The effects of the glial cell line-derived neurotrophic factor (GDNF) on ...

ISSN 20790597, Russian Journal of Genetics: Applied Research, 2015, Vol. 5, No. 4, pp. 407–412. © Pleiades Publishing, Ltd., 2015. Original Russian Text © A.S. Tsybko, T.V. Il’chibaeva, V.S. Naumenko, 2014, published in Vavilovskii Zhurnal Genetiki i Selektsii, 2014, Vol. 18, No. 4/3, pp. 1110–1116.

The Effects of the Glial Cell LineDerived Neurotrophic Factor (GDNF) on the Levels of mRNA of Apoptotic Genes Bax and Bclxl in the Brain of Mice genetically predisposed to Pathological Behavior A. S. Tsybko, T. V. Il’chibaeva, and V. S. Naumenko The Federal Research Center Institute of Cytology and Genetics, Siberian Division, Russian Academy of Sciences, Novosibirsk, Russia email: [email protected] Received September 14, 2014; in final form, November 6, 2014

Abstract—Similar to the other neurotrophic factors, the glial cell linederived neurotrophic factor (GDNF) may inhibit apoptosis in vitro. However, the antiapoptotic GDNF effects in vivo are not known. We studied the effect of GDNF central administration of on the mRNA levels of genes encoding the proapoptotic pro tein Bax and the antiapoptotic protein Bclxl in the brain of ASC mice genetically predisposed to depressive like behavior and mice of their nondepressive parental CBA strain. We found that the GDNF injection increased the Bclxl mRNA content in the hippocampi of mice of both strains (p < 0.05) and Bax mRNA (p < 0.05) in the hippocampus of ASC mice. Thus, we revealed both the anti and proapoptotic effects of GDNF in vivo. These effects substantially depended on the genotype of the animals. We also observed signif icant interstrain differences in the Bax and Bclxl mRNA levels. In ASC mice, the Bax mRNA levels were significantly higher (p < 0.001 and p < 0.01) in all investigated structures and the content of Bclxl mRNA was elevated in the midbrain. Our data demonstrate the activation of apoptotic processes in ASC mice and the substantial compensatory changes, probably directed to the rise of the threshold for neuronal apoptosis. Keywords: apoptotic genes, depressivelike behavior, Bax, Bclxl, GDNF, ASC mice DOI: 10.1134/S2079059715040152

mood stabilizers (Kosten et al., 2008; Kubera et al., 2011; Dygalo et al., 2012; Shishkina et al., 2012).

INTRODUCTION Considerable evidence indicates that depressive disorders are associated with the activation of immune, inflammatory, oxidative and nitrosative stress pathways (Maes, 2008; Maes et al., 2011, Moy lan et al., 2013). The external stress factors, together with the internal stress factors, such as inflammation, may activate these pathways. This supports their involvement in the etiology of depression (Maes, 2008; Anisman, 2009; Miller et al., 2009). Moreover, depression is associated with structural modifications in the hippocampus, prefrontal cortex, amygdala, cin gulate gyrus, and basal ganglia (Campbell and Mac Queen, 2006). One of the principal mechanisms, which inhibit neurogenesis and induce depressive states, is apoptosis (Kubera et al., 2011). There are two main pathways of apoptosis: the external pathway, which is mediated by the tumor necrosis factor recep tors and the internal or mitochondrial pathway, which is controlled by the proteins of Bcl2 family (Yuole and Strasser, 2008). Protein inhibitors of apoptosis have a clear functional antagonism to Bax proteins (Kim et al., 2005). Bclxl is specifically interesting among the antiapoptotic proteins because of its sensitivity to the effects of stress, as well as antidepressants and

The idea that the efficacy of antidepressants signif icantly depends on increased neurogenesis and neu ronal plasticity (Duman and Aghajanian, 2012) has promoted intense studies on neurotrophic factors as a target for antidepressant therapy. Moreover, the brain derived neurotrophic factor (BDNF) has been consid ered as an antidepressant agent for a long time (Siu ciak et al., 1997; Shirayama et al., 2002; Hoshaw et al., 2005; Naumenko et al., 2012). The glial cell line derived neurotrophic factor (GDNF) is primarily known as a promising tool for the treatment of Parkin son’s disease (Peterson and Nutt, 2008); however, the data on the involvement of GDNF in the pathogenesis of depression (Liu et al., 2012) allowed us to consider GDNF as a prospective antidepressant agent. In the previous studies, we did not observe the clear antide pressant GDNF effects, although we found some interesting effects on the behavior of ASC (Antide pressant Sensitive Catalepsy) mice and the expression of key genes of the 5HT system in this strain of mice (Semenova et al., 2013; Naumenko et al., 2013). It is important that neurotrophic factors have antiapop totic activity due to the inhibition of proapoptotic and the activation of antiapoptotic proteins, including

407

408

TSYBKO et al.

Nucleotide sequences of primers and their features Gene

Nucleotide sequence

Tann, °C

Length of PCR product, bp

Bax

F5'catctttgtggctggagtcctc3' R5'aagtggacctgaggtttattggc3'

64

216

Bclxl

F5'tggatctctacgggaacaatgc3' R5'gtggctgaagagagagttgtgg3'

64

197

GPD

F5'gcaaggtcatcccagagctg3' R5'gtccaccaccctgttgctgtag3

59

326

Bclxl. To date, these properties are evident in all main neurotrophins and growth factors, such as NGF (Mogi et al., 2000), FGF2 (Kim et al., 2012), TGFβ1 (Buis son et al., 2003), BDNF (Chao et al., 2011), and GDNF (Cao et al., 2013). However, almost all antiap optotic effects of GDNF were observed in cell cul tures. There is only one report on the antiapoptotic GDNF effect in vivo (Oo et al., 2003); however, a pos sible mechanism mediating this effect was not sug gested in the study. It is only known that GDNF acti vates the expression of Bcl2; however, there are no data on the GDNF effects on Bclxl. Another impor tant question is the effect of GDNF in ASC mice. This strain was founded by Dr. Kulikov at the Institute of Cytology and Genetics, Siberian Division, Russian Academy of Sciences after selection for high suscepti bility to catalepsy. ASC mice exhibit the depressive like behavioral features and sensitivity to antidepres sants, and thus, they fit the criteria of depression mod els (Kulikov et al., 2008; Tikhonova et al., 2013). The aim of the present study was to examine the effect of GDNF on the mRNA levels ofgenes encod ing apoptotic proteins Bax and Bclxl in the brain of mice genetically predisposed to depressivelike behav ior and mice of the nondepressive parental strain. MATERIALS AND METHODS Animals. The experiments were carried out on adult male ASC mice with inherited susceptibility to depres sivelike behavior (Kulikov et al., 2008) and the mice of the parental nondepressive CBA strain. The animals were housed in plastic cages of 40 × 30 × 15 cm under the standard conditions (a temperature of 18–22°C, relative humidity of 50–60%, and natural lighting with 12h light and 12h dark) and free access to standard food and water. Two days prior to the experiment the animals were housed individually for preventing the effects of group housing. All procedures were per formed in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Ani mals (NIH Publications No. 80023, 1996). Drug. Human GDNF (Peprotech, United States) was dissolved in sterile water and injected into the left lat eral ventricle of the mouse brain in accordance with the coordinates AP –0.5 mm, L –1.6 mm, and DV 2 mm

(Slotnick and Leonard, 1975), at a dose of 800 ng/ani mal. We chose a low dose of the drug, i.e., less than 0.1 μg, because of the data in the literature data on the absence of toxic effects of low concentrations of GDNF (Taylor et al., 2013). Prior to the central administration of GDNF, the animals were shortly anesthetized with ester for 20–30 s. The control ani mals were injected with sterile water. The volume of liquid injected centrally was 5 μL. Twentyone day later, the animals were decapitated, and the midbrain, hippocampus, and frontal cortex were sampled for analysis. The samples were stored at –70°C before RNA extraction. Total RNA extraction. Total RNA was extracted using the TRIzol Reagent (Life Sciences, United States) according to the protocol of the manufacturer. RNA was diluted with water to the concentration of 0.125 μg/kg and stored at –70°C. The presence of genomic DNA in RNA preparations was determined according to the previously described protocol (Nau menko and Kulikov, 2006; Naumenko et al., 2008). Reaction of reversed transcription. Eight μL or 1 μg of total RNA was mixed with 180 ng of a statistical primer of 6 nucleotides’ length (the final concentra tion of the primer was 5 μM) and 16 μL of a sterile solution containing 2.25 μM KCl. RNA was dena tured at 94°C using a Hybaid OmnE amplificator (United Kingdom), and then, annealed at 41°C for 15 min. Then, we added 15 μL of a mixture containing reverse transcriptase MMLV (200 U), TrisHCl (pH 8.3, 0.225 μmol), and a mixture of dNTPs (0.015 μmol of each), DTT (0.225 μmol), and MnCl2 (0.03 μmol). The prepared mixture with a final volume of 31 μL was incubated at 41°C for 60 min. The syn thesized cDNA was stored at –20°C. Realtime polymerase chain reaction (PCR). The primers used for the amplification of cDNA of the genes of interest are presented in the Table. They were developed using sequences published in the EMBL Nucleotide database and synthesized by Biosan (Novosibirsk, Russia). One μL of cDNA was mixed with 2.5 μL of the PCR buffer, containing intercalat ing SYBR green I and reference ROX stains, 2.5 μL of 2.5 mM dNTP, 2.5 μL of 25 mM MgCl2, 2.5 μL of a mixture of forward and reverse primers, 0.2 μL of Taq DNA polymerase, and sterile water up to a final vol

RUSSIAN JOURNAL OF GENETICS: APPLIED RESEARCH

Vol. 5

No. 4

2015

THE EFFECTS OF THE GLIAL CELL LINEDERIVED NEUROTROPHIC FACTOR Content of Bax mRNA 300 * *

250

Content of Bclxl mRNA 400 #

Control GDNF

350

409

Control GDNF

# #

*

300 # #

200 150 100

200

# # #

150 100

# #

50 0

CBA ASC

Midbrain

*

250

CBA ASC

50 0

CBA ASC

Hippocampus Frontal cortex

CBA ASC

Midbrain

CBA ASC

CBA ASC

Hippocampus Frontal cortex

Fig. 1. Effect of GDNF on the Bax mRNA level in the brain divisions of ASC and CBA mice. The level of Bax gene expression is assessed as the number of cDNA copies per 100 copies of GAPDH cDNA. The data are presented as the mean ± SEM for at least eight animals, and the groups are compared using twoway ANOVA. **, p < 0.01 com pared to control ASC animals; ## and ###, p < 0.01 and p < 0.001, respectively, compared to control CBA animals.

Fig. 2. Effect of GDNF on the Bclxl mRNA level in brain divisions of ASC and CBA mice. The level of Bclxl gene expression is assessed as the number of cDNA copies per 100 copies of GAPDH cDNA. The data are presented as the mean ± SEM for at least eight animals, and the groups are compared using twoway ANOVA. **, p < 0.01 com pared to control ASC animals; ## and ###, p < 0.01 and p < 0.001, respectively, compared to control CBA animals.

ume of 25 μL. For preparation of the reaction mixture, we used reagent kits supplied by Sintol (Moscow, Rus sia). PCR was performed using a C1000 Thermo cycler (BioRad, United States). The following proto col was used: 3 min at 94°C, 1 cycle; 10 s at 94°C, 30 s at 59°C for glyceraldehyde3phosphate dehydroge nase (GPD) or 64°C for Bax or Bclxl, 30 s at 72°C, 40 cycles. A series of genomic DNA diluted to the concentrations of 0.125, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 ng/μL was simultaneously amplified in separate tubes and was used as the external exogenous standard for plotting a standard curve. The standard curve was plotted in the coordinate representation of Ct (the value of the threshold cycle)—logP (common logarithm of the standard DNA content) automati cally using the BioRad software. Gene expression is presented as a ratio of the content of the cDNA of the gene of interest to 100 copies of the GPD gene, which was used as an internal standard.

RESULTS

Statistical analysis. The data are presented as m ± SEM. The data were compared using twoway analysis of variances (ANOVA) with post hoc multiple com parisons of means using Fisher’s test. STATISTICA 6.0 software was used for the analysis. The experiments with animals were performed at the Department of Experimental Animal Genetic Resources of the Institute of Cytology and Genetics, Siberian Division, Russian Academy of Sciences (grants RFMEFI61914X0005 and RFMEFI62114X0010 of the Ministry of Education and Science of the Russian Feder ation nos).

Twoway ANOVA revealed the GDNF effect (F1,30 = 10.9, p < 0.01) and the strain effect (F1,30 = 36.02, p < 0.001) on the content of mRNA of the gene encoding the proapoptotic protein Bax in the hippoc ampus (Fig. 1), but no interaction between these fac tors (F1,30 = 1.07, p > 0.05). A post hoc comparison revealed that the intracerebroventricular administra tion of GDNF significantly increased Bax mRNA in ASC mice (p < 0.01) but not in CBA mice (p = 0.09). However, we observed a higher level of Bax gene mRNA in ASC mice compared to CBA mice (p < 0.01). In the midbrain and frontal cortex, we also found the strong effect of strain (F1,30 = 98.3, p < 0.001 and (F1,30 = 10.2, p < 0.01, respectively) but not GDNF (F1,30 = 1.35, p > 0.05 and F1,30 = 2.7, p > 0.05, respectively) or interaction between the factors (F1,30 = 1.39, p > 0.05 and F1,30 = 0.9, p > 0.05 in the midbrain and frontal cortex, respectively). A post hoc compari son revealed that in both the midbrain and frontal cor tex of ASC mice the level of Bax mRNA was higher than in CBA mice (p < 0.001 and p < 0.01, respectively; Fig. 1). The intracerebroventricular administration of the GDNF substantially influenced the content of the mRNA of the gene encoding the antiapoptotic protein Bclxl in the hippocampus of both the ASC and CBA mice (Fig. 2). Twoway ANOVA revealed the strain effect (F1,30 = 5.53, p < 0.05) and GDNF effect (F1,30 = 11.19, p < 0.01), but no interaction between these fac tors (F < 1, p > 0.05). GDNF significantly increased the content of Bclzl mRNA in the hippocampi of


Vol. 5

No. 4

2015

410

TSYBKO et al.

both ASC mice (p < 0.05) and CBA mice (p < 0.05). We also revealed the GDNF effect in the frontal cortex (F1,28 = 5.5, p < 0.05); however, a post hoc comparison demonstrated only a trend towards the lower content of Bclxl mRNA in ASC mice (p = 0.06). In the mid brain we found only the effect of strain (F1,29 = 63.3, p < 0.001; Fig. 2). This effect was only expressed in the higher level of Bclxl mRNA in ASC mice compared to CBA mice (p < 0.001). DISCUSSION We have demonstrated for the first time that GDNF may increase the content of mRNA of antiap optotic protein Bclxl in vivo. The activating effect of GDNF on the expression of antiapoptotic Bclxl pro tein in the hippocampus of ASC and CBA mice is sim ilar to the effects of antidepressant inhibitors of MAO A or serotonin reuptake. The fluoxetin or moclobe mide treatment of stem cells from the rat hippocam pus is known to increase substantially the expression of Bclxl and Bcl2 (Chiou et al., 2006; Chen et al., 2007); antidepressants such as reboxetine and tranyl cypromine increased the Bclxl expression in vivo (Kosten et al., 2008). The increased expression of Bclxl gene in the rat brainstem has been observed after fluoxetin administration during stress (Shishkina et al., 2012). The increased Bclxl expression in the GDNFtreated animals was probably aimed at mini mizing the effects of proapoptotic proteins. The molecular mechanisms of GDNFgoverned Bclxl expression are not known. We assume that the GDNF influence on the MAPK signal pathway and NFκB transcription factor like BDNF, for which this pathway of regulation of proteins of the Bcl2 family has been already reported (Kosten et al., 2008; Dygalo et al., 2012). In cell culture experiments, Bax gene expression was decreased after GDNF treatment (Cao et al., 2013); however, under the in vivo conditions, GDNF increased the level of Bax mRNA in the hippocampus of ASC mice. This effect may be related to the specific features of mice of this strain. We have repeatedly demonstrated the higher sensitivity of ASC mice to neurotrophic factors, such as BDNF or GDNF (Nau menko et al., 2012; 2013). Specifically, this was reflected in the alterations in the expression of the key genes of the serotonergic system, which were not observed in CBA mice. It is possible that in ASC mice, in addition to the serotonergic system some other important systems, including the system controlling apoptosis, are highly sensitive to GDNF. We note that the increased content of the Bax gene mRNA level was associated with the increased level of the Bclxl gene mRNA, indicating the importance of the balance between the pro and antiapoptotic molecules for the maintenance of the stress resistance of the animals. We also observed interesting interstrain differences in the levels of Bax and Bclxl mRNA. In ASC mice,

the levels of Bax mRNA were substantially higher than in CBA mice in allinvestigated brain structures. Previ ously, the neuroanatomical alterations were revealed in ASC mice, such as the smaller size of the dienceph alon, including the hippocampus, and the striatum (Tikhonova et al., 2013). The presence of neurodegen erative changes may indicate enhanced apoptosis. This is supported by the elevated expression of the gene encoding one of the main proapoptotic proteins Bax. On the other hand, the Bclxl mRNA content was ele vated in the midbrain of ASC mice. It is known that Bclxl expression increases in response to acute stress (Shishkina et al., 2012). The higher level of Bclxl mRNA compared to Bax mRNA may increase the threshold of neuronal apoptosis (Dygalo et al., 2012; Shishkina et al., 2012) and in turn improve the stress resistance of the animals. The higher level of Bclxl mRNA in the brain of ASC mice may indicate strong compensatory modifications probably directed towards the elimination of Bax effects. Thus, we demonstrate for the first time that central administration of GDNF substantially increases the contents of mRNAs of the proapoptotic Bax and Bcl xl proteins. Moreover, we found that the substantial alterations in the levels of Bax and Bclxl mRNAs in the animals with hereditary predisposition to depres sive behavior may indicate that they have the enhanced threshold of neuronal apoptosis. ACKNOWLEDGMENTS This study was supported by the Russian Founda tion for Basic Research, project no. 142500038. REFERENCES Anisman, H., Cascading effects of stressors and inflamma tory immune system activation: implications for major depressive disorder, J. Psychiatry Neurosci., 2009, vol. 34, pp. 4–20. Buisson, A., Lesne, S., Docagne, F., Ali, C., and Nicole, O., Mackenzie, E.T., and Vivien, D., Transforming growth factorbeta and ischemic brain injury, Cell Mol. Neurobiol., 2003, vol. 23, nos 4/5, pp. 539–550. Campbell, S. and Macqueen, G., An update on regional brain volume differences associated with mood disorders, Curr. Opin. Psychiatry, 2006, vol. 19, no. 1, pp. 25–33. Cao, J.P., Niu, H.Y., Wang, H.J., Huang, X.G., and Gao, D.S., NFκB p65/p52 plays a role in GDNF up regulating Bcl2 and Bclw expression in 6OHDA induced apoptosis of MN9D cell, Int. J. Neurosci., 2013, vol. 123, no. 10, pp. 705–710. Chao, C.C., Ma, Y.L., and Lee, E.H., Brainderived neu rotrophic factor enhances BclxL expression through protein kinase casein kinase 2activated and nuclear factor kappa Bmediated pathway in rat hippocampus, Brain Pathol., 2011, vol. 21, no. 2, pp. 150–162. Chen, S.J., Kao, C.L., Chang, Y.L., Yen, C.J., Shui, J.W., Chien, C.S., Chen, I.L., Tsai, T.H., Ku, H.H., and Chiou, S.H., Antidepressant administration modulates


Vol. 5

No. 4

2015

THE EFFECTS OF THE GLIAL CELL LINEDERIVED NEUROTROPHIC FACTOR neural stem cell survival and serotoninergic differentia tion through bcl2, Curr. Neurovasc. Res., 2007, vol. 4, no. 1, pp. 19–29. Chiou, S.H., Ku, H.H., Tsai, T.H., Lin, H.L., Chen, L.H., Chien, C.S., Ho, L.L., Lee, C.H., and Chang, Y.L., Moclobemide upregulated Bcl2 expression and induced neural stem cell differentiation into serotonin ergic neuron via extracellularregulated kinase pathway, Br. J. Pharmacol., 2006, vol. 148, no. 5, pp. 587–598. Duman, R.S. and Aghajanian, G.K., Synaptic dysfunction in depression: potential therapeutic targets, Science, 2012, vol. 338, no. 6103, pp. 68–72. Dygalo, N.N., Kalinina, T.S., Bulygina, V.V., and Shish kina, G.T., Increased expression of the antiapoptotic protein in the brain is associated with resilience to stressinduced depressionlike behavior, Cell. Mol. Neurobiol., 2012, vol. 32, no. 5, pp. 767–76. Hoshaw, B.A., Malberg, J.E., and Lucki, I., Central admin istration of IGFI and BDNF leads to longlasting antidepressantlike effects, Brain Res., 2005, vol. 1037, pp. 204–208. Kim, R., Unknotting the roles of bcl2 and bclxl in cell death, Biochem. Biophys. Res. Commun., 2005, vol. 333, no. 2, pp. 336–343. Kim, H.R., Heo, Y.M., Jeong, K.I., Kim, Y.M., Jang, H.L., Lee, K.Y., Yeo, C.Y., Kim, S.H., Lee, H.K., Kim, S.R., Kim, E.G., and Choi, J.K., FGF2 inhibits TNF2 mediated apoptosis through upregulation of Bcl2A1 and BclxL in ATDC5 cells, BMB Rep., 2012, vol. 45, no. 5, pp. 287–292. Kosten, T.A., Galloway, M.P., Duman, R.S., Russell, D.S., and D’Sa, C., Repeated unpredictable stress and anti depressants differentially regulate expression of the Bcl2 family of apoptotic genes in rat cortical, hippoc ampal, and limbic brain structures, Neuropsychophar macology, 2008, vol. 33, pp. 1545–1558. Kubera, M., Obuchowicz, E., Goehler, L., Brzeszcz, J., and Maes, M., In animal models, psychosocial stress induced (neuro) inflammation, apoptosis and reduced neurogenesis are associated to the onset of depression, Prog. Neuropsychopharmacol. Biol. Psychiatry, 2011, vol. 35, no. 3, pp. 744–759. Kulikov, A.V., Bazovkina, D.V., Kondaurova, E.M., and Popova, N.K., Genetic structure of hereditary cata lepsy in mice, Genes Brain Behav., 2008, vol. 7, pp. 506–512. Liu, Q., Zhu, H.Y., Li, B., Wang, Y.Q., Yu, J., and Wu, G.C., Chronic clomipramine treatment restores hippocampal expression of glial cell linederived neu rotrophic factor in a rat model of depression, J. Affect. Disord., 2012, vol. 141, nos. 2/3, pp. 367–372. Maes, M., The cytokine hypothesis of depression: inflam mation, oxidative and nitrosative stress (io&ns) and leaky gut as new targets for adjunctive treatments in depression, Neuro. Endocrinol. Lett, 2008, vol. 29, no. 3, pp. 287–291. Maes, M., Galecki, P., Chang, Y.S., and Berk, M., A review on the oxidative and nitrosative stress (O&NS) path ways in major depression and their possible contribu tion to the (neuro) degenerative processes in that ill ness, Prog. Neuropsychopharmacol. Biol. Psychiatry, 2011, vol. 35, no. 3, pp. 676–692.

411

Miller, A.H., Maletic, V., and Raison, C.L., Inflammation and its discontents: the role of cytokinesin in the patho physiology of major depression, Biol. Psychiatry, 2009, vol. 65, pp. 732–741. Mogi, M., Kondo, A., Kinpara, K., and Togari, A., Anti apoptotic action of nerve growth factor in mouse osteo blastic cell line, Life Sci., 2000, vol. 67, no. 10, pp. 1197– 1206. Moylan, S., Maes, M., Wray, N.R., and Berk, M., The neu roprogressive nature of major depressive disorder: path ways to disease evolution and resistance, and therapeu tic implications, Mol. Psychiatry, 2013, vol. 18, no. 5, pp. 595–606. Naumenko, V.S. and Kulikov, A.V., Quantitative assay of 5 ht(1a) serotonin receptor gene expression in the brain, Mol. Biol. (Mosc.), 2006, vol. 40, no. 1, pp. 37–44. Naumenko, V.S., Osipova, D.V., Kostina, E.V., and Kulikov, A.V., Utilization of a twostandard system in realtime pcr for quantification of gene expression in the brain, J. Neurosci. Methods, 2008, vol. 170, pp. 197–203. Naumenko, V.S., Kondaurova, E.M., Bazovkina, D.V., Tsybko, A.S., Tikhonova, M.A., Kulikov, A.V., and Popova, N.K., Effect of brainderived neurotrophic factor on behavior and key members of the brain sero tonin system in genetically predisposed to behavioral disorders mouse strains, Neuroscience, 2012, vol. 214, pp. 59–67. Naumenko, V.S., Bazovkina, D.V., Semenova, A.A., Tsybko, A.S., Il’chibaeva, T.V., Kondaurova, E.M., and Popova, N.K., Effect of glial cell linederived neu rotrophic factor on behavior and key members of the brain serotonin system in mouse strains genetically pre disposed to behavioral disorders, J. Neurosci. Res., 2013, vol. 91, no. 12, pp. 1628–1638. Oo, T.F., Kholodilov, N., and Burke, R.E., Regulation of natural cell death in dopaminergic neurons of the sub stantia nigra by striatal glial cell linederived neu rotrophic factor in vivo, J. Neurosci., 2003, vol. 23, no. 12, pp. 5141–5148. Peterson, A.L. and Nutt, J.G., Treatment of Parkinson’s disease with trophic factors, Neurotherapeutics, 2008, vol. 5, no. 2, pp. 270–280. Semenova, A.A., Bazovkina, D.V., and Tsybko, A.S., Nau menko V.S., Popova N.K. Effect of GDNF on the behavior of mice ASC with a high genetic predisposi tion to catalepsy, Zh. Vyssh. Nervn. Deyat. im. I.P. Pav lova, 2013, vol. 63, pp. 495–501. Semenova, A.A., Bazovkina, D.V., Tsybko, A.S., Nau menko, V.S., and Popova, N.K., Effect of GDNF on the behavior of ASC mice with high hereditary predis position to catalepsy, Zh. Vyssh. Nerv. Deiat. Im. I.P. Pavlova, 2013, vol. 63, no. 4, pp. 495–501. Shirayama, Y., Chen, A.C., Nakagawa, S., Russell, D.S., and Duman, R.S., Brainderived neurotrophic factor produces antidepressant effects in behavioral models of depression, J. Neurosci., 2002, vol. 22, pp. 3251–3261. Shishkina, G.T., Kalinina, T.S., Berezova, I.V., and Dygalo, N.N., Stressinduced activation of the brain stem BclxL gene expression in rats treated with fluox etine: correlations with serotonin metabolism and depressivelike behavior, Neuropharmacology, 2012, vol. 62, no. 1, pp. 177–183.


Vol. 5

No. 4

2015

412

TSYBKO et al.

Siuciak, J.A., Lewis, D.R., Wiegand, S.J., and Lindsay, R.M., Antidepressantlike effect of brainderived neu rotrophic factor (BDNF), Pharmacol. Biochem. Behav., 1997, vol. 56, pp. 131–137. Slotnick, B.M. and Leonard, C.M., A Stereotaxic Atlas of the Albino Mouse Forebrain. Rockville, Maryland: U.S. Dept. of Health, Education and Welfare, 1975. Taylor, H., Barua, N., Bienemann, A., Wyatt, M., Cas trique, E., Foster, R., Luz, M., Fibiger, C., Mohr, E., and Gill, S., Clearance and toxicity of recombinant methionyl human glial cell linederived neurotrophic factor (rmetHu GDNF) following acute convection

enhanced delivery into the striatum, PLoS One, 2013, vol. 8, no. 3, p. e56186. Tikhonova, M.A., Kulikov, A.V., Bazovkina, D.V., Kuli kova, E.A., Tsybko, A.S., Bazhenova, E.Y., Nau menko, V.S., Akulov, A.E., Moshkin, M.P., and Pop ova, N.K., Hereditary catalepsy in mice is associated with the brain dysmorphology and altered stress response, Behav. Brain Res., 2013, vol. 243, pp. 53–60. Youle, R.J. and Strasser, A., The BCL2 protein family: opposing activities that mediate cell death, Nat. Rev. Mol. Cell. Biol., 2008, vol. 9, no. 1, pp. 47–59.

Translated by M. Stepanichev


Vol. 5

No. 4

2015