The Effect of Aerosolized and Intravenously Administered Clenbuterol ...

Download PDF
0 downloads 0 Views 198KB Size Report
Comment
venously administered clenbuterol and aerosolized fluticasone propionate on ... ther intravenously or by aerosol, in comparison with fluticasone propionate (FP) ...
Veterinary Research Communications, 30 (2006) 623–635 DOI: 10.1007/s11259-006-3346-9

 C Springer 2006

The Effect of Aerosolized and Intravenously Administered Clenbuterol and Aerosolized Fluticasone Propionate on Horses Challenged with Aspergillus fumigatus Antigen T.T.J.M. Laan1,∗ , S. Bull2,3 , R.A. van Nieuwstadt1 and J. Fink-Gremmels2 1 Department of Equine Sciences, Internal Medicine Section, 2 Department of Veterinary Pharmacy, Pharmacology and Toxicology (VFFT), Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands; 3 Department of Health, Toxicology Unit, Section on Clinical Pharmacology, Imperial College, London, UK ∗ Correspondence: E-mail: [email protected]

Laan, T.T.J.M., Bull, S., van Nieuwstadt, R.A. and Fink-Gremmels, J., 2006. The effect of aerosolized and intravenously administered clenbuterol and aerosolized fluticasone propionate on horses challenged with aspergillus fumigatus antigen. Veterinary Research Communications, 30(6), 623–635

ABSTRACT β-Agonists have been shown to display anti-inflammatory properties in several experimental models. The aim of this study was to investigate the anti-inflammatory properties of clenbuterol (CB), administered either intravenously or by aerosol, in comparison with fluticasone propionate (FP) in recurrent airway obstruction (RAO)-susceptible horses. Eight horses, of which five were known to be susceptible to RAO, underwent an inhalation challenge with Aspergillus fumigatus (AF) antigen and were treated with CB intravenously, CB by aerosol, or FP by aerosol. Twenty-four hours after the challenge, bronchoalveolar lavage was performed, the total and differential cell counts were assessed, and cytokines were measured in isolated alveolar macrophages. After challenge with AF, RAO-susceptible horses showed an increase in total cell count, based on an increase in macrophages and lymphocytes, which was inhibited by treatment with intravenous CB, aerosolized CB and aerosolized FP. Neutrophil ratios were decreased when treated with aerosolized CB and FP. Expression of interleukin (IL)-1β and IL-8 was significantly increased after AF challenge. Interleukin-1β was significantly decreased following treatment with intravenous CB, aerosolized CB and aerosolized FP, whereas only FP decreased the expression of IL-8. These data suggest that the antiinflammatory property of CB provide new opportunities in the therapeutic intervention of early inflammation in RAO.

Keywords: recurrent airway obstruction (RAO), clenbuterol, anti-inflammatory, fluticasone propionate, alveolar macrophages

Abbreviations: AF, Aspergillus fumigatus; AM, alveolar macrophage(s); AR, adrenoceptor; BAL(F), broncholaveolar lavage (fluid); CB, clenbuterol; DWBC, differential white blood cell count; FBS, fetal bovine serum; FP, fluticasone propionate; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IκB, inhibitor κB; IFN, inter feron; i.v., intravenous; IL, interleukin; LPS, lipopolysaccharide; MIP, macrophage inflamatory protein; NFκB, nuclear factor κB; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; RAO, recurrent airway obstruction; RPMI, Roswell Park Memorial Institute (medium); TLR, Toll-like receptor(s); TNF-α, tumor necrosis factor α; TWBC, total white blood cell count

623

624

INTRODUCTION Recurrent airway obstruction (RAO) in horses is a pulmonary disease activated by allergens such as fungal spores and pro-inflammatory agents present in organic stable dust (McGorum et al., 1993a; Pirie et al., 2001, 2002). More than 50 species of moulds have been identified in dust, but, Feani rectivirgula, Thermoactinomyces vulgaris and Aspergillus fumigatus (AF) are considered to be most important in the aetiology of RAO (Mair and Derksen, 2000). Horses susceptible to RAO display a more severe response following natural challenge when compared with inhalation challenges with fungal antigens. However, AF antigen inhalation challenges have been shown to be effective in inducing an inflammatory pulmonary response (McGorum et al., 1993a). Aspergillus fumigatus antigen binds to specific Toll-like receptors (TLR) of macrophages and other dendritic cells. Activation of TLR induces a cascade of intracellular events; among others the dissociation of IκB from NFκB is initiated allowing NFκB to translocate to the nucleus and subsequently upregulate gene expression, leading to the secretion of cytokines (Lentsch et al., 1999; Lien and Ingalls, 2002). Production of inflammatory mediators via this mechanism suggests that alveolar macrophages (AM) stimulated by AF might contribute to the inflammation that occurs in the lungs during exacerbations of equine RAO. Earlier, Franchini and colleagues (1998) showed that interleukin (IL-) 8 and macrophage inflammatory protein-2 (MIP-2) concentrations were increased in relation to neutrophilic influx, suggesting that AM contribute to the disease syndrome. Current therapy in RAO focuses on β-agonists, primarily used to achieve bronchodilation, and corticosteroids to reduce inflammatory and allergic reactions (Dixon et al., 1995). Such therapeutic agents are normally administered to the patient parenterally. However, aerosol therapy in horses, using currently prescribed drugs, has gained interest, and a wide range of medications, derived from human medicine, have been tested in horses. For example, fluticasone propionate (FP), a highly potent corticosteroid that is 18 times stronger than dexamethasone, has been shown to be effective in treating RAO-affected horses following inhalation treatment (Giguere et al., 2002). Its efficacy depends on pulmonary absorption because bioavailability following oral and nasal application has proved to be negligible both in humans (Harding, 1990) and in horses (Laan et al., 2004). However, with regard to the use of corticosteroids in the long-term treatment of allergic lung disease, both beneficial and limiting side-effects have been reported. For example, corticosteroids appear to modulate the expression of β-adrenoceptors (ARs), thereby increasing the sensitivity for the β2 -agonists mentioned above (Abraham et al., 2002). Conversely, reduced sensitivity towards corticosteroids has also been reported in human asthma (Walsh et al., 2003; Barnes et al., 2004). Anecdotal reports from equine practice seem to substantiate the problem of corticosteroid resistance. Hence, it would be beneficial in the treatment of RAO to reduce the inflammatory reaction in the early stages, with anti-inflammatory agents other than corticosteroids. Anti-inflammatory properties have been ascribed to β-adrenergic agonists in other studies involving both experimental animal models (Izeboud et al., 1999a; Nakamura et al., 2000) and human asthmatic patients (Spoelstra et al., 2002) and seem to depend on the inhibition of the phosphorylation of IκB, preventing its detachment from NFκB (Farmer and Pugin, 2000; Ye, 2000) and thereby impeding its translocation to the nucleus and the subsequent increase in cytokine production.

625

The aim of this study was to investigate the anti-inflammatory properties of clenbuterol administered either intravenously or by aerosol, in comparison with the highly potent corticosteroid FP, administered in aerosolized form. Cytology, total cell counts in bronchoalveolar lavoge fluid and cytokine expression in AM derived from RAO-susceptible horses after inhalation challenge with AF antigen were examined.

MATERIALS AND METHODS Statement of animal care The committee on ethical considerations in animal experiments of the Faculty of Veterinary Science of the University of Utrecht, The Netherlands, approved all experiments under numbers 0301.0602 and 0307.0601 Animals Eight adult Dutch warm blood mares (mean body weight 608 kg, range 570–665 kg, ages 7–10 years) were used in this study. Five horses were classified as being RAO-susceptible and three horses were considered free of respiratory disease. Classification of the horses was based on anamnesis, complete clinical examination, and a natural challenge experiment. Horses were stabled for 24 h in a dusty environment and fed mouldy hay, following which the neutrophil ratio in the bronchoalveolar lavage fluid (BALF) was ascertained. Horses were classified as RAO-susceptible when the BALF neutrophil ratio exceeded 20%. The criteria used for the classification of horses were in accordance with the consensus report for experimental studies in heaves by Robinson and colleagues (Robinson, 2001). Prior to the initiation of the experiments, horses were stabled on shavings and fed silage and pelleted feed, were vaccinated, received routine anthelmintic treatment and were accustomed to wearing the facemask subsequently used for the challenge procedures. Throughout the study, the horses were individually stabled but shared a common airspace. Horses were evaluated clinically and, when necessary, endoscopically for upper airway disease prior to each challenge. The minimum time between individual challenges was at least 3 weeks. Challenge solution AF-antigen was supplied by Greer Laboratories (Lot no. My3-64). Each challenge contained 0.2 mg (200 μg) of antigen-protein in 2.5 ml sterile saline. Chemical solutions Clenbuterol (Ventipulmin; Boehringer Ingelheim) intravenously 0.75 μg/kg; total volumes of aerosolized CB varied between 7.6 and 8.8 ml.

626

Fluticasone propionate (Flixotide; Glaxo Wellcome): 8 actuations of 250 μg per actuation

Experimental design All horses were treated twice daily for 3 days prior to challenge with AF antigen, with the last administration of CB 2–3 h before the challenge. Following a 3-week ‘wash-out’ period, horses were treated with a single dose of aerosolized CB (0.4 μg/kg) 6 h after the AF challenge. After a second 3-week wash-out period, horses were challenged with AF, 6 h after which aerosolized FP (2000 μg) was applied. Aerosols of both AF antigen and CB were generated using a compressor (Porta-neb) with a calibrated output of 9 l/min, connected to a nebulizer cup (Sidestream, Porta-neb) the manufacturers of which state that 80% of aerosol is in the respirable range (< 5 μm). The aerosol was delivered to a T-piece that was connected to an equine Aeromask (Trudell Medical). Values of NaCl challenge of these horses were obtained from previous experiments. Fluticasone proprionate was administered by delivering actuations to a spacer designed for and connected to the Aeromask.

Bronchoalveolar lavage (BAL) Horses were sedated with 10 μg/kg detomidine (Domosedan, Pfizer Animal Health) and BALF was collected via a 2.2 m long endoscope passed through the trachea and wedged in a secondary or tertiary bronchus. During the endoscopically guided BAL procedure, the trachea was instilled with a 1:5 dilution of 2% lidocaine (= 4 mg/ml) to minimize the cough reflex. Following positioning of the tip of the scope in an appropriate bronchus, five successive 60 ml aliquots of warmed saline containing 200 μg/ml gentamicin (gentamicin 5%, Eurovet) and 2.5 μg/ml amphotericin B (Fungizone, Life Technologies) were instilled and withdrawn immediately by manual suction using 60 ml syringes. The lavage fluid was pooled, decanted into sterile bottles and placed on ice. A 10 ml aliquot was used for BALF cytology. The BALF was collected from the right lung at 24 h post challenge.

Preparation of microscopic slides Cytospin slides were used for microscopic evaluation of the cellular components of the BALF. Briefly, samples were filtered through a double layer of sterile gauze and washed twice by centrifugation at 1100g for 5 min at 4◦ C in cold phosphate-buffered saline (PBS). Two millilitres of the washed sample was placed in cytochambers and centrifuged at 50g for 5 min. Slides were air-dried prior to staining with May–Grunwald–Giemsa stain and a cover slip was placed over the cells using DePeX mounting medium. Differential white blood cell counts (DWBC) were based on the observation of 400 cells. Cells were identified as macrophages, lymphocytes, neutrophils, mast cells or eosinophils.

627

Total cell counts Total white blood cell count (TWBC) was performed using a dual threshold Coulter counter. Urea concentration was measured both in heparinized venous blood samples, collected immediately prior to BAL, and in BALF supernatant using commercial kits (Beckman urea kit and Infinity urea, Clindia, respectively). Measurement of urea in BALF was validated for horses prior to the initiation of experiments. The proportion of pulmonary epithelial lining fluid in each BALF sample was calculated from the formula: [BALF urea concentration × 100] ÷ [plasma urea concentration] as described earlier by McGorum and colleagues (McGorum et al., 1993b).

Isolation of alveolar macrophages Isolation of AM in BALF commenced within 30 min of sample collection. The lavage fluid was filtered through a double layer of sterile gauze and centrifuged in a swing-out rotor centrifuge at 150g for 30 min at 4◦ C. The fluid was discarded and the cell pellet was washed twice by centrifugation in cold PBS at 150g for 15 min at 4◦ C. After washing, the cells were resuspended in 4 ml of warm Roswell Park Memorial Institute RPMI) 1640 medium supplemented with 5% fetal bovine serum (FBS), 100 U/ml penicillin, 200 μg/ml gentamicin and 2.5 μg/ml amphotericin B. This cell suspension was layered over Ficoll Hypaque (Amershan Bioscienes ) using a ratio of 6:4 and centrifuged at 3000 g at 22◦ C for 20 min. The cells were recovered from the RPMI–Ficoll interface and washed by centrifugation in warm medium at 150g for 15 min at 22◦ C. The AM were finally resuspended in 1 ml medium and counted, and their viability was assessed by trypan blue staining. Cells were seeded into 6-well plates, using a cell density of 1 × 106 cells/well, and incubated at 37◦ C and 5% CO2 for 1.5 h to allow cells to adhere, following which the medium and the non-adherent cells were removed. The monolayer was washed and harvested in cold PBS. The cell suspension was placed in RNAse free Eppendorf vials and centrifuged at 15 000g for 5 min. Cell pellets were snap-frozen in liquid nitrogen and stored at −70◦ C until further analysis. The cell cultures contained more than 95% macrophages, as determined by differential staining with May–Gr¨unwald–Giemsa.

RNA isolation and cDNA synthesis Total cellular RNA was isolated from the above-mentioned samples using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. The RNA concentration was measured by optical density at 260 nm. All RNA samples were treated with amplificationgrade DNAse according to the manufacturer’s instructions (Qiagen) to remove any traces of DNA. cDNA was synthesized with the Reverse Transcription (RT) System (Promega) following the manufacturer’s protocol, after which the sample was diluted and stored at 4◦ C until PCR amplification.

628

Quantitative PCR measurements Quantitative real-time PCR was performed on equine glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, TNF-α, IL-1β, IL-6, IL-8 and IL-10. The real-time PCR method was based on the high-affinity double-stranded DNA-binding dye SYBR green I (BMA) and was performed in triplicate in a spectrofluorometric thermal cycler (BioRad). For each PCR reaction, 2 μl of cDNA was used in a reaction volume of 50 μl containing 1× manufacturer’s buffer, 2 m mol/L MgCl2 , 0.5× SYBR green I, 200 μmol/L dNTPs, 20 pmol of both primers, 1.25 units of AmpliTaq Gold (Applied Biosystems), on 96-well iCycler iQ plates (BioRad). PCR primer pairs specific for equine GAPDH, β-actin, TNF-α IL-1β, IL-6, IL-8 and IL-10 were designed, using PrimerSelect software (DNASTAR) based on their GenBank accession numbers (Table I). Melting curves (BioRad) were used to examine each sample for purity and negative controls were included in the amplification reactions to check for contamination. Standard sequencing procedures were used to verify the analytical specificity of the PCR products. All genes were examined in each experimental sample. GAPDH and β-actin were determined as housekeeping genes. Statistical analysis Data were checked for normality by using the Kolmogorov–Smirnov test and were found to be normally distributed. Differences in DWBC, TWBC and expression of cytokines in the AM after NaCl and AF-antigen inhalation challenges were analysed using a two-tailed paired Student’s t-test. To evaluate whether CB, intravenous or aerosolized, or FP had a TABLE I Nucleotide sequences of equine specific primers; F = forward, R = reverse Gene

Primer

Sequence (5 –3 )

Tann (◦ C)

Accssion no.

GAPDH

F R F R F R F R F R F R F R

TGGCATGGCCTTCCGTGTCC GCCCTCCGATGCCTGCTTCAC CAAGGCCAACCGCGAGAAGATGAC GCCAGAGGCGTACAGGGACAGCA GCCTTTCCCCGCCCTCCTCTCG CTCTCCTGGCTGGTCCCCTGTTGC TGGCAGAGGGGAATAGAAGGGTTTG ATAGGGAAGGCAGCTGGGCATTGA ATGAGTGGCTGAAGAACACAACAAC AGGAATGCCCATGAACTACAACAAT TGGCCTCTTCCTGCTTTCTG GGTTTGGAGTGCGTCTTGATGC GAGAACCACGGCCCAGACATCAAG GACAGCGCCGCAGCCTCACT

63.0

AF157626

63.5

AF035774

61.5

M64087

59.0

U92480

61.0

AF005227

64.0

AF062377

64.5

U38200

β-actin TNF-α IL-1β IL-6 IL-8 IL-10

629

significant effect on these parameters after AF challenge, a one-way ANOVA followed by a Dunnet’s multiple comparison test when values were significant was performed. Statistical analysis of data was done with statistical software (Graphpad Prism 4.0 and Statgraphics plus 5.0) and results were considered to be significant when p < 0.05. Unless otherwise indicated, data are given as mean ± standard error of mean.

RESULTS RAO-susceptible horses In RAO-susceptible horses, TWBC was significantly increased 24 h after inhalation challenge with AF antigen compared with saline controls, and returned to reference values following treatment with intravenous CB, aerosolized CB and aerosolized FP (Figure 1). There was no significant difference between the different kinds of treatment (Figure 1). Absolute values reflecting the DWBC show that both macrophages and lymphocytes were significantly increased 24 h after challenge, compared with saline controls, while values of neutrophils, mast cells and eosinophils remained low (Figure 2). Challenge with AF antigen did not induce significant differences in cell ratios found in the BALF at 24 h. Clenbuterol administered intravenously did not induce any significant effects in cell ratios. In contrast, in horses treated with aerosolized CB and FP, neutrophil ratios were reduced (Table II). Inhalation challenge with AF antigen resulted in a significant increase of IL-1β and IL-8 expression in the AM of susceptible horses 24 h after challenge, compared with

TCC (G/L)

40

*

30 20

# #

10

#

P F FA

B

ae ro

iv

C A F-

CB FA

A F

N aC

L

0

Figure 1. Total white blood cell count (TCC) in BALF of RAO-susceptible horses 24 h after inhalation challenge with AF antigen with treatment with intravenous (i.v.) CB, aerosolized (aero) CB and aerosolized FP. Data are expressed as mean ± SEM of 5 horses susceptible for RAO. ∗ Significant difference ( p < 0.05) compared with saline challenge. # Significant difference ( p < 0.05) between different treatments and AF challenge

630

TABLE II Differential white blood cell count, presented as percentages, in BALF of RAO susceptible horses 24 h after inhalation challenge with AF with treatment with intravenous (i.v.) CB aerosolized (aero) CB and aerosolized FP. Data are expressed as mean ± SEM of five horses susceptible for RAO

Macrophages Lymphocyes Neutrophils Mast cells Eosinophils ∗ Significant

NaCl

AF

AF CB i.v.

AF CB aero

AF FP aero

35.9 ± 8.2 59.3 ± 6.2 2.6 ± 0.5 1.7 ± 0.2 0.2 ± 0.1

33.3 ± 4.1 60.1 ± 2.1 5.2 ± 2.0 1.1 ± 0.4 0.3 ± 0.2

38.4 ± 3.8 54.5 ± 8.3 5.6 ± 0.8 0.9 ± 0.4 0.1 ± 0.1

46.3 ± 8.8 49.6 ± 5.6 2.2 ± 0.9∗ 2.1 ± 0.8 0.4 ± 0.4

40.7 ± 6.4 58.0 ± 6.8 0.3 ± 0.2∗ 0.8 ± 0.6 0.2 ± 0.1

difference ( p < 0.05) between different treatments

25

*

DCC (G/L)

20

NaCl AF

15

*

10 5

yt es N eu tro ph ils M as tc el ls Eo si no ph ils

oc ph

m Ly

M ac ro

ph

ag e

s

0

Figure 2. Absolute values of differential white blood cell count in BALF of RAO-susceptible horses 24 h after inhalation challenge with AF antigen. Data are expressed as mean ± SEM of 5 horses susceptible for RAO. ∗ Significant differences ( p < 0.05) compared with saline challenge

saline controls. All drug treatments significantly reduced the expression of IL-1β and FP also reduced the expression of IL-8 at 24 h after the challenge. The expression of IL-6 at 24 h after the challenge in susceptible horses was neither significantly affected by the AF inhalation challenge nor altered in any of the treatment groups, although intravenous CB seemed to increase IL-6 expression (Figure 3). Neither TNF-α nor IL-10 was influenced either by the AF challenge or by the different treatment groups at 24 h after challenge (data not shown).

631

Figure 3. Expression, against the expression of GAPDH, of IL-1β, IL-6 and IL-8 in AM harvested from RAO-susceptible horses 24 h after inhalation challenge with AF antigen with treatment with intravenous (i.v.) CB, aerosolized (aero) CB and aerosolized FP. Data are expressed as mean ± SEM of 5 horses susceptible for RAO. ∗ Significant difference ( p < 0.05) compared with saline challenge. # Significant difference ( p < 0.05) between different treatments and AF challenge

RAO-non-susceptible horses The three RAO-non-susceptible horses used in this study did not show any significant differences in TWBC and DWBC in the BALF and in AM cytokine expression, following a challenge with AF (data not shown). DISCUSSION Aspergillus fumigatus antigen, proven to be one of the aetiological factors responsible for the occurrence of equine RAO, has been shown to induce pulmonary disease in RAOsusceptible horses following inhalation challenge (McGorum et al., 1993a). The present study, however, does not show significant changes in inflammatory cells, such as neutrophils and mast cells 24 h after AF challenge besides an increase in TWBC. This increase could be directly attributed to the increase in total amount of macrophages and lymphocytes. Recognition of AF by the alveolar macrophage is the first and crucial step in the elimination of the invading fungal spores, followed by the recruitment of neutrophils into affected lung tissue (Meier et al., 2003). The need for a rise in macrophages able to recognize and phagocytose invading fungal organisms might explain the increase found in our study. The increase in lymphocytes can be explained as part of the adaptive immunity, while RAO has been linked to a specific TH 2 cell type response (Lavoie et al., 2001), or as a specific need for the TH 1 cell cytokine interferon (IFN-) γ , which is known to enhance the fungicidal activity of phagocytes (Roilides et al., 1993). However, the fact that IFN-γ production by lymphocytes is enhanced by pre-treatment with intrinsic components of the fungal cell wall (Sherwood et al., 2001) supports the latter hypothesis. Further supporting the idea of a

632

TH 1-dependent pathway are the increased levels of IFN-γ in BALF of RAO-horses challenged with a natural challenge (Giguere et al., 2002; Ainsworth et al., 2003). It has been shown by AF-stimulation of different macrophage cell lines that the activation of NFκB-dependent gene expression depends on the presence of TLR2 and TLR4, and it is assumed that both receptor sites are equally important in the recognition of AF. The increased expression of the pro-inflammatory cytokine IL-1 and chemokine IL-8 at 24 h after inhalation challenge with AF antigen can be explained by activation of the NFκB pathway (Meier et al., 2003). However in other studies involving AM and AF, MyD88independent pathways have also been shown to be activated upon stimulation with AF conidia (Marr et al., 2003). With the present experimental design, TNF-α and IL-10 cytokine expression in the AM was not observed. The apparent lack of a TNF-α response can be explained by the fact that AM were harvested only at 24 h post challenge. As TNF-α is an early-phase cytokine, it is possible that it had already become undetectable (Strieter et al., 2003). Low levels of IL-10 can be ascribed to a protective phenomenon that is suggested to act via the IL-10 receptor site, allowing a normal inflammatory response to airborne challenges (Fernandez et al., 2004). One of the options to modulate the inflammatory response is the stimulation of β-adrenergic receptors, leading to the inhibition of the phosphorylation of IκB and therefore delaying the translocation of NFκB to the nucleus and subsequently inhibiting the expression of cytokines (Farmer and Pugin, 2000; Ye, 2000). Clenbuterol, being a βagonist with high β2 selectivity, has been shown to modulate the inflammatory response in several other studies using porcine alveolar macrophages, hepatic macrophages, and rodent and human macrophage cell lines (Izeboud et al., 1999b, 2004). The present results again demonstrate anti-inflammatory effects of CB when used in RAO-susceptible horses after an inhalation challenge with AF-antigen. Interleukin-6 has recently been characterized as acting predominantly as an antiinflammatory cytokine (Opal and DePalo, 2000), and increased expression is a response to an increase in expression of TNF-α and IL-1 (Libert et al., 1994; Xing et al., 1998). Twenty-four hours after inhalation challenge with AF antigen we were not able to show a significant increase in expression of IL-6 in AM of RAO-susceptible horses. At the same time non-susceptible horses showed a higher, albeit not significant, increase in IL-6 after stimulation with AF. When compared to susceptible horses, IL-6 expression in non-susceptible horses was higher and the difference between the two groups approached statistical significance ( p = 0.0518, data not shown). We have previously reported a significantly higher IL-6 expression in AM of non-susceptible horses compared to RAO-susceptible horses 6 h after challenge with AF or LPS, suggesting that low susceptibility to AF is correlated with a high IL-6 productivity, suppressing neutrophil influx (Laan et al., 2006). Data reported in the present study at 24 h could be a result of the differences present at 6 h post challenge. Clenbuterol administered by aerosol, considered equally potent as salbutamol frequently used in human asthma, caused a significant decrease in TWBC and neutrophil ratios in the BALF of RAO-susceptible horses. These results are in agreement with recent studies that report a significant decrease in neutrophil involvement in human asthmatics when treated with aerosolized salbutamol (Jeffery et al., 2002; Johnson, 2002). In addition, we were able to show a decrease in IL-1 expression in the AM of RAO-susceptible horses in vivo.

633

Although a few reports describe the inhibition of IL-8 in BALF when salmeterol was added to a low dose of inhaled corticosteroids (Pang and Knox, 2000; Reid et al., 2003), further evidence describing cytokine inhibition in response to inhaled β-agonists is lacking. The effects on neutrophil ratios and TWBC were of equal significance when comparing aerosolized CB and FP; FP was more effective only in inhibiting mRNA expression in AM. These results are in agreement with those of Jeffery and colleagues (2002) who compared the effects of aerosolized salbutamol and FP on neutrophil ratios in asthmatic subjects and found no significant differences between the different treatment groups. The demonstrated effects of FP treatment are in agreement with multiple studies investigating the anti-inflammatory effect of this highly potent corticosteroid on inflammatory mediators (Gizycki et al., 2002; Hattotuwa et al., 2002) and accord with an efficacy study done in horses with RAO (Giguere et al., 2002). In conclusion, inhalation challenge with AF antigen resulted in a mild inflammatory reaction in RAO-susceptible horses. More profound reactions can be expected when different aetiological components responsible for RAO are combined (Pirie et al., 2002). We can, however, conclude that the inflammatory response seen in our study was modulated by different treatment protocols including intravenously administered and, even more so, aerosolized CB. This additive value of CB, commonly used in the treatment of equine RAO for relief of bronchospasm, points towards new opportunities in the therapeutic intervention of RAO-related early inflammation.

REFERENCES Abraham, G., Brodde, O.E. and Ungemach, F.R., 2002. Regulation of equine lymphocyte beta-adrenoceptors under the influence of clenbuterol and dexamethasone. Equine Veterinary Journal, 34, 587–593 Ainsworth, D.M., Grunig, G., Matychak, M.B., Young, J., Wagner, B., Erb, H.N. and Antczak, D.F., 2003. Recurrent airway obstruction (RAO) in horses is characterized by IFN-gamma and IL-8 production in bronchoalveolar lavage cells. Veterinary Immunology and Immunopathology, 96, 83–91 Barnes, P.J., Ito, K. and Adcock, I.M., 2004. Corticosteroid resistance in chronic obstructive pulmonary disease: inactivation of histone deacetylase. Lancet, 363, 731–733 Dixon, P.M., Railton, D.I., McGorum, B.C. and Tothill, S., 1995. Equine pulmonary disease: a case control study of 300 referred cases. Part 4: Treatments and re-examination findings. Equine Veterinary Journal, 27, 436– 439 Farmer, P. and Pugin, J., 2000. β-Adrenergic agonists exert their “anti-inflammatory” effects in monocytic cells through the IκB/NF-κB pathway. American Journal of Physiology. Lung Cellular and Molecular Physiology, 279, L675–682 Fernandez, S., Jose, P., Avdiushko, M.G., Kaplan, A.M. and Cohen, D.A., 2004. Inhibition of IL-10 receptor function in alveolar macrophages by Toll-like receptor agonists. Journal of Immunology, 172, 2613–2620 Franchini, M., Gilli, U., Akens, M.K., Fellenberg, R.V. and Bracher, V., 1998. The role of neutrophil chemotactic cytokines in the pathogenesis of equine chronic obstructive pulmonary disease (COPD). Veterinary Immunology and Immunopathology, 66, 53–65 Giguere, S., Viel, L., Lee, E., MacKay, R.J., Hernandez, J. and Franchini, M., 2002. Cytokine induction in pulmonary airways of horses with heaves and effect of therapy with inhaled fluticasone propionate. Veterinary Immunology and Immunopathology, 85, 147–158 Gizycki, M.J., Hattotuwa, K.L., Barnes, N. and Jeffery, P.K., 2002. Effects of fluticasone propionate on inflammatory cells in COPD: an ultrastructural examination of endobronchial biopsy tissue. Thorax, 57, 799–803 Harding, S.M., 1990. The human pharmacology of fluticasone propionate. Respiratory Medicine, 84 (supplement A), 25–29 Hattotuwa, K.L., Gizycki, M.J., Ansari, T.W., Jeffery, P.K. and Barnes, N.C., 2002. The effects of inhaled fluticasone on airway inflammation in chronic obstructive pulmonary disease: a double-blind, placebo-controlled biopsy study. American Journal of Respiratory and Critical Care Medicine, 165, 1592–1596

634

Izeboud, C.A., Mocking, J.A., Monshouwer, M., van Miert, A.S. and Witkamp, R.F., 1999a. Participation of betaadrenergic receptors on macrophages in modulation of LPS-induced cytokine release. Journal of Receptor and Signal Transduction Research, 19, 191–202 Izeboud, C.A., Monshouwer, M., van Miert, A.S. and Witkamp, R.F., 1999b. The beta-adrenoceptor agonist clenbuterol is a potent inhibitor of the LPS-induced production of TNF-alpha and IL-6 in vitro and in vivo. Inflammation Research, 48, 497–502 Izeboud, C.A., Hoebe, K.H., Grootendorst, A.F., Nijmeijer, S.M., van Miert, A.S., Witkamp, R.R. and Rodenburg, R.J., 2004. Endotoxin-induced liver damage in rats is minimized by beta 2-adrenoceptor stimulation. Inflammation Research, 53, 93–99 Jeffery, P.K., Venge, P., Gizycki, M.J., Egerod, I., Dahl, R. and Faurschou, P., 2002. Effects of salmeterol on mucosal inflammation in asthma: a placebo-controlled study. European Respiratory Journal, 20, 1378–1385 Johnson, M., 2002. Effects of beta2-agonists on resident and infiltrating inflammatory cells. Journal of Allergy and Clinical Immunology, 110, S282–290 Laan, T.T., Westermann, C.M., Dijkstra, A.V., van Nieuwstadt, R.A. and Fink-Gremmels, J., 2004. Biological availability of inhaled fluticasone propionate in horses. Veterinary Record, 155, 361–364 Laan, T.T.J.M., Bull, S., Pirie, R.S. and Fink-Gremmels, J., 2006. Macrophages in the pathogenesis of recurrent airway obstruction in horses. Journal of Veterinary Internal Medicine, 20, 167–174 Lavoie, J.P., Maghni, K., Desnoyers, M., Taha, R., Martin, J.G. and Hamid, Q.A., 2001. Neutrophilic airway inflammation in horses with heaves is characterized by a Th2-type cytokine profile. American Journal of Respiratory and Critical Care Medicine, 164, 1410–1413 Lentsch, A.B., Czermak, B.J., Bless, N.M., Van Rooijen, N. and Ward, P.A., 1999. Essential role of alveolar macrophages in intrapulmonary activation of NF-κB. American Journal of Respiratory Cell and Molecular Biology, 20, 692–698 Libert, C., Takahashi, N., Cauwels, A., Brouckaert, P., Bluethmann, H. and Fiers, W., 1994. Response of interleukin6-deficient mice to tumor necrosis factor-induced metabolic changes and lethality. European Journal of Immunology, 24, 2237–2242 Lien, E. and Ingalls, R.R., 2002. Toll-like receptors. Critical Care Medicine, 30, S1–11. Mair, T.S. and Derksen, F.J., 2000. Chronic obstructive pulmonary disease: a review. Equine Veterinary Education, 12, 35–44 Marr, K.A., Balajee, S.A., Hawn, T.R., Ozinsky, A., Pham, U., Akira, S., Aderem, A. and Liles, W.C., 2003. Differential role of MyD88 in macrophage-mediated responses to opportunistic fungal pathogens. Infectious Immunology, 71, 5280–5286 McGorum, B.C., Dixon, P.M. and Halliwell, R.E., 1993a. Responses of horses affected with chronic obstructive pulmonary disease to inhalation challenges with mould antigens. Equine Veterinary Journal, 25, 261– 267 McGorum, B.C., Dixon, P.M., Halliwell, R.E. and Irving, P., 1993b. Evaluation of urea and albumen as endogenous markers of dilution of equine bronchoalveolar lavage fluid. Research in Veterinary Science, 55, 52–56 Meier, A., Kirschning, C.J., Nikolaus, T., Wagner, H., Heesemann, J. and Ebel, F., 2003. Toll-like receptor (TLR) 2 and TLR4 are essential for Aspergillus-induced activation of murine macrophages. Cellular Microbiology, 5, 561–570 Nakamura, A., Imaizumi, A., Kohsaka, T., Yanagawa, Y. and Johns, E.J., 2000. Beta2-adrenoceptor agonists suppresses tumour necrosis factor production in rat mesangial cells. Cytokine, 12, 491–494 Opal, S.M. and DePalo, V.A., 2000. Anti-inflammatory cytokines. Chest, 117, 1162–1172 Pang, L. and Knox, A.J., 2000. Synergistic inhibition by beta(2)-agonists and corticosteroids on tumor necrosis factor-alpha-induced interleukin-8 release from cultured human airway smooth-muscle cells. American Journal of Respiratory Cell and Molecular Biology, 23, 79–85 Pirie, R.S., Collie, D.D., Dixon, P.M. and McGorum, B.C., 2002. Evaluation of nebulised hay dust suspensions (HDS) for the diagnosis and investigation of heaves. 2: Effects of inhaled HDS on control and heaves horses. Equine Veterinary Journal, 34, 337–342 Pirie, R.S., Dixon, P.M., Collie, D.D. and McGorum, B.C., 2001. Pulmonary and systemic effects of inhaled endotoxin in control and heaves horses. Equine Veterinary Journal, 33, 311–318 Reid, D.W., Ward, C., Wang, N., Zheng, L., Bish, R., Orsida, B. and Walters, E.H., 2003 Possible anti-inflammatory effect of salmeterol against interleukin-8 and neutrophil activation in asthma in vivo. European Respiratory Journal, 21, 994–999 Robinson, N.E., 2001. International Workshop on Equine Chronic Airway Disease. Michigan State University, 16–18 June 2000. Equine Veterinary Journal, 33, 5–19 Roilides, E., Uhlig, K., Venzon, D., Pizzo, P.A. and Walsh, T.J., 1993. Enhancement of oxidative response and damage caused by human neutrophils to Aspergillus fumigatus hyphae by granulocyte colony-stimulating factor and gamma interferon. Infection and Immunity, 61, 1185–1193

635

Sherwood, E.R., Varma, T.K., Fram, R.Y., Lin, C.Y., Koutrouvelis, A.P. and Toliver-Kinsky, T.E., 2001. Glucan phosphate potentiates endotoxin-induced interferon-gamma expression in immunocompetent mice, but attenuates induction of endotoxin tolerance. Clinical Science (London), 101, 541–550 Spoelstra, F.M., Postma, D.S., Hovenga, H., Noordhoek, J.A. and Kauffman, H.F., 2002. Additive antiinflammatory effect of formoterol and budesonide on human lung fibroblasts. Thorax, 57, 237–241 Strieter, R.M., Belperio, J.A. and Keane, M.P., 2003. Host innate defenses in the lung: the role of cytokines. Current Opinion in Infectious Disease, 16, 193–198 Walsh, G.M., Sexton, D.W., and Blaylock, M.G., 2003. Corticosteroids, eosinophils and bronchial epithelial cells: new insights into the resolution of inflammation in asthma. Journal of Endocrinology, 178, 37–43 Xing, Z., Gauldie, J., Cox, G., Baumann, H., Jordana, M., Lei, X.F. and Achong, M.K., 1998. IL-6 is an antiinflammatory cytokine required for controlling local or systemic acute inflammatory responses. Journal of Clinical Investigation, 101, 311–320 Ye, R.D., 2000. β-Adrenergic agonists regulate NF-κB activation through multiple mechanisms. American Journal of Physiology. Lung Cellular and Molecular Physiology, 279, L615–617 (Accepted: 26 February 2005)