mutants tested retained their ability to interact with SPT6, including the E617A mutant. Like the PP602/ 603AA mutant, the E617A mutant was previously described as a shuttling mutant, suggesting that residues 602 and 603 may be involved in both SPT6 binding and shuttling activity. To determine if either of these functions are required for virus replication, we incorporated the C496A, PP602/603AA, and E617A mutations into the viral genome to generate individual UL69 viral mutants. Figure 1B depicts the UL69 ORF and the location of each specific mutation. These UL69 mutants were then assayed for viral replication, SPT6 binding activity, and shuttling activity. SPT6 binding correlates with viral replication. To generate the specific UL69 mutant viruses, we utilized a previously described system in which the UL69 ORF was replaced with a selection cassette containing both kanamycin resistance and LacZ genes by using allelic exchange protocols (13). This pAD⌬UL69 BAC was then used as the parental BAC to generate the specific UL69 point mutant BACs. The mutant BACs were then screened by restriction enzyme digestion, Southern blotting, and direct sequencing to verify that the mutations were properly inserted and

February 2012 Volume 86 Number 4

FIG 1 Identification of UL69 mutants unable to bind SPT6. (A) 293T cells were transfected with HA-tagged wild-type or mutant UL69 expression vectors. At 48 h posttransfection, protein lysates were collected and an equal amount of protein was immunoprecipitated (IP) with anti-SPT6 antibody. Immune complexes and cell lysates were separated by SDS-PAGE and analyzed by Western blotting. (B) Schematic representation of the UL69 ORF and location of the mUAP, C496A, PP602/603A, and E617A point mutations.

that no other subsequent mutations were incorporated into the UL69 open reading frame (data not shown). The viruses were reconstituted by transfecting mutant UL69 BAC DNA into complementing HFF cells and harvesting the viruses when a 100% cytopathic effect was observed (4, 13). Viral stocks were generated by infecting noncomplementing cells at a high multiplicity of infection, and the titers of the stocks were determined by plaque assay on complementing cells. Growth curves were then performed by infecting noncomplementing cells at a multiplicity of 0.01 PFU/cell with the wild-type, C496A, PP602/603AA, E617A, or ⌬UL69 virus or the appropriate revertant virus. Virus was harvested at the indicated times postinfection, and viral titers were determined by plaque assay on complementing cells. As shown in Fig. 2A and B, both the C496A and PP602/603AA mutants displayed a growth phenotype similar to that of the ⌬UL69 mutant. Replication of both the C496A and PP602/603AA mutants was reduced by approximately 2 logs compared to that of the wild-type virus. However, when the mutations were repaired, the C496A and PP602/603AA revertant viruses replicated to levels similar to that observed for the wild-type virus, demonstrating that the phenotype is not the result of a secondary mutation elsewhere in the genome. We observed no replication defect with the E617A mutant virus (Fig. 2C). We next examined the expression of several viral genes following infection with each virus. HFF cells were infected at a multiplicity of 0.01 PFU/cell and protein lysates were harvested at 24-h intervals for 5 days and assayed for UL69, IE1, IE2, UL44, and UL99 expression by Western blotting. There was a delay and decrease in UL69, UL44, and UL99 expression following infection with the ⌬UL69, C496A, and PP602/603AA mutants (Fig. 3A, middle panel) compared to that observed following infection with the wild-type virus. This delay and decrease in protein expression was not observed following infection with the ⌬UL69, C496A, and PP602/603AA revertant viruses (Fig. 3A, bottom panel). There was no significant difference in IE1 and IE2 expression levels at

jvi.asm.org 2013

Cygnar et al.

FIG 2 Growth curve analysis of UL69 mutant viruses. (A) HFF cells were

infected at a multiplicity of 0.01 PFU/cell with either the wild-type (), ⌬UL69 (Œ), C496A (), or C496A revertant (C496A-R) (p) virus. (B) HFF cells were infected at a multiplicity of 0.01 PFU/cell with either the wild-type (), ⌬UL69 (Œ), PP602/603AA (), or PP602/603AA revertant (p) virus. (C) HFF cells were infected at a multiplicity of 0.01 PFU/ml with either the wild-type (), ⌬UL69 (Œ), or E617A () mutant virus. Total virus was collected at the indicated days postinfection, and viral titers were determined by plaque assay on complementing cells. Results are the averages of three independent experiments.

early times after infection with any of the UL69 mutants compared to infection with the wild-type virus. However, as with the other proteins assayed, we observed an increase in IE1 and IE2 levels at late times postinfection in cells infected with the wild-type virus compared to infection with the ⌬UL69, C496A, and PP602/ 603AA mutants (Fig. 3A, top and middle panels). This delay and decrease in gene expression observed following infection with the ⌬UL69, C496A, and PP602/603AA mutants is likely due to the replication defect observed at 4 days postinfection (Fig. 2A and B)

2014

jvi.asm.org

and the viruses’ inability to efficiently spread to uninfected cells at late times after infection. To test this, we examined viral gene expression after infecting cells at a multiplicity of 3 PFU/cell where the UL69 growth defect is limited (9) and all cells are infected in a synchronous fashion. UL69 expression was again delayed and slightly lower at 36 and 72 h postinfection following infection with the C496A and PP602/603AA mutants (Fig. 3B, middle panel) compared to that observed following infection with the wild-type virus. However, by 108 h postinfection, UL69 protein levels were similar to those observed following wild-type infection. Levels of IE1, IE2, UL44, and UL99 expression observed following infection with the ⌬UL69, C496A, or PP602/603AA mutant were similar to those observed following infection with the wild-type virus (Fig. 3B, middle panel). These results suggest that the decreased protein levels observed at a multiplicity of 0.01 PFU/cell were largely due to the growth defect observed with these mutants and their inability to efficiently produce infectious virus and spread, rather than a defect in viral gene expression. Since we observed a delay and decrease in UL69 expression at both multiplicities, it raised the possibility that UL69 may be regulating its own transcription. To test this, we assayed for UL69 RNA abundance by qPCR following infection with either the wild-type virus, the C496A virus, or the PP602/603AA virus. We observed no significant difference in the levels of UL69 RNA abundance when comparing the C496A and PP602/603AA mutants to the wild-type virus (data not shown), suggesting that the delay in UL69 expression is not due to a defect in UL69 transcription. C496A and PP602/603AA mutants fail to interact with SPT6 during infection. We next assayed for UL69’s ability to bind SPT6 during infection. HFF cells were infected with wild-type, mutant, or revertant virus, and lysates were harvested 72 h postinfection and subjected to immunoprecipitation with an antibody against SPT6. As shown in Fig. 4, we could readily detect an interaction between UL69 and SPT6 in cells that had been infected with either the wild-type virus (lane 2), the E617A virus (lane 7), or the revertant viruses (lanes 4 and 6). However, we were unable to detect an interaction between SPT6 and UL69 in cells infected with the C496A (lane 3) or PP602/603AA (lane 5) mutants. We were also unable to detect an interaction between SPT6 and the UL99 viral protein following infection with any of the viruses, confirming the specificity of the SPT6/UL69 interaction. These data confirm the results obtained from the transient-transfection experiments (Fig. 1A) and suggest that the interaction between UL69 and SPT6 is important for efficient viral replication. UL69 mutants defective for SPT6 binding are defective for nucleocytoplasmic shuttling. The two mutants that inhibit UL69’s ability to interact with SPT6 also displayed a dramatic defect in viral replication. One of these mutants, PP602/603AA, has also been shown to be defective for shuttling activity in transient-transfection heterokaryon experiments (14). However, it is not known if the C496A mutant has a similar shuttling defect. This raised the possibility that the SPT6 interaction may be involved in supporting UL69 shuttling activity. We assayed the C496A, PP602/603AA, and E617A mutants for UL69 shuttling activity during virus infection. HFF cells were infected with either wild-type or mutant virus, and heterokaryon assays were done as previously described (13). At 72 h postinfection, HFF cells were fused with murine 3T3 fibroblasts to form heterokaryons. The cells were then fixed and stained with antibody against UL69 or the nonshuttling UL44 protein. Cells were also stained with

Journal of Virology

UL69/SPT6 Interaction Required for HCMV Replication

FIG 3 Viral protein expression following infection with UL69 mutant viruses. (A) HFF cells were infected at a multiplicity of 0.01 PFU/cell with either the wild-type, C496A, PP602/603AA, or E617A virus or a revertant virus (⌬UL69-R, etc.). Total protein was collected at the indicated days postinfection (dpi). Lysates were analyzed by Western blotting with the indicated antibodies. (B) HFF cells were infected at a multiplicity of 3 PFU/cell with either the wild-type, C496A, PP602/603AA, or E617A virus or a revertant virus. Total protein was collected at the indicated hours postinfection (hpi) and analyzed by Western blotting with the indicated antibodies.

Hoechst dye to allow for identification of both human and murine nuclei (a distinct punctate pattern is observed for murine nuclei; murine nuclei are indicated with white arrows). As shown in Fig. 5, UL69 was detected in both human and murine nuclei in heterokaryons formed following infection with wild-type virus. As ex-

FIG 4 UL69 mutants that display a growth defect are unable to bind SPT6. HFF cells were infected at a multiplicity of 3 PFU/cell with either the wild-type, C496A, PP602/603AA, or E617A virus or a revertant virus (C496A-R, etc.). Total protein was collected at 72 h postinfection, and an equal amount of protein was immunoprecipitated using an anti-SPT6 antibody. Immune complexes and cell lysates were separated by SDS-PAGE and analyzed by Western blotting.

February 2012 Volume 86 Number 4

pected, UL69 expressed from the PP602/603AA virus was retained solely within human nuclei and failed to shuttle to the murine nuclei within heterokaryons. The C496A virus also exhibited a defect in UL69 shuttling that was similar to that observed for the PP602/603AA virus. Surprisingly, UL69 expressed from the E617A virus was readily detected within murine nuclei of heterokaryons and displayed a shuttling phenotype similar to that of wild-type UL69. Infected heterokaryons were scored, and the quantitative results are shown at the bottom of Fig. 5. These results indicate that UL69 proteins expressed from the replicationdefective viruses are defective not only for SPT6 binding but also for shuttling activity. In contrast, the E617A virus retained wildtype levels of shuttling activity even though this mutation has previously been reported to inhibit shuttling activity in transienttransfection assays (14). Therefore, we also tested the PP602/ 603AA, E617A, and C496A mutants for shuttling activity following transient transfection of HFF cells. Like the results following infection, the PP602/603AA and C496A mutations inhibited shuttling activity, whereas the E617A mutation had no effect on UL69’s shuttling activity (data not shown). Taken together, our data suggest that the E617A mutant is fully functional and does not affect SPT6 binding, shuttling activity, or virus replication. PP602/603AA mutant retains its ability to bind other cellular proteins. Since UL69 proteins expressed from both the C496A and PP602/603AA mutants are defective for both SPT6 binding

jvi.asm.org 2015

Cygnar et al.

FIG 6 The PP602/603AA mutant retains its ability to bind other proteins. Cells were cotransfected with empty vector or Flag-tagged UL69 expression vectors and HA-tagged URH49, eIF4a1, or wild-type UL69 expression vectors. Total protein was collected and quantified 48 h postinfection. Immunoprecipitations were performed using the indicated antibodies. Immune complexes and cell lysates were separated by SDS-PAGE and analyzed by Western blotting.

FIG 5 UL69 mutants that display a growth defect lack shuttling activity. HFF cells were infected at a multiplicity of 0.5 PFU/cell with the indicated viruses. HFF cells were fused with 3T3 fibroblasts to form heterokaryons 72 h postinfection. Cells were fixed and stained for UL69 or UL44. Nuclei were visualized with Hoechst stain. Virally encoded GFP was used to aid in identifying infected heterokaryons. Murine nuclei are indicated with white arrows. The bar graph represents the quantitation of shuttling-positive heterokaryons.

and shuttling, it raised the possibility that these mutations are not specific for SPT6 binding and/or shuttling but rather are nonspecific mutations that may render the UL69 protein nonfunctional. To address this, we assayed these mutant proteins for their ability to interact with other UL69-binding proteins. Previous reports have demonstrated that UL69 interacts with the eukaryotic initiation factor 4a1 (eIF4a1) and the 49-kDa UAP56-related helicase (URH49) protein and is able to dimerize with itself. Unfortunately, we could not perform these assays in the context of an infection due to the lack of a URH49 antibody and the requirement that UL69 needs to be tagged with two different epitopes to

2016

jvi.asm.org

demonstrate dimerization. Therefore, we utilized cotransfection experiments to assay for UL69 binding to eIF4a1 and URH49 and its ability to dimerize. Cells were cotransfected with vectors expressing Flag-tagged wild-type, C496A, PP602/603AA, or E617A UL69 along with a vector expressing eIF4a1, HA-tagged URH49, or HA-tagged wild-type UL69. At 48 h posttransfection, cell lysates were harvested and coimmunoprecipitations were performed using the indicated antibodies. As shown in Fig. 6, the wild-type, PP602/603AA, and E617A UL69 proteins were capable of binding eIF4a1 and URH49. In addition, these mutants were all capable of dimerizing with wild-type UL69. However, we were unable to detect an interaction between C496A UL69 and any of the binding partners tested (Fig. 6). Identical results were obtained when the mutants were tested in a yeast two-hybrid assay for their ability to bind eIF4a1, URH49, and UL69 (data not shown). Cumulatively, our results suggest that the C496A mutation may result in a global functional defect in UL69 since this mutant was defective in every assay in which it was tested. Therefore, it is difficult to draw specific conclusions about the function of UL69 using this mutant. However, unlike the C496A mutation, the PP602/603AA mutations specifically abolished UL69’s interaction with SPT6 (Fig. 1A) while retaining its ability to interact with eIF4a1 and URH49 and dimerize with wild-type UL69 (Fig. 6). Furthermore, we conclude that residues 602 and 603 are required both for binding SPT6 and for UL69 shuttling activity.

Journal of Virology

UL69/SPT6 Interaction Required for HCMV Replication

FIG 7 Wild-type HCMV replication is impaired in SPT6-depleted HFFs. (A) HFF cells were transduced with lentivirus expressing either control (nonsilencing) or SPT6-specific shRNA. Seven days posttransduction, total RNA and protein were collected and assayed for SPT6 abundance. SPT6-specific RNA was quantified by qPCR and normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase). (B) HFF cells were transduced with either control (black bars) or SPT6 (gray bars) shRNA lentivirus. Cell viability was examined by MTT assay 72 h and 7 days posttransduction. (C) HFF cells were transduced with either control (black bars) or SPT6 (gray bars) shRNA lentivirus. Following selection, cells were infected at a multiplicity of 1.0, 0.1, or 0.01 PFU/cell with the wild-type, ⌬UL69, or PP602/603AA mutant virus. Total virus was collected at 7, 9, or 13 days postinfection, respective to multiplicity, and virus titers were determined by plaque assay. Results are the averages of three independent experiments. (D) Control or SPT6 knockdown (SPT6 KD) cells were infected at a multiplicity of 0.01 PFU/cell with the wild-type, ⌬UL69, or PP602/603AA virus. Cell lysates were harvested at 72 h postinfection and assayed for SPT6, IE1, IE2, and UL44 expression.

Knockdown of endogenous SPT6 inhibits wild-type HCMV replication. Since the PP602/603AA mutations affect UL69’s ability to interact with SPT6 and UL69’s shuttle activity, we could not use this mutant to definitively demonstrate the importance of SPT6 for viral replication. Therefore, we took an alternate experimental approach. Using shRNA-mediated knockdown, we examined what effect knockdown of endogenous SPT6 would have on replication of wild-type HCMV. If SPT6 is important for HCMV replication, we predicted that knocking down SPT6 expression would attenuate WT virus replication. To test this, HFF cells were transduced with lentivirus expressing either a control shRNA (nonsilencing) or SPT6-specific shRNA and selected with puromycin. Total RNA was collected at 7 days posttransduction, RNA was reverse transcribed, and SPT6 transcript levels were quantified by real-time PCR. SPT6 transcript levels were reduced by greater than 95% in the SPT6 knockdown cells compared to the control knockdown cells (Fig. 7A). SPT6 protein levels were also examined by Western blotting to confirm SPT6 knockdown. As shown in Fig. 7A, expression of SPT6 was dramatically reduced (⬃10-fold) in cells transduced with shRNA directed against SPT6 compared to that observed in the control knockdown cells. This demonstrates our ability to efficiently reduce the expression of SPT6 at both the transcript and protein levels. SPT6 is described as both an essential and nonessential gene in yeast cells depending on the species examined (1, 6, 22). However, it is not clear whether SPT6 is required for cell viability in mammalian cells. To examine

February 2012 Volume 86 Number 4

this, HFF cells were transduced with either control or SPT6 shRNA lentivirus and assayed for viability by MTT assay at both 3 and 7 days posttransduction. As shown in Fig. 7B, we observed no difference in cell viability between SPT6 and control knockdown cells at either 3 or 7 days posttransduction, demonstrating that knocking down expression of SPT6 did not affect cell viability. We next examined what effect knockdown of SPT6 has on viral replication. Control and SPT6 knockdown cells were infected with the wild-type, ⌬UL69, or PP602/603AA virus at a multiplicity of 1, 0.1, or 0.01 PFU/cell. Progeny virus was collected, and infectious virus titers were quantified by plaque assay. As shown in Fig. 7C, regardless of the multiplicity used, wild-type HCMV replication in SPT6 knockdown cells was reduced by greater than 90% compared to that in control knockdown cells. As expected, we observed an approximately 2-log reduction in titers for both the ⌬UL69 and PP602/603AA viruses on nonsilencing cells. Interestingly, we observed similar titers when SPT6 knockdown cells were infected with the UL69 deletion mutant or the PP602/603AA mutant virus, demonstrating that the knockdown cells are capable of supporting virus replication to the same levels as the nonsilencing cells. Cell lysates were also examined at 72 h postinfection by Western blotting to confirm the SPT6 knockdown and demonstrate that the knockdown cells were infected with virus. No differences in IE1, IE2, or UL44 expression were observed following infection with the indicated viruses on SPT6 knockdown cells relative to that observed following infection on control knockdown

jvi.asm.org 2017

Cygnar et al.

cells (Fig. 7D). Taken together, our data suggest that UL69’s interaction with SPT6 plays an important role in regulating HCMV replication. Knockdown of endogenous SPT6 does not affect UL69 shuttling activity. Since the PP602/603AA mutant affects both UL69’s ability to shuttle and its ability to interact with SPT6, it is possible that UL69’s shuttling activity may be linked to SPT6 binding. To address this, we assayed for UL69 shuttling activity following wildtype infection of SPT6 knockdown cells. First, we performed immunofluorescent staining on both control and SPT6 knockdown cells to determine the level and homogeneity of the SPT6 knockdown. As shown in Fig. 8A, we could readily detect SPT6 within the nucleus of control knockdown cells. However, we were unable to detect significant levels of SPT6 within cells expressing the SPT6 shRNA. Control and SPT6 knockdown cells were then infected with the wild-type virus and assayed for UL69 shuttling using the heterokaryon assay. As shown in Fig. 8B, UL69 was capable of shuttling to murine nuclei within heterokaryons formed in both control knockdown cells and SPT6 knockdown cells, suggesting that SPT6 may not be required for UL69 shuttling. Quantitative results are shown in Fig. 8C. DISCUSSION

The tegument protein UL69 has previously been shown to be required for efficient virus replication and to interact with multiple cellular and viral proteins (2, 16, 20, 23, 25). However, it is not clear which of these interactions contribute to virus replication. In this report, we have utilized a number of UL69 viral mutants and shRNA knockdown technology to examine the functional significance of UL69’s interaction with SPT6 during HCMV infection. A number of point mutants have been described that negatively affect various UL69 functions, including its ability to shuttle between the nucleus and cytoplasm and to interact with various cellular proteins (14, 16, 25). However, many of these mutants have not been tested for their ability to interact with SPT6 or assayed for their effect on viral replication. Therefore, we examined a panel of UL69 mutants to identify mutations that inhibit UL69’s ability to bind SPT6 (Fig. 1A). Using this approach, we identified two UL69 mutants that abolished binding to SPT6. As expected, the C496A mutant was unable to bind SPT6. This mutation has previously been shown to block UL69’s ability to interact with SPT6 in yeast two-hybrid studies (25). The second mutant unable to bind SPT6 was the PP602/603AA mutant, which has also been described as a UL69 shuttling mutant (14). All other mutants tested retained their ability to interact with SPT6, including the E617A mutant, which has also been described as a shuttling mutant (14). These results suggested that UL69’s shuttling activity may be linked to its ability to bind SPT6 and that we may be able to separate these two activities. Therefore, we focused on the C496A, PP602/603AA, and E617A mutants for further characterization. We incorporated these three different UL69 mutants into the viral genome and examined the replication phenotype of each recombinant virus. Replication of the C496A and PP602/603AA mutants was severely impaired and paralleled that of the UL69 deletion mutant (Fig. 2A and B), suggesting that UL69’s interaction with SPT6 is important for viral replication. In support of this was the fact that the E617A mutant, which retained its ability to bind SPT6, replicated to wildtype levels (Fig. 2C). Unexpectedly, the two predicted shuttling mutants (PP602/603AA and E617A) displayed opposite growth

2018

jvi.asm.org

FIG 8 Knockdown of SPT6 does not inhibit UL69 shuttling activity. (A) HFF cells were transduced with lentivirus expressing either control or SPT6-specific shRNA. At 72 h posttransduction, cells were fixed and stained for SPT6. Nuclei were visualized by Hoechst staining. (B) HFF cells were transduced with either control or SPT6 shRNA lentivirus. Knockdown cells were infected with wildtype HCMV at a multiplicity of 0.5 PFU/cell. At 72 h postinfection, heterokaryon analysis was performed as described. Virally encoded GFP was used to aid identification of infected heterokaryons, and murine nuclei are indicated with white arrows. (C) The bar graph shows quantitation of shuttling-positive heterokaryons on control or SPT6 knockdown cells.

phenotypes. Given the differences in the growth phenotypes between the PP602/603AA and E617A mutants, we examined the ability of all three mutants to shuttle between the nucleus and cytoplasm of infected cells. As expected, the PP602/603AA mutant was defective for shuttling activity, but surprisingly, the C496A mutant exhibited a similar defect (Fig. 5). However, UL69 expressed from the E617A mutant was fully capable of shuttling between the nucleus and cytoplasm during infection (Fig. 5). We also tested the three mutants for their ability to shuttle following transient transfection of HFF cells. Like the results following in-

Journal of Virology

UL69/SPT6 Interaction Required for HCMV Replication

fection, the PP602/603AA and C496A mutations inhibited shuttling, whereas the E617A mutation had no effect on UL69’s shuttling activity (data not shown). The reason for the discrepancy between our results and those previously published for the shuttling activity of the E617A mutation is currently unknown but could be due to the use of different cell types or expression vectors in the heterokaryon assay. However, the entire UL69 open reading frame from the E617A mutant virus and expression plasmid was sequenced to confirm the specific point mutation and rule out the possibility of a secondary mutation elsewhere in the ORF. Our findings clearly demonstrate that the E617A mutation has no effect on viral replication, UL69 shuttling activity, SPT6 binding, or UL69’s ability to interact with eIF4a1, URH49, or wild-type UL69. Since both the C496A and PP602/603AA mutant viruses displayed growth phenotypes similar to the UL69 deletion mutant and both were inhibited for SPT6 binding and shuttling activity, it raised the possibility that these mutations may render the UL69 protein nonfunctional. We tested this possibility by assaying each of the UL69 mutants for their ability to interact with other cellular proteins that have previously been shown to bind UL69. Not only was the C496A mutant unable to interact with SPT6 (Fig. 1A), but it was also unable to interact with URH49 and eIF4a1 or dimerize with wild-type UL69 (Fig. 6). These results suggest that mutation of amino acid 496 within UL69 may render the protein nonfunctional since this mutant was defective in every assay tested. However, we cannot rule out the possibility that this protein remains functional in other assays. The reason for this defect is unclear. We did observe a decrease in expression levels of the C496A UL69 protein following either transient transfection or infection (Fig. 1A and Fig. 3), suggesting that this mutation may affect the stability of the UL69 protein. In addition, the C496A mutation lies within the region that has been predicted to be required for UL69 dimerization and/or multimerization (15). Therefore, it is possible that UL69’s ability to dimerize may be required for its function and/or its ability to form protein interactions. Unlike the C496A mutant, the PP602/603AA mutant retained its ability to interact with URH49 and eIF4a1 and its ability to dimerize with wild-type UL69, demonstrating that these mutations do not render the UL69 protein nonfunctional. It also demonstrates that the PP602/ 603AA mutations represent specific mutations that block SPT6 binding. It also suggests that the SPT6-binding domain within UL69 encompasses a region that includes amino acids 602 and 603. Interestingly, we also observed lower protein levels at early times postinfection with the PP602/603AA mutant virus. However, unlike with the C496A mutant, there was no defect in expression levels following transient transfection (Fig. 1A). The decreased levels are not due to a defect in UL69 transcription since we observed similar levels of UL69 transcripts when comparing wild-type infection to PP602/603AA infection (data not shown). One possibility for the decreased protein levels is that the interaction between UL69 and SPT6 helps to stabilize the UL69 protein. Therefore, in the absence of SPT6 binding following infection with the PP602/603AA mutant, the stability of UL69 may be altered. Finally, the protein interaction results with the PP602/ 603AA mutant support our previous findings that demonstrated that UL69’s interaction with URH49 is dispensable for virus replication (13). They also suggest that UL69’s interaction with eIF4a1 may not be required for efficient virus replication, since the PP602/603AA mutant still retains its ability to bind eIF4a1 but

February 2012 Volume 86 Number 4

demonstrates a growth phenotype identical to that of the UL69 deletion mutant. Since abolishing UL69’s interaction with SPT6 correlated with a loss of shuttling activity, it is tempting to speculate that UL69’s interaction with SPT6 is required not only for viral replication but also for UL69 shuttling activity. To test this, we assayed for viral replication and shuttling activity following infection of SPT6 knockdown cells with wild-type HCMV. Knockdown of SPT6 did not affect UL69’s ability to shuttle during infection, suggesting that the interaction is not required for shuttling activity (Fig. 8B). However, caution should be taken when interpreting this result. SPT6 knockdown resulted in a significant reduction in available SPT6 protein but did not result in a complete loss of SPT6 (Fig. 7A). Therefore, it is possible that the residual amount of SPT6 protein remaining after knockdown is below the limit of detection by immunofluorescent staining but sufficient to allow for UL69 shuttling activity. Alternatively, murine SPT6 may compensate for the loss of human SPT6 upon heterokaryon formation, thereby allowing UL69 to shuttle in this assay. While these data suggest these functions may not be linked, further studies will need to be performed to confirm that UL69 shuttling is independent of the SPT6 interaction. However, knockdown of SPT6 inhibited wild-type replication by greater than 90%, underscoring the importance of SPT6 in HCMV replication. The mechanism by which SPT6’s interaction with UL69 regulates viral replication is still uncertain. SPT6 functions as both a chromatin remodeling protein and a transcriptional elongation factor. Therefore, it is likely that the interaction between UL69 and SPT6 is critical for regulating the rate of transcription that occurs on individual viral or cellular genes or that the interaction is required for the proper chromatin modifications needed to allow for efficient gene expression. Further studies will be required to address these possibilities. Regardless of the mechanism, our results demonstrate that the interaction between UL69 and SPT6 plays an important role in controlling HCMV replication. ACKNOWLEDGMENTS We are grateful to Tom Shenk (Princeton) for the monoclonal antibody recognizing UL69. We thank Steve Rice and Stacia Phillips for helpful discussions and for critically reading the manuscript. This work was supported by NIH grant AI059340 (to W.A.B).

REFERENCES 1. Al-Rawi N, Laforce-Nesbitt SS, Bliss JM. 2010. Deletion of Candida albicans SPT6 is not lethal but results in defective hyphal growth. Fungal Genet. Biol. 47:288 –296. 2. Aoyagi M, Gaspar M, Shenk TE. 2010. Human cytomegalovirus UL69 protein facilitates translation by associating with the mRNA cap-binding complex and excluding 4EBP1. Proc. Natl. Acad. Sci. U. S. A. 107:2640 – 2645. 3. Bortvin A, Winston F. 1996. Evidence that Spt6p controls chromatin structure by a direct interaction with histones. Science 272:1473–1476. 4. Cantrell SR, Bresnahan WA. 2006. Human cytomegalovirus (HCMV) UL82 gene product (pp71) relieves hDaxx-mediated repression of HCMV replication. J. Virol. 80:6188 – 6191. 5. Chiang PW, et al. 1996. Identification and analysis of the human and murine putative chromatin structure regulator SUPT6H and Supt6h. Genomics 34:328 –333. 6. Clark-Adams CD, Winston F. 1987. The SPT6 gene is essential for growth and is required for delta-mediated transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 7:679 – 686. 7. Endoh M, et al. 2004. Human Spt6 stimulates transcription elongation by RNA polymerase II in vitro. Mol. Cell. Biol. 24:3324 –3336.

jvi.asm.org 2019

Cygnar et al.

8. Hartzog GA, Wada T, Handa H, Winston F. 1998. Evidence that Spt4, Spt5, and Spt6 control transcription elongation by RNA polymerase II in Saccharomyces cerevisiae. Genes Dev. 12:357–369. 9. Hayashi ML, Blankenship C, Shenk T. 2000. Human cytomegalovirus UL69 protein is required for efficient accumulation of infected cells in the G1 phase of the cell cycle. Proc. Natl. Acad. Sci. U. S. A. 97:2692–2696. 10. Kalejta RF. 2008. Functions of human cytomegalovirus tegument proteins prior to immediate early gene expression. Curr. Top. Microbiol. Immunol. 325:101–115. 11. Kalejta RF. 2008. Tegument proteins of human cytomegalovirus. Microbiol. Mol. Biol. Rev. 72:249 –265. 12. Kaplan CD, Morris JR, Wu C, Winston F. 2000. Spt5 and Spt6 are associated with active transcription and have characteristics of general elongation factors in D. melanogaster. Genes Dev. 14:2623–2634. 13. Kronemann D, Hagemeier SR, Cygnar D, Phillips S, Bresnahan WA. 2010. Binding of the human cytomegalovirus (HCMV) tegument protein UL69 to UAP56/URH49 is not required for efficient replication of HCMV. J. Virol. 84:9649 –9654. 14. Lischka P, Rosorius O, Trommer E, Stamminger T. 2001. A novel transferable nuclear export signal mediates CRM1-independent nucleocytoplasmic shuttling of the human cytomegalovirus transactivator protein pUL69. EMBO J. 20:7271–7283. 15. Lischka P, Thomas M, Toth Z, Mueller R, Stamminger T. 2007. Multimerization of human cytomegalovirus regulatory protein UL69 via a domain that is conserved within its herpesvirus homologues. J. Gen. Virol. 88:405– 410. 16. Lischka P, Toth Z, Thomas M, Mueller R, Stamminger T. 2006. The UL69 transactivator protein of human cytomegalovirus interacts with DEXD/H-Box RNA helicase UAP56 to promote cytoplasmic accumulation of unspliced RNA. Mol. Cell. Biol. 26:1631–1643. 17. Lu M, Shenk T. 1999. Human cytomegalovirus UL69 protein induces cells to accumulate in G1 phase of the cell cycle. J. Virol. 73:676 – 683.

2020

jvi.asm.org

18. Pass R. 2001. Cytomegalovirus, p 2675–2706. In Knipe DM, et al (ed), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, PA. 19. Phillips SL, Bresnahan WA. 2011. Identification of binary interactions between human cytomegalovirus virion proteins. J. Virol. 85:440 – 447. 20. Rechter S, et al. 2009. Cyclin-dependent kinases phosphorylate the cytomegalovirus RNA export protein pUL69 and modulate its nuclear localization and activity. J. Biol. Chem. 284:8605– 8613. 21. Smith GA, Enquist LW. 1999. Construction and transposon mutagenesis in Escherichia coli of a full-length infectious clone of pseudorabies virus, an alphaherpesvirus. J. Virol. 73:6405– 6414. 22. Swanson MS, Winston F. 1992. SPT4, SPT5 and SPT6 interactions: effects on transcription and viability in Saccharomyces cerevisiae. Genetics 132:325–336. 23. Thomas M, et al. 2009. Cytomegaloviral protein kinase pUL97 interacts with the nuclear mRNA export factor pUL69 to modulate its intranuclear localization and activity. J. Gen. Virol. 90:567–578. 24. Toth Z, Lischka P, Stamminger T. 2006. RNA-binding of the human cytomegalovirus transactivator protein UL69, mediated by arginine-rich motifs, is not required for nuclear export of unspliced RNA. Nucleic Acids Res. 34:1237–1249. 25. Winkler M, aus dem Siepen T, Stamminger T. 2000. Functional interaction between pleiotropic transactivator pUL69 of human cytomegalovirus and the human homolog of yeast chromatin regulatory protein SPT6. J. Virol. 74:8053– 8064. 26. Winkler M, Rice SA, Stamminger T. 1994. UL69 of human cytomegalovirus, an open reading frame with homology to ICP27 of herpes simplex virus, encodes a transactivator of gene expression. J. Virol. 68:3943–3954. 27. Yoh SM, Cho H, Pickle L, Evans RM, Jones KA. 2007. The Spt6 SH2 domain binds Ser2-P RNAPII to direct Iws1-dependent mRNA splicing and export. Genes Dev. 21:160 –174.

Journal of Virology

Suggest Documents