Behav Genet (2014) 44:155–164 DOI 10.1007/s10519-014-9643-0
ORIGINAL RESEARCH
The Drosophila Small GTPase Rac2 is Required for Normal Feeding and Mating Behaviour Philip Goergen • Anna Kasagiannis • Helgi B. Schio¨th • Michael J. Williams
Received: 3 July 2013 / Accepted: 17 January 2014 / Published online: 1 February 2014 Ó Springer Science+Business Media New York 2014
Abstract All multicellular organisms require the ability to regulate bodily processes in order to maintain a stable condition, which necessitates fluctuations in internal metabolics, as well as modifications of outward behaviour. Understanding the genetics behind this modulation is important as a general model for the metabolic modification of behaviour. This study demonstrates that the activity of the small GTPase Rac2 is required in Drosophila for the proper regulation of lipid storage and feeding behaviour, as well as aggression and mating behaviours. Rac2 mutant males and females are susceptible to starvation and contain considerably less lipids than controls. Furthermore, Rac2 mutants also have disrupted feeding behaviour, eating fewer but larger meals than controls. Intriguingly, Rac2 mutant males rarely initiate aggressive behaviour and display significantly increased levels of courtship behaviour towards other males and mated females. From these results
Edited by Charalambos Kyriacou. P. Goergen M. J. Williams Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen, UK Present Address: P. Goergen H. B. Schio¨th M. J. Williams Functional Pharmacology, Department of Neuroscience, Uppsala University, Uppsala, Sweden A. Kasagiannis Department of Neuroscience, Uppsala University, Uppsala, Sweden M. J. Williams (&) Department of Neuroscience, Biomedical Center, Box 593, 75 124 Uppsala, Sweden e-mail:
[email protected]
we conclude that Rac2 has a central role in regulating the Drosophila homeostatic system. Keywords Aggression Mating behaviour Rho GTPase Feeding behaviour Lipid homeostasis
Introduction The cost of aggressive behaviour includes increased energy use, increased risks of injuries and increased exposure to predators. When the costs of aggression are not balanced by the benefits, an alternative strategy, called the opportunistic or ‘diplomat’ approach, could be employed (Belsare et al. 2010; Popova 2006). Less aggressive, subordinate or submissive males do not compete for access to females, but instead sneak-mate opportunistically. This diplomatic approach can also be effective in terms of access to food. Although male aggression and its alternatives have been studied extensively in the context of behavioural evolution, the inter-regulation between an animal’s behaviour and its physiology, especially the physiological costs or benefits of a particular behaviour, remain largely unknown. The genetically tractable model organism Drosophila melanogaster is a good system for studying the interactions between metabolism and overt behaviours, and has already shown that a large repertoire of G protein-coupled receptor (GPCR) pathways control both behaviour and metabolism (Dierick and Greenspan 2007; Zhou et al. 2008; Wang and Anderson 2010; Certel et al. 2010; Alekseyenko et al. 2010; Alekseyenko et al. 2013; So¨derberg et al. 2012; Luo et al. 2012). Yet, how these diverse GPCR signalling pathways coordinate to integrate behaviour and metabolism in order to maintain a homeostatic condition is still not completely understood.
123
156
It would be prudent to study the GPCR signalling pathways that regulate metabolism and behaviour in order to gain a better understanding of possible interactions between an organism’s internal and external cues. In Drosophila Arrestin2 interacts with and regulates the desensitisation of a number of GPCRs known to control metabolism and behaviour (Johnson et al. 2003). Interestingly, it was recently determined that the small GTPase Rac2 is necessary for the proper localization of Arrestin2 after NinaE activation (Elsaesser et al. 2010). NinaE, a Rhodopsin-like GPCR, is required for the visualization of visible light (Mitra et al. 2011). Like many GPCRs, once activated NinaE is phosphorylated, bound by Arrestin2 and recycled from the plasma membrane (Elsaesser et al. 2010). This desensitization is necessary for continued signalling, without which the system would quickly become saturated and shutdown. A large-scale RNAi screen discovered that Rac2 knockdown flies had significantly less stored lipids than controls (Pospisilik et al. 2010), and the current plan was to ascertain if Rac2 is involved in regulating Drosophila metabolism. We determined that Rac2 is necessary for proper lipid storage and this lack of lipids make Rac2 mutants more susceptible to starvation. Furthermore, we show that Rac2 is also necessary for proper feeding behaviour in adult males. Finally, we determined that Rac2 mutant males are less aggressive than control flies and display aberrant courtship behaviour towards both males and mated females.
Results Rac2 mutants are susceptible to starvation The null mutant Rac2D has the genetic marker rosy (ry) in the background, which is known to have a strong starvation phenotype, possibly due to a lower lipid content (Hardeland et al. 2003; Fajardo et al. 1995), due to this fact we decided to include another Rac2 mutant, Rac2DG19808, in our studies. This allele has a hobo element inserted in the Rac2 50 UTR and has not been characterised previously. To clarify if Rac2DG19808 was a mutant, we performed quantitative real time PCR (qPCR) to measure the level of Rac2 transcript (Fig. 1a). Compared with Rac2DG19808 heterozygous controls, Rac2DG19808 homozygous mutants had only 38.6 % (SE ± 7.8, P \ 0.005) of the normal Rac2 RNA expression levels, meaning that Rac2DG19808 was a hypomorphic mutant. We have used Rac2DG19808 for the feeding and metabolic studies but included both Rac2D and Rac2DG19808 for the aggressive and mating behaviour assays. Recently, it was discovered in a large-scale RNAi screen that Rac2 knockdown flies had significantly less stored lipids than controls (Pospisilik et al. 2010). Also, we noticed that Rac2DG19808 and Rac2D mutant males
123
Behav Genet (2014) 44:155–164
appeared thinner than equally aged controls. In particular their abdomens were thinner than controls (data not shown). A starvation resistance assay was performed to begin to test the idea that Rac2 was involved in lipid homeostasis. To carry out the assay, twenty 5–7 day old male or female flies, maintained on standard lab food (see materials and methods), were placed in a vial containing 1 % agarose, this meant the flies could obtain water but no caloric value. Since Rac2DG19808 was in a white (w1118) genetic background, w1118 flies were used as controls. The vials were maintained at 25 °C and the number of dead flies was counted every 12 h until all had expired. Using this method control males had a median survival time of 68 h (SE ± 3.5), heterozygous Rac2DG19808 mutants had a median survival time of 67.5 h (SE ± 3.8, P = 0.83), while Rac2DG19808 homozygous males had a median survival time of only 41 h (SE ± 4.9, P \ 0.005) (Fig. 1b). To determine whether the starvation defect was specific to males we also performed this assay using females. Control females had a median survival time of 71 h (SE ± 5.4) and heterozygous Rac2DG19808 mutants a time of 113 h (SE ± 14.4, P \ 0.005), which was significantly higher than controls, although the average total survival time for the two strains was the same (132 h). Rac2DG19808 homozygous females had a median survival time of only 55 h (SE ± 4.4, P \ 0.005) (Fig. 1b). The Rac2DG19808 susceptibility to starvation could be due to a lack of stored lipids, to test this possibility ethyl ether extraction was employed to measure total lipid content. Using this method it was discovered that control w1118 males contained 160 lg (SE ± 20) of total lipids per fly, and Rac2DG19808 heterozygous males had a total lipid content of 145 lg (SE ± 18, P = 0.72) (Fig. 1c). The total lipid content of Rac2DG19808 homozygous males, on the other hand, was only 48 lg (SE ± 25, P \ 0.005) per fly. Similar results were obtained for females, where control females had a total lipid content of 170 lg (SE ± 16) and Rac2DG19808 heterozygous females had 163 lg (SE ± 23, P = 0.87), while homozygous Rac2DG19808 females contained a significantly lower total lipid content (90 lg, SE ± 12, P \ 0.005) (Fig. 1c). Rac2 required for normal feeding behaviour So far we determined that Rac2 influenced starvation resistance and affected lipid storage. A CAFE assay was performed to measure how much food flies fed ad lib consumed during a 24 h period (Ja et al. 2007). When the total food intake was measured control w1118 males ate 567 nl (SE ± 116) and Rac2DG19808 heterozygous males ate 526 nl (SE ± 123), during this same time period Rac2DG19808 homozygous males did not consume a significantly different volume of food (571 nl, SE ± 115,
Behav Genet (2014) 44:155–164
157
Fig. 1 Rac2 is necessary for proper lipid storage. a Relative level of Rac2 expression in Rac2DG19808 heterozygous controls and homozygous mutant males. Upon eclosion flies were aged for 5–7 days at 25 °C. This assay was repeated at least 7 times. **P \ 0.005 compared with control, one-way ANOVA. b To test the ability of the various mutants to survive starvation 5–7 day old male or female flies were place in a vial containing 1 % agarose and maintained at 25 °C. All flies were kept on a 12:12 light:dark cycle at 25 °C. Percent survival was calculated every 12 h. (n = 100 flies per genotype;
*P \ 0.05, **P \ 0.005 compared with controls, one-way ANOVA with Bonferroni post hoc test for multiple comparisons). c Total lipid content for males and females was determined using ethyl ether extraction (see ‘‘Materials and Methods’’ section). Initial weight (dry weight before extraction) - final weight (dry weight after extraction)/ total number of flies = Total lipid content per fly in lg. (n = 100 flies per genotype; *P \ 0.05, **P \ 0.005 compared with controls, one-way ANOVA with Bonferroni post hoc test for multiple comparisons)
P = 0.97) (Fig. 2a). While the CAFE assay was being performed the flies were also videoed, allowing us to determine both the number of feeding bouts and the average meal size per fly. While w1118 control males had 16.4 feeding bouts (SE ± 3.1) over a 24 h period and Rac2DG19808 heterozygous males had 15.9 bouts (SE ± 2.9), Rac2DG19808 homozygous males had significantly fewer feeding bouts (6.9, SE ± 1.9, P \ 0.05) (Fig. 2b). Control flies ate on average 39 nl per meal (SE ± 11), Rac2DG19808 heterozygous males ate 33 nl (SE ± 12) and Rac2DG19808 homozygous males consumed considerably larger meals (112 nl, SE ± 29, P \ 0.05) (Fig. 2c). Another possibility for the lower lipid levels in the Rac2 flies could be a significant change in activity. To test this controls, Rac2DG19808 or Rac2D mutant males were put in a behavioural activity chamber, either alone, with a Csorc lab-strain wild-type male (see ‘‘Materials and Methods’’
section) or with a Csorc virgin female, and their activity was recorded for 30 min. Activity was assessed as the percentage of time a male was actively walking. When single males were introduced into the chamber, no significant difference was observed between controls and Rac2 mutant males (Fig. 2d). Yet when Rac2 mutant males were paired together with another male (Rac2DG19808 = 82 %, SE ± 4.0, P \ 0.05, Rac2D = 88 %, SE ± 3.5, P \ 0.05) or a virgin female (Rac2DG19808 = 78 %, SE ± 3.7, P \ 0.05, Rac2D = 82 %, SE ± 4.1, P \ 0.05) they were significantly more active than control males (male–male interactions: w1118 = 62 %, SE ± 4.0, Rac2DG19808?/- = 58 %, SE ± 2.3, Rac2D?/- = 60 %, SE ± 4.4; male– female: w1118 = 51 %, SE ± 2.4, Rac2DG19808?/- = 60 %, SE ± 2.7, Rac2D?/- = 56 %, SE ± 2.1). From these results we conclude that Rac2 mutant males are hyperactive in the presence of another fly, possibly due to a
123
158
Behav Genet (2014) 44:155–164
Fig. 2 Rac2 regulates feeding behaviour. A CAFE assay was used to assess the average a food intake, b number of feeding bouts and c meal size over a 24 h period in 5–7 days old adult males. Five males were used for each replicate and the assay was repeated at least 10 times for each genotype. (n = 50 males per genotype; *P \ 0.05 compared with controls, one-way ANOVA with Bonferroni post hoc test for multiple comparisons) d Activity assay: 5–7 day old control
or Rac2 mutant males were placed in a behavioural chamber, either alone, with a Csorc wild-type male or a Csorc virgin female, and the percentage of time over a 30 min period that either males were actively moving was recorded (n = 25 males per genotype; *P \ 0.05 compared with controls, one-way ANOVA with Bonferroni post hoc test for multiple comparisons)
misregulation of their natural aggressive and mating behaviours.
with a leg (shoving), or quick wing flicking (wing flick); high intensity fighting (HIF) was graded as lunging (lunging), boxing face-to-face with the two front legs (boxing), as well as holding the wings up at a 30°–45° angle (wing threat). Courtship behaviour was marked as one-wing extended at a 90° angle (singing), circling to the posterior (circling), or bending the abdomen towards the other fly (abdomen bending). When it came to HIF behaviours there was no significant difference between controls, Rac1 and Rac2 mutant males. However, there was a significant difference between controls and Rac2 mutants when it came to the type of LIF behaviours performed (Fig. 3a). Rac2DG19808 (82.0, SE ± 2.0, P \ 0.005) and Rac2D (62.0, SE ± 2.4, P \ 0.005) homozygous males performed significantly more wing flicks over a 20 min fighting bout than either w1118 controls (30.7, SE ± 2.2), Rac2DG19808 heterozygous males (18.0, SE ± 1.0) or Rac2D (28.0, SE ± 2.6) heterozygous males (Fig. 3a). On the other hand, Rac2DG19808 (8.0, SE ± 0.02, P \ 0.005) and Rac2D (14, SE ± 0.8, P \ 0.005) homozygous males performed significantly fewer shoves than w1118 controls (30.0, SE ± 2.4),
Rac2 is involved in regulating male–male interactions To begin to understand if the Rac GTPases were involved in regulating Drosophila male behaviour an aggression assay was performed. Aggression analysis experiments were executed by placing pairs of 5–7 day old males, raised in isolation, in a behavioural assay chamber, containing 1 % agarose, and their interactions were monitored over a 20 min period. The total number of interactions for each fly was recorded, whether it involved aggressive or courtship behaviour. Assays were performed on both Rac1 and Rac2 mutants to ascertain if a deficiency in either gene had an effect on male aggression. Rac1J11 contains a point mutation creating a hypomorphic allele, while Rac2D is an amorphic null allele (Hakeda-Suzuki et al. 2002; Ng et al. 2002). The assayed male–male interactions consisted of eight distinct behaviours. Aggressive interactions were scored as either low or high-intensity engagements. Low intensity fighting (LIF) was scored as side-by-side pushing
123
Behav Genet (2014) 44:155–164
159
Fig. 3 The small GTPase Rac2 regulates male aggression. a Total interactions that were either high or low intensity aggression, or courtship behaviour in controls, Rac1 and Rac2 mutant males were determined. All males were between 5 and 7 days old. The types of behaviours were distributed into three catagories, HIF, LIF and courtship behaviour (CB) and the number of each type of behaviour
performed is represented. In all instances the assay was repeated at least 10 times. (n = 20 males/treatment; *P \ 0.05, **P \ 0.005 compared with controls, two-way ANOVA with Bonferroni post hoc test for multiple comparisons). b Still captures from videos showing Rac2DG19808 males performing various courtship behaviours. Arrow indicates pursued male, arrowhead indicates courting male
Rac2DG19808 heterozygous males (22.6, SE ± 2.6) or Rac2D (22.0, SE ± 1.8) heterozygous males (Fig. 3c). Finally, loss of Rac2 had a significant effect on all scored mating behaviours. Compared to w1118 males (4.0, SE ± 0.8), Rac2DG19808 heterozygous males (5.0, SE ± 0.4) or Rac2D (6.3, SE ± 1.0) heterozygous males, Rac2DG19808 (48.0, SE ± 3.2, P \ 0.005) and Rac2D (45.0, SE ± 3.3, P \ 0.005) homozygous males performed significantly more singing behaviours (Fig. 3a). Rac2DG19808 and Rac2D homozygous males also performed more circling manoeuvres than controls, and unlike controls they performed abdomen bends towards other males (Fig. 3a). Interestingly, when individual courtship behaviours were scored, Rac2 mutants displayed all behaviours males would normally present towards virgin females, including, singing, circling, tapping of the abdomen, licking the genitalia and bending their abdomen (Fig. 3b). Intriguingly, even though the Rac2 mutant males performed significantly more courtship behaviours than controls, they were not less aggressive (Fig. 3a). Upon closer inspection of the individual performance of each Rac2 male placed in the behaviour assay chamber, it was discovered that the courting, or following, male never initiated
aggressive interactions (Fig. 3b, arrowhead). All HIF and LIF behaviours were instigated by the fly being pursued (Fig. 3b, arrow). To determine whether the Rac2 mutant males, unless otherwise provoked by a courting male, would ever initiate aggressive interactions, one Rac2DG19808 or Rac2D mutant male was placed into the behavioural assay chamber with either another mutant male of the same genotype or a wild-type male and they were monitored as before. In this instance, since there has been debate on the aggressive capabilities of white eyed mutants we used our lab wild-type Csorc strain for the control males (Alekseyenko et al. 2010; Hoyer et al. 2008). As seen previously, when two homozygous Rac2DG19808 or Rac2D males were placed in the assay chamber, the leading (pursued) male initially displayed wing flicks, The wing flicks could eventually evolve into HIF behaviours, including wing threats, lunges and fencing encounters, and the number of HIF behaviours was similar to controls, 42.2 (SE ± 6.0) and 45.1 (SE ± 6.0), respectively (Fig. 4a). In contrast, when paired with a wild-type male, the Rac2 mutants were now always the courting male and the overall number of HIF behaviours was significantly lower than when two Rac2 males were paired together. The number of
123
160
Behav Genet (2014) 44:155–164
Fig. 4 Rac2 mutant males rarely initiate aggressive behaviour. To test the aggressiveness of Rac2 mutant males they were paired with either another Rac2 mutant male, or with a wild type Csorc male, and an aggression assay was performed. a–c The number of interactions that were either high or low intensity aggression, or courtship behaviour in controls and Rac2 mutant males were determined. All males were between 5 and 7 days old. In all instances the assay was
repeated 20 times. a HIF, b LIF, or c courtship behaviour. (n = 20 males per genotype; *P \ 0.05, **P \ 0.005 compared with controls, one-way ANOVA with Bonferroni post hoc test for multiple comparisons. Different letters indicate similar groups, i.e. ‘a’ is significantly different than ‘b’ or ‘c’ and so on. One-way ANOVA with Bonferroni post hoc test for multiple comparisons, at least P \ 0.05)
HIF behaviours for Rac2DG19808 or Rac2D males placed in the assay chamber with Csorc control males was only 2.1 (SE ± 0.6, P \ 0.005) and 3.0 (SE ± 1.0, P \ 0.005), respectively (Fig. 4a). Interestingly, the number of LIF behaviours performed by Rac2DG19808 or Rac2D males when placed together with another Rac2 mutant male were slightly, but not significantly higher, than when two control males were introduced to each other. Yet, when Rac2DG19808 or Rac2D males were placed together with a control Csorc male the number of LIF behaviours was significantly reduced (Csorc control = 55.2, SE ± 4.0; Rac2DG19808 = 13,1, SE ± 1.2, P \ 0.005; Rac2D SE ± 19.8, P \ 0.005) (Fig. 4b). In all cases, whether a Rac2 male was placed together with another Rac2 or a control male the number of courtship behaviours was significantly higher (Fig. 4c).
Normally Drosophila males will not present courtship behaviour towards a recently mated female (Scott 1986; Wolfner 1997). Since Rac2 males performed courtship behaviour towards other males, it was investigated whether they fail to recognize mated females. Control or Rac2 mutant males were paired with Csorc females who had mated within the last hour, and the courtship behaviour of the male was monitored for 20 min. Compared to controls, Rac2 mutants spent more than significantly more time courting mated females (Rac2DG19808 = 51 % SE ± 8.2, P \ 0.005, Rac2D = 66 %, SE ± 10.5, P \ 0.005, n = 10) than controls (w1118 = 22 %, SE ± 1.8, Rac2DG19808?/- = 17 % SE ± 2.5 and Rac2D = 21 %, SE ± 4.0) (Fig. 5c).
Discussion Rac2 males fail to recognize mated females Next, it was determined whether loss of Rac2 affected the ability of a male to display normal courtship behaviour towards a virgin female. To do this 5-7 day old control or Rac2 mutant males, raised in isolation, were paired with 3–4 day old Csorc virgin females and the courtship behaviour of the male was monitored for 20 min or until copulation occurred. Two aspects of courtship were measured, latency (the time it took before the male performed courtship behaviours) and courtship index (the percentage of time from the first courtship behaviour until 10 min had elapsed or until copulation). When Rac2 males were paired with Csorc virgin females no significant difference in either latency or courtship behaviour was observed compared to controls (Fig. 5a, b).
123
In this report we explore the function of the small GTPase Rac2 in the regulation of Drosophila male behaviour. Endogenous Rac2 mutant males are unable react properly towards males and mated females. Furthermore, both male and female Rac2 mutants are susceptible to starvation and have reduced lipid stores. Interestingly, although Rac2 mutant males eat the same amount of food over a 24 h period as wild type males, they eat fewer but larger meals. These results lead us to conclude that Rac2 is a central player in the regulation of Drosophila behavioural metabolism. Intriguingly, although Rac2 mutant males have the propensity to be aggressive, unless provoked, they do not display aggressive behaviour, instead they choose to display courtship behaviour towards other males. Any overtly
Behav Genet (2014) 44:155–164
161
Fig. 5 Rac2 males fail to recognize previously mated females. a The amount of time, in seconds, before the first courtship behaviour, or latency, was determined for control and Rac2 mutant males introduced to 3–4 day old wild-type virgin females. b The percentage of time a male spent actively courting a 3–4 day old wild-type virgin female was determined for control and Rac2 mutant males. c The
percentage of time a male spent actively courting a 4–5 day old wildtype mated female was determined for control and Rac2 mutant males. (n = 10 males per genotype; *P \ 0.05, **P \ 0.005 compared with controls, one-way ANOVA with Bonferroni post hoc test for multiple comparisons)
aggressive behaviour displayed by a courting male towards another male was only in reaction to an attack initiated by the pursued male. This lack of instigation by the courting male was true even if the Rac2 mutant males changed roles during the observational period. When the courting male became the pursued male, it would then initiate all LIF and HIF interactions. Furthermore, the aggressive displays by the pursued male appeared to be a reaction to the courting males attempted copulation. The pursued male would begin with wing flicks, which could escalate to wing threats and intensify to a face to face lunge or fencing duel with the courting male. This is interesting because this may mean that all the mechanisms that normally control aggressive behaviour, such as octopamine and serotonin signalling may be intact, but the Rac2 male still displays improper behaviours towards other males and mated females. An attractive possibility is that loss of Rac2 is interfering with octopamine signalling as it was suggested that octopamine has a role in coordinating sensory cues between males (Certel et al. 2007). Interestingly, the GPCR Gr32a is necessary for males to properly recognize other males, as well as mated females (Miyamoto and Amrein 2008). Gr32a is a gustatory receptor expressed in neurons found in the tarsal segments of both male and female flies, which project to the subesophageal ganglion region of the Drosophila brain, this region contains octopaminergic neurons explicitly involved in regulating male aggression (Zhou et al. 2008). Gr32a was shown to be necessary to suppress male courtship behaviour towards other males and mated females (Miyamoto and Amrein 2008), similar to what we observed in Rac2 mutant males. One possibility is that, similar to NinaE, Gr32a is phosphorylated upon pheromone stimulation, leading to its subsequent binding by an Arrestin. This in
turn would cause it to be internalized and recycled. In a Rac2 mutant fly, again similar to what was observed in the eye with NinaE, when Gr32a is activated Arrestin would fail to localize properly, thus Gr32a could not be recycled. Inhibition of desensitization may well lead to either acute or chronic receptor signalling that would quickly exhaust the system and inhibit further signalling. Rac2 mutants, both male and female, had lower lipid contents than controls. These findings are in accordance with Pospisilik et al. 2010. They performed a highthroughput RNAi screen to find new genes involved in regulating adiposity in Drosophila and found Rac2 knockdowns to have lower stored lipid content. For the males at least we might be able to explain this with behaviour. Rac2 mutant males spent most of their time chasing other flies, trying to mate and gave the appearance of being very hyperactive (see Fig. 2d). It could be that the desire to mate is overriding any hunger signals, which could explain why they eat fewer but larger meals, only going to eat when the appetitive signal is strong enough. Overall the Rac2 mutant males did not overeat during a 24 h period, and their hyperactivity may lead to the reduced lipid content. By casual observation Rac2 females did not show any obvious signs of hyperactivity, but they spent much of their time trying to avoid pursuing Rac2 males. We cannot rule out that GPCRs also regulate satiation signals in Drosophila, and it could be that signalling from receptors, similar to NinaE, are disrupted in a Rac2 mutant. Interestingly, many of the GPCRs involved in regulating feeding behaviour, including Drosophila cholecystokinin-like and Leucokinin receptors, have been shown to interact with Kurtz, a Drosophila non-visual Arrestin (Roman et al. 2000; Johnson et al. 2008).
123
162
In conclusion, we have found that the small GTPase Rac2 regulates male aggressive, mating and feeding behaviour. Previously, Rac2 was shown to regulate the translocation of Arrestin2 after the GPCR NinaE was activated. This translocation of Arrestin2 is necessary for NinaE desinsitization. It could be that Rac2 regulation of Arrestin-like protein translocation is not limited to the Drosophila eye, but is a general mechanism of many GPCRs.
Materials and Methods Fly maintenance The Drosophila CantonS and OregonR-C strains, as well as yw; Rac2DG19808, Rac2D ry509 and y1 w*,Rac1J11 P{FRT(whs)}2A/TM6B, Tb? and w1118 were obtained from the Bloomington Stock Center, and the references are given in Flybase. CantonS and OregonR-C flies were crossed together to create the Csorc wild-type lab strain. In a previous study we introduced yw marked chromosome into the Rac2D ry509 background, yellow (y) has been implicated in behaviour and metabolism (Edwards et al. 2006; Walter et al. 1996), because of this we exchanged all yw chromosomes for w1118. All flies were maintained on enriched Jazz mix standard fly food (Fisher Scientific), and kept at 25 °C, 50 % humidity, on a 12:12 light:dark cycle. Aggression assay For all aggression assays a cylindrical behavioural chamber dimensions were 2 cm by 2.5 cm (height 9 diameter), and filled with 1 % agarose to 1.5 cm in height to maintain proper humidity. Newly emerged male flies were collected and isolated for 5–7 days at 29 °C, 50 % humidity, on a 12:12 light:dark cycle. Behavioural tests were carried out at room temperature with 60 % humidity. Furthermore, for all aggression assays performed two male flies were anesthetized using an ice-water bath for 10–15 s before being transferred to a behavioural chamber. After a recovery period of at least 3 min, a camera (Panasonic HDC-SD90), positioned above the chamber, was used to record activity for a minimum of 30 min. After the 3 min recovery period the behavioural interactions between the males was scored for 20 min. Distinct stereotypic aggressive interactions were scored as described by Chen et al. (2002) and Nilsen et al. (2004). At least 10 replicates were conducted for each genotype. Mating behaviour assay For all mating assays newly eclosed males were collected and aged in isolation for 5–7 days, at 29 °C, 50 %
123
Behav Genet (2014) 44:155–164
humidity, on a 12:12 light:dark cycle. Individual males and 3–4 day old virgin wild type Csorc females were then transferred to a behavioural chamber, using ice-water anesthetization for 10–15 s. For all behavioural assays, after a recovery period of at least 3 min, a camera (Panasonic HDC-SD90), positioned above the chamber, was used to record activity for a minimum of 30 min. After the 3 min recovery period the behavioural interactions between the males was scored for 20 min or until copulation occurred. Csorc is a lab wild type strain created by crossing Canton-S and OregonR-C wild type strains. Scoring of the courtship behaviours was performed as described by Becnel et al. (2011). Latency, courtship index as well as the frequency of mating behaviours were measured. Latency was calculated by counting the time it took a male to initiate mating and courtship index is calculated as the percentage of time a male spends actively courting a female over a 20 min period (Seconds spent actively courting/(1,200 s - Latency seconds) At least 10 replicates per genotype were conducted. Activity assay Cylindrical behavioural chamber dimensions were 2 cm by 2.5 cm (height 9 diameter), and filled with 1 % agarose to 1.5 cm in height to maintain proper humidity. Newly emerged male flies were collected and isolated for 5–7 days at 29 °C, 50 % humidity, on a 12:12 light:dark cycle. Behavioural tests were carried out at room temperature with 60 % humidity. The male fly to be analysed was anesthetized using an ice-water bath and a colour dot using acrylic paint was placed on the dorsal side of the abdomen before being transferred to a behavioural chamber. The male to be assayed was placed in the behavioural chamber either alone, with a male Csorc wild-type male or a Csorc wild-type virgin female. After a recovery period of at least 3 min, a camera (Panasonic HDC-SD90), positioned above the chamber, was used to record activity for a minimum of 30 min. Activity was determined at the percentage of time the male spent activity walking over the 30 min period, preening activity was ignored for this assay.
Lipid measurements Lipid content was determined according to the method of Service (1987). Groups of 5 male flies were weighed, and subsequently dried at 60 °C for 24 h. Flies were then weighed again to obtain dry weight. Lipids were extracted by placing intact dry flies in glass vials containing 10 ml of diethyl ether for 24 h with gentle agitation at room temperature. The diethyl ether was removed and flies were dried for 2 h. Flies were weighed to obtain lean dry weight.
Behav Genet (2014) 44:155–164
The difference between dry weight and lean dry weight was considered the total lipid content of the flies. Starvation resistance assay Starvation resistance was measured by placing 20 male or female flies, which were 5–7 days old, in a vial containing 5 ml of 1 % agarose, which provides water and humidity but no food source. The vials were kept at 25 °C in a incubator, on a 12 h:12 h light:dark cycle. The numbers of dead flies was counted every 12 h. This allowed for the calculation of the median time of death and survival rate. At least 10 replicates for each genotype were conducted. Capillary feeding (CAFE) assay This method was modified from Ja et al. (2007). A vial, 9 cm by 2 cm (height 9 diameter), containing 1 % agarose (5 cm high) to provide moisture and humidity for the flies, was used for this assay. A calibrated capillary glass tube (5 ll, VWR International) was filled with liquid food which contains 5 % o sucrose, 5 % yeast extract and 0.5 % foodcolouring dye. A layer of mineral oil was used to prevent the liquid food from evaporating. Five males, which were 5–7 days old, were put inside the chamber and the opening of the vial was covered with paraffin tape, a capillary tube was inserted from the top through paraffin tape. The experimental set up was kept at room temperature and the activity was recorded for 24 h using a HD camera (Panasonic SDS90). The initial and final food level in the capillary tube was marked to determine total food intake per day. The number of feeding bouts per fly was counted from the recording, and the average meal size of the fly was calculated by dividing the total food intake by the number of feeding bouts (meal size = Total food intake fly-1 24 h-1/ Total number of feeding bouts fly-1 24 h-1). At least 10 replicates were performed for each genotype. RNA extraction Total RNA from fly heads was extracted by homogenizing 50 heads in 800 ll TRIzol reagent (Invitrogen), followed by an incubation time of 5 min at room temperature. 160 ll of chloroform was added, shaken vigorously for 15 s and incubated for 3 min. The solution was microcentrifuged for 15 min at 4 °C and at 12,0009g. The aqueous phase was precipitated with 400 ll isopropanol and was spun for a second time for 15 min at 4 °C and at 12,0009g. After an incubation period of 10 min at room temperature, the RNA is spun down with a third run in the microcentrifuge for 15 min at 4 °C at 12,0009g. The supernatant was discarded and the pellet were rinsed with 1 ml of 75 % Ethanol followed by a fourth centrifuge run for 5 min. The supernatant
163
was discarded and the RNA pellet air dried. The pellets were then resuspended in 30 ll of DEPC water and incubated at 55 °C for 10 min. To degrade any DNA contamination 2 ll of DNAse was added and the samples were incubated for 3 h at 37 °C and subsequently at 75 °C for 15 min. cDNA synthesis A spectrophotometer (model ND-1000, Nanodrop) was used to measure total RNA concentration. For cDNA synthesis, 5 lg RNA samples were diluted with MilliQ water to 12 ll. The first Mastermix consisting of 0.5 ll 20 mM dNTP and 0.5 ll random Hexamers (diluted to 1/6.25) was added and the sample was incubated at 65 °C for 5 min. After a quick spin down the second Mastermix consisting of 4 ll 59 FS buffers, 2 ll 0.1 M DTT and 1 ll of murne leukemia virus transcriptase was added. Samples were incubated for 1 h at 37 °C and subsequently subjected to PCR to confirm cDNA synthesis. Quantitative RT-PCR The mastermix for each qRT-PCR (qPCR) contained 2 ll MgCl2 free 109 buffer, 1.6 ll 50 mM MgCl2, 0.2 ll 20 mM dNTP, 0.05 ll of both forward and reverse primer (100 pmol/ll), 1 ll dimethyl sulfoxide, 0.5 ll Sybr Green (1:50,000), 0.08 ll Taq polymerase (5 U/ll) and 13.52 ll MilliQ water. qPCRs were performed in duplicates, and negative controls were included on each plate. Amplification was performed as follows: denaturation at 95 °C for 3 min, 50 cycles of denaturing at 95 °C for 15 s, annealing at an appropriate temperature established for the primers for 15 s, and extension at 72 °C for 30 s. The following housekeeping gene was analyzed: rp49. Reactions were run on iCycler temperature cyclers and fluorescence was measured using MyiQ single colour real time PCR detection system. Data was analyzed using iQ5 software (BioRad, Sweden). All samples were analyzed in duplicates, and the measured concentration of mRNA was normalized relative to rp49 control values. The relative levels of a given mRNA were quantified from the normalized data according to the DCT analysis.
Primer designing Primers were designed with Beacon Designer (Premier Biosoft, Palo Alto, CA, USA) using the SYBR Green settings. Primer sequences for the housekeeping genes rp49 were rp49F:CACACCAAATCTTACAAAATGTGTGA; rp49R:AATCCGGCCTTGCACATG, and those of Rac2 were Rac2F:ATAATATACCGACCGAACAG; Rac2R: GCTCACGCACTAATACAA.
123
164
Statistical analysis Mean and standard error from all replicates of each experiment was calculated. All analysis was performed with GraphPad Prism 4, and used ANOVA with appropriate post hoc analysis for multiple comparisons. The type of analysis performed for each assay is specified in the appropriate figure legend. Acknowledgments This study was supported by the University of Aberdeen, the National Research Fund of Luxembourg, the Carl Tryggers Stiftelse, Stiftelsen Olle Engkvist Byggma¨stare and Stiftelsen Lars Hiertas Minne. Conflict of Interest Philip Goergen, Anna Kasagiannis, Helgi B. Schio¨th, and Michael J. Williams declare that they have no conflict of interest. Human and Animal Rights and Informed Consent This article does not contain any studies with human or animal subjects performed by any of the authors.
References Alekseyenko OV, Lee C, Kravitz EA (2010) Targeted manipulation of serotonergic neurotransmission affects the escalation of aggression in adult male Drosophila melanogaster. PLoS ONE 5(5):e10806 Alekseyenko OV, Chan YB, Li R, Kravitz EA (2013) Single dopaminergic neurons that modulate aggression in Drosophila. Proc Natl Acad Sci USA 110:6151–6156 Becnel J, Johnson O, Luo J, Nassel DR, Nichols CD (2011) The serotonin 5-HT7Dro receptor is expressed in the brain of Drosophila, and is essential for normal courtship and mating. PLoS ONE 6:e20800 Belsare PV, Watve MG, Ghaskadbi SS, Bhat DS, Yajnik CS, Jog M (2010) Metabolic syndrome: aggression control mechanisms gone out of control. Med Hypotheses 74:578–589 Certel SJ, Savella MG, Schlegel DCF, Kravitz EA (2007) Modulation of Drosophila male behavioral choice. Proc Natl Acad Sci USA 104:4706–4711 Certel S, Leung A, Lin C-Y, Perez P, Chiang A-S, Kravitz E (2010) Octopamine neuromodulatory effects on a social behavior decision-making network in Drosophila males. PLoS ONE 5:e13248 Chen S, Lee AY, Bowens NM, Huber R, Kravitz EA (2002) Fighting fruit flies: a model system for the study of aggression. Proc Natl Acad Sci USA 99:5664–5668 Dierick HA, Greenspan RJ (2007) Serotonin and neuropeptide F have opposite modulatory effects on fly aggression. Nat Genet 39: 678–682 Edwards AC, Rollmann SM, Morgan TJ, Mackay TF (2006) Quantitative genomics of aggressive behavior in Drosophila melanogaster. PLoS Genet 2:e154 Elsaesser R, Kalra D, Li R, Montell C (2010) Light-induced translocation of Drosophila visual arrestin2 depends on Rac2. Proc Natl Acad Sci USA 107:4740–4745 Fajardo TT Jr, Villahermosa LG, dela Cruz EC, Abalos RM, Franzblau SG, Walsh GP (1995) Minocycline in lepromatous leprosy. Int J Lepr Other Mycobact Dis 63:8–17 Hakeda-Suzuki S, Ng J, Tzu J, Dietzl G, Sun Y, Harms M, Nardine T, Luo L, Dickson BJ (2002) Rac function and regulation during Drosophila development. Nature 416:438–442
123
Behav Genet (2014) 44:155–164 Hardeland R, Coto-Montes A, Poeggeler B (2003) Circadian rhythms, oxidative stress, and antioxidative defense mechanisms. Chronobiol Int 20:921–962 Hoyer SC, Eckart A, Herrel A, Zars T, Fischer SA, Hardie SL, Heisenberg M (2008) Octopamine in male aggression of Drosophila. Curr Biol 18:159–167 Ja WW, Carvalho GB, Mak EM, de la Rosa NN, Fang AY, Liong JC, Brummel T, Benzer S (2007) Prandiology of Drosophila and the CAFE assay. Proc Natl Acad Sci USA 104:8253–8256 Johnson EC, Bohn LM, Barak LS, Birse RT, Na¨ssel DR, Caron MG, Taghert PH (2003) Identification of Drosophila neuropeptide receptors by G protein-coupled receptors–b-arrestin2 interactions. J Biol Chem 278:52172–52178 Johnson EC, Tift FW, McCauley A, Liu L, Roman G (2008) Functional characterization of kurtz, a Drosophila non-visual arrestin, reveals conservation of GPCR desensitization mechanisms. Insect Biochem Mol Biol 38:1016–1022 Luo J, Becnel J, Nichols CD, Nassel DR (2012) Insulin-producing cells in the brain of adult Drosophila are regulated by the serotonin 5-HT1A receptor. Cell Mol Life Sci 69:471–484 Mitra A, Chinchore Y, Kinser R, Dolph PJ (2011) Characterization of two dominant alleles of the major rhodopsin-encoding gene ninaE in Drosophila. Mol Vis 17:3224–3233 Miyamoto T, Amrein H (2008) Suppression of male courtship by a Drosophila pheromone receptor. Nat Neurosci 11:874–876 Ng J, Nardine T, Harms M, Tzu J, Goldstein A, Sun Y, Dietzl G, Dickson BJ, Luo L (2002) Rac GTPases control axon growth, guidance and branching. Nature 416:442–447 Nilsen SP, Chan Y-B, Huber R, Kravitz EA (2004) Gender-selective patterns of aggressive behavior in Drosophila melanogaster. Proc Natl Acad Sci USA 101:12342–12347 Popova NK (2006) From genes to aggressive behavior: the role of serotonergic system. BioEssays 28:495–503 Pospisilik JA, Schramek D, Schnidar H, Cronin SJ, Nehme NT, Zhang X, Knauf C, Cani PD, Aumayr K, Todoric J, Bayer M, Haschemi A, Puviindran V, Tar K, Orthofer M, Neely GG, Dietzl G, Manoukian A, Funovics M, Prager G, Wagner O, Ferrandon D, Aberger F, Hui CC, Esterbauer H, Penninger JM (2010) Drosophila genome-wide obesity screen reveals hedgehog as a determinant of brown versus white adipose cell fate. Cell 140:148–160 Roman G, He J, Davis RL (2000) Kurtz, a novel nonvisual arrestin, is an essential neural gene in Drosophila. Genetics 155:1281–1295 Scott D (1986) Sexual mimicry regulates the attractiveness of mated Drosophila melanogaster females. Proc Natl Acad Sci USA 83:8429–8433 So¨derberg J, Carlsson M, Na¨ssel D (2012) Insulin-producing cells in the Drosophila brain also express satiety-inducing cholecystokinin-like peptide, Drosulfakinin. Front Endocrinol 3:109 Walter MF, Zeineh LL, Black BC, McIvor WE, Wright TR, Biessmann H (1996) Catecholamine metabolism and in vitro induction of premature cuticle melanization in wild type and pigmentation mutants of Drosophila melanogaster. Arch Insect Biochem Physiol 31:219–233 Wang L, Anderson DJ (2010) Identification of an aggressionpromoting pheromone and its receptor neurons in Drosophila. Nature 463:227–231 Wolfner MF (1997) Tokens of love: functions and regulation of Drosophila male accessory gland products. Insect Biochem Mol Biol 27:179–192 Zhou C, Rao Y, Rao Y (2008) A subset of octopaminergic neurons are important for Drosophila aggression. Nat Neurosci 11: 1059–1126
