The Fas-Fas Ligand System and Other Modulators of ... - CiteSeerX

The Fas-Fas Ligand System and Other Modulators of Apoptosis in the Cornea Steven E. Wilson *"\ Qian Li,\ Jian Weng,\ Patricia A. Barry-Lane,^ James V. Jester,f Qianwa Liang,* and Robert J. WordingerX

Purpose. Previous studies have suggested that the disappearance of anterior keratocytes after injury to the overlying epithelium is mediated by apoptosis. The authors examined the expression of the apoptosis-related modulators, Fas (receptor), Fas ligand, Bax, Bcl-2, Bcl-XL, and interleukin-1 beta converting enzyme (ICE) in corneal cells as candidate mediators of this response and tested the effect of Fas receptor-stimulating antibody on corneal stromal fibroblast cells in vitro. Methods. Reverse-transcription-polymerase chain reaction was used to detect FAS, FAS ligand, Bax, Bcl-2, Bcl-XL, and ICE mRNA expression in primary cultures of human corneal epithelial, stromal fibroblast, and endothelial cells. Immunohistochemistry was applied to detect Fas and Fas ligand proteins in fresh-frozen sections of normal human cornea. The effect of FASstimulating monoclonal antibody on first-passage stromalfibroblastswas studied using a DNA fragmentation assay, the live-dead assay with fluorescent microscopy, toluidene blue staining with light microscopy, and electron microscopy. Results. FAS, Fas ligand, Bax, Bcl-2, Bcl-XL, and ICE mRNAs are expressed in all three major cell types of the cornea. Fas protein is expressed in corneal epithelial, keratocyte, and endothelial cells in fresh-frozen human cornea. Fas ligand protein, however, was detected in corneal epithelial and endothelial, but not keratocyte, cells. Fas-stimulating antibody induced firstpassage stromal fibroblast cell death with morphologic changes and DNA fragmentation consistent with apoptosis. Conclusions. The Fas system (Fas and Fas ligand) modulators and final common pathway mediators of apoptosis are expressed in corneal cells. The distribution of Fas (epithelial, keratocyte, and endothelial cells) and Fas ligand (epithelial and endothelial cells) protein expression in fresh-frozen corneal tissue suggests that Fas ligand expressed in corneal epithelial and endothelial cells modulates functions in keratocyte cells and, possibly, autocrinejuxtacrine functions in epithelium and endothelium. The Fas-Fas ligand system is expressed in the cornea and could have important functions in normal corneal physiology and in the pathophysiology of corneal disease, including modulation of keratocyte apoptosis after epithelial injury. Invest Ophthalmol Vis Sci. 1996;37:1582-1592.

Apoptosis (programmed cell death) is a fundamental process that occurs during development, homeostasis, and wound healing in the tissues of essentially all multicellular organisms.1'2 We recently demonstrated From the *Eye Institute and the Department of Cell Biology, The Cleveland Clinic Foundation, Cleveland, Ohio; the f Department of Ophthalmology, University of Texas Southiuestern Medical Center at DalUis; and the %North Texas Eye Research Institute, University of North Texas Health Sciences Center, Fort Worth, Texas. Presented in part at the Ocular Cell and Molecular Biology Symposium, San Diego, California, August 1995, and the Association for Research in Vision and Ophthalmology, Fort Lauderdale, Florida, April 1996. Supported by US Public Health Service grant EY10056 from the National Institutes of Health. Submitted for publication January 17, 1996; revised March 21, 1996; accepted March 22, 1996. Proprietary interest calegoiy: N. Reprint requests: Steven E. Wilson, Eye Institute and Department of Cell Biology/ A31, The Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195.

1582

apoptosis of keratocytes mediated through epithelial stromal interactions after wounding of the corneal epithelium, 3 providing a mechanism for the disappearance of keratocytes in the anterior stroma after corneal wounding initially described by Nakayasu4 in the rat and Crosson5 in the rabbit and recently confirmed in primates. 6 We hypothesized a fundamental role for this system in the maintenance of corneal tissue organization, the response to injury, and the pathophysiology of corneal diseases.3 For example, apoptosis of the anterior stromal keratocytes that occurs after excimer laser photorefractive keratectomy probably is an initiating event in the subsequent wound healing response. 3 The molecular mechanisms underlying the initiaInvestigative Ophthalmology & Visual Science, July 1996, Vol. 37, No. 8 Copyright © Association for Research in Vision and Ophthalmology

Apoptosis-Related Modulators

1583

,,. CORTICOtion and regulation of apoptosis are topics of intense I STEROIDS 0 ;>* i, x investigation throughout the scientific community. Numerous mutations affecting mediators of specific stages of apoptosis have been identified in the nematode Caenorhabditis elegans7 and analogous modulators have been identified in higher organisms (Fig. I). 8 For example, the C. elegans death gene, ced-S, is analogous to interleukin-1 beta converting enzyme (ICE)like protease, and the ced-9 apoptosis inhibitory gene is analogous to Bcl-2.8 Specific cell types have been CENTRAL shown to have multiple, alternative, extracellular and DEATH SIGNAL MODULATOR "REAPER-DROSPHILA" intracellular apoptosis signaling pathways that converge on a single common death pathway (Fig. I). 8 For example, our recent studies have demonstrated that interleukin (IL)-l alpha and ILrl beta can induce apoptosis in corneal stromal fibroblasts in vitro and ICE-LIKE I PROTEASE; keratocytes in vivo.3 Because IL-1 alpha is expressed by corneal epithelial cells14'15 and ILrl receptor is expressed by keratocytes, 1617 we hypothesized that injury- or death-induced release of IL-1 alpha from corneal epithelial cells activates the final common apoptotic pathway in keratocytes, inducing cell death. We CELL could not inhibit the in vivo apoptotic response of DEATH keratocytes to epithelial wounding, however, by prior FIGURE l. Cell-specific and common pathways of apoptosis. injection of IL-1 receptor antagonist into the stroma. 3 Examples of cell-specific signaling pathways that produce One possible explanation for the ineffectiveness of ILapoptosis in cells are diagrammed above the broken hori1 receptor antagonist at inhibiting this response is zontal line. A particular cell type may undergo apoptosis expression of multiple systems activating the death of in response to several different signals. All the cell-specific the keratocyte cells in response to epithelial cell inpathways shown in the diagram are dependent on extracellujury. An important lesson learned from transgenic anilar signals. Cell-specific signals also may be intracellular. Each of the cell-specific pathways is thought to trigger a mal models is that such duplication of regulatory syscommon apoptotic pathway (diagrammed schematically betems is the norm for many cytokine- and growth factorlow the broken line) by a central death signal. The macromediated processes.18 In the current study, we have molecule serving this function in higher organisms has not examined corneal cell expression of several modulabeen identified. A gene called reaper that appears to serve tors known to be involved in apoptosis. These include such a function has been identified in Drosophila melanogasmodulators that are likely to regulate intercellular ter.9 The reaper gene product has been shown to integrate communication leading to apoptosis, such as Fas information from alternative signaling pathways. Deletions (APO-1) and Fas ligand, as well as members of the of reaperhave been found to suppress the apoptotic response final common apoptotic pathway (ICE, Bcl-2, Bcl-XL, to every stimulus evaluated to date. The subsequent steps and Bax). We also examined the effect of a Fas-stimu(arrows) leading to apoptotic cell death are likely ordered in a pathway. Many participants in the pathway have yet to lating antibody on corneal stromal fibroblasts. be identified in higher organisms. Interleukin-1 beta converting enzyme (ICE) or an ICE-like protein that is a mammalian homologue of the Caenorhabditis elegans cell death METHODS AND MATERIALS gene ced-S is one of the modulators in the common pathwav - T h e Bcl - 2 protein is able to suppress many apoptotic Immunohistochemistry for Fas and Fas Ligand death programs in higher organisms (dash indicates inhibiCorneoscleral rims were excised from eyes of patients tion)." Bcl-2 is the mammalian homologue to ced-9, the with conjunctival melanoma not involving the cornea gene product that suppresses apoptosis in cells of C. elegans. or choroidal melanoma within 5 minutes of evisceraAnother member of the Bcl family that appears to suppress tion or enucleation, respectively, embedded in Histo apoptosis Bcl-XL.12 Both Bcl-2 and Bcl-XL heterodimerize with a product of another gene called Bax.13 Overexpression Prep (Fisher, Fairlong, NJ), snap frozen in liquid nitrogen, and stored at — 85°C. The research followed of Bax accelerates apoptosis. The exact relationship of Bcl2, Bcl-X^, and Bax to cell survival versus apoptosis is unthe tenets of the Declaration of Helsinki, and inclear.""13 It appears, however, that the equilibrium between formed consent was obtained from each patient behomodimers and heterodimers of these proteins may have fore surgery after the nature and the possible consea role in regulating the common apoptotic pathway. Expresquences of the study were explained. This study was sion in corneal cells of modulators within hatched boxes is approved by the Institutional Review Boards at the investigated in this study.

1584 TABLE

Investigative Ophthalmology & Visual Science, July 1996, Vol. 37, No. 8

l. Polymerase Chain Reaction Primers

Modulator BCL^2 alpha BCL^X,. BAX alpha Beta actin ICE FAS FAS LIGAND

Reference Size 11 12 13 20 21 22, 23 24, 25

332/>332 379/unknown 482/=>482 321/772 424/=>424 413/>4000 177/177 750/^750

Upstream Primer

Downstream Primer

TTGTGGCCTTCTTTGAGTTCG (exon 1) GGAGCTGGTGGTTGACTTTCT AGACAGGGGCCCTTTTGCTTC (exon 2) AGGCCAACCGCGAGAAGATGACC (exon 3) AGCTTTGATTGACTCCGTTAT (exon 2) AGACTGCGTGCCCTGCCAAGA (exon 3) TTCTTCCCTGTCCAACCTCTG (exon 1)

TACTGCTTTAGTGAACCTTTT (exon 2) CCGGAAGAGTTCATTCACTAC GAGCACTCCCGCCACAAAGAT (exon 6) GAAGTCCAGGGCGACGTAGCAC (exon 4) CAGATTTTGTAGCAGCATTGT (exon 5) CAGGATTTAAGGTTGGAGATT (exon 7) AAAACATCACAAGGAGACACA (exon 1) TCTTCCCCTCCATCATCACCA (exon 4)

Cleveland Clinic Foundation, (Cleveland, OH) and the University of Texas Southwestern Medical Center (Dallas, TX). Seven-micrometer sections were prepared with a Reichert-Jung (Leica, Deerfield, IL) cryostat. Tissue sections were fixed in acetone at — 20°C for 10 minutes. Immunohistochemistry for Fas or Fas ligand was performed using standard methods involving biotinylated secondary antibodies and streptavidin-conjugated peroxidase (Universal LSAB + Kit, peroxidase; DAKO, Carpinteria, CA) according to the manufacturer's instructions, except that sections were incubated overnight at 37°C with Fas, Fas ligand, or control primary antibody. Fas immunohistochemistry was performed with an anti-human Fas mouse IgM monoclonal antibody (Upstate Biotechnology, Lake Placid, NY). Control immunohistochemistry was performed with a nonimmune mouse IgM (RD Systems, Minneapolis, MN). Both Fas and control antibodies were used at a concentration of 10 /ig/ml. An anti-Fas ligand rabbit polyclonal antibody (Fas-L N-20; Santa Cruz Biotechnology, Santa Cruz, CA) was used at a concentration of 2 /Ltg/ml. Control preabsorption was performed for Fas ligand by preincubating the antibody with sc-834P control Fas ligand peptide (Santa Cruz Biotechnology) at a concentration of 20 fxg/ml for 30 minutes before incubating with tissue sections overnight at 37°C. Reverse-Transcription-Polymerase Chain Reaction Method for the Detection of Messenger RNA Total cellular ribonucleic acid (RNA) was isolated, and cDNA was synthesized from human primary cultures of corneal epithelial, stromal fibroblast, and endothelial cells, as previously described.19 The quality of cDNA synthesis was monitored through the amplification of beta actin. Only cDNA yielding beta actin amplifications of the expected size for beta actin mRNA, without contamination with genomic beta actin amplification product of a larger size, was used for experimental amplification.19 Polymerase chain reaction primers for ICE, Fas, Fas ligand, Bcl-2, Bcl-XL, and Bax were designed from the previously reported sequences (Table 1)-"-13-iJ()-25 Polymerase chain reac-

tion reactions were performed with a temperature cycler (MJ Research, Watertown, MA) according to a previously described method.19 A modified hot-start method was used in which anti-TAQ polymerase antibody (Clontech, Palo Alto, CA) was added to the reactions, according to the manufacturer's instructions, to prevent initiation of amplification until after the reactions initially were raised to the antibody denaturing temperature of 70°C. Polymerase chain reaction amplification products were run on agarose gels as previously described.19 Polymerase chain reaction products were cut from agarose gels, cloned into the PCR II Cloning Vector (Invitrogen, San Diego, CA), and sequenced (Sequenase 2.0, United States Biochemical, Cleveland, OH) according to the manufacturer's protocols. Effect of Fas-Stimulating Antibody on Stromal Fibroblasts Primary human stromal fibroblast cells were cultured as previously described.19 First-passage stromal fibroblast cells were plated at densities from 5 X 102 to 1 X 105 cells/cm2 in standard six-well plates (Corning, Corning, NY) in Eagle's modified essential medium with 10% fetal bovine serum. Twenty-four hours after plating, the medium was changed to Eagle's modified essential medium with 0.5% fetal bovine serum before either 100 ng/ml of anti-human Fas mouse monoclonal IgM antibody (Upstate Biotechnology) or 100 ng/ml control mouse IgM (RD Systems) was added. After 24 hours, the percent of dead cells per field was determined in 10 randomly selected 100X inverted microscope fields (model TMF; Nikon, Melville, NY) for both the anti-Fas and control antibody groups. Statistical comparisons were made using the Mann-Whitney Test. P < 0.05 was considered statistically significant. Photographs also were obtained with the inverted microscope. First-passage human stromal fibroblasts exposed to anti-Fas or control antibody for 24 hours were tested for viability with the Live/Dead Eukolight Viability/ Cytotoxicity Assay (Molecular Probes, Eugene, OR) according to the manufacturer's instructions. Live cells have ubiquitous intracellular esterase activity that converts nonfluorescent, cell-permeant, calcein acet-

1585

Apoptosis-Relatcd Modulators

BP

EPI M 1 2

SF 1 2 3

600 • • • • • • • »

400-^^^^^^El

HCN 1 2 C

— y —a

a

413

FIGURE 2.

Fas mRNA expression in human corneal cells. Primary cultures of human corneal epithelial {EPI), stromal fibroblast (SF), and endothelial (HCN) cells were evaluated for the production of Fas mRNA by reverse-transcription polymerase chain reaction. Each corneal cell type yielded amplification bands of the expected size of 413 bp for Fas mRNA. M = 100 bp marker with sizes in bp (BP) indicated to the left. C = simultaneous control reaction without added cDNA target.

oxymethyl ester to calcein resulting in green fluorescence with a fluorescein isothiocyanate filter. The level of green fluorescence diminishes as cells die. Concurrently, ethidium homodimer enters dead cells because of increased permeability from membrane damage and binds nucleic acids. Chromatin within dead cells fluoresces red with a rhodamine filter. Chromatin condensation frequently can be detected in cells undergoing apoptosis. Computer-generated composites that allow both colors to be displayed simultaneously were obtained using cells plated onto 60 mm Petriperm tissue culture dishes (Bachofer, Reutlingen, Germany) and were viewed using a Leitz Fluovert FU microscope (Leica, Deerfield, IL) equipped with a Thermal Liquid Coupled Micro Incubator (Adams and List Associates, Westbury, NY) and constant 5% CO^ in an air perfusion system. Fluorescent images were captured digitally using a high-performance CCD camera (COHU, San Diego, CA) and integrator-frame storer (Colorado Video, Boulder, CO). Images were digitized using a 486 personal computer with a Data Translation DT3852 image acquisition card (Marlboro, MA) and 8 Mbytes of on-board memory. Individual images were transferred to a Silicon Graphics (Mountain View, CA) workstation (Personal Iris 4D-35G) and processed using the ANALYZE image processing software program (Mayo Medical Ventures, Rochester, MN). Final images were photographed using an AGFA-Matrix film recorder (model 6564; Orangeburg, NY) and 4X5 Ektachrome 64T (Eastman Kodak, Rochester, NY). First-passage human stromal fibroblasts were exposed to anti-Fas or control antibody for 24 hours. Dead cells were combined with living cells that had been removed from the culture flask by trypsinization. DNA was isolated, and ethidium bromide-stained gels were used to detect internucleosomal DNA fragmentation as previously described.20 The experiment was repeated three times. First-passage stromal fibroblasts exposed to antiFas monoclonal or control antibody were trypsinized,

washed with medium containing 10% fetal bovine serum, pelleted in a 1.5 ml Eppendorf tube, and fixed in 3% gluteraldehyde and 1% paraformaldehyde. Onemicron sections were stained with toluidine blue 1% in borate buffer and photographed with a light microscope (Optiphot-2, Nikon). Electron microscopy was performed as previously described27 on the fixed cell pellets. Electron microscopy sections were cut at 70 nm and stained with 3% uranyl acetate for 15 minutes, followed by 3 minutes in Reynold's lead citrate. RESULTS Fas mRNA was detected by reverse-transcription-polymerase chain reaction (RT-PCR) in corneal epithelial, stromal fibroblast, and endothelial cells (Fig. 2) in primary culture. Nucleic acid sequencing demonstrated that the amplification product of the expected size was identical to the known sequence for Fas. Fas protein was detected by immunohistochemistry in corneal epithelial, keratocyte, and endothelial cells (Fig. 3). Although each cell type stained diffusely, perinuclear staining was prominent. Fas ligand mRNA was detected by RT-PCR in all

0 0

o c> \

A

i

B

I

0

C

0 D

FIGURE 3. Immunohistochemical detection of Fas in human corneal cells. Fas protein was detected in human corneal

epithelial (A, between hollow arroios), keratocyte (A,C, arrows),

and endothelial (C, holloxv arrow) cells. The morphology of the human endothelial cells was distorted by cryostat sectioning, but this did not influence immunohistologic staining. Each cell type appeared to stain diffusely, although perinuclear staining seemed most prominent. No staining of cells was noted in adjacent sections when a nonimmune IgG was used as a control (B,D). Magnification, X200.

1586


FIGURE 4. Fas ligand mRNA expression in human corneal cells. Primary cultures of human corneal epithelial (EPI), stromalfibroblast(SF), and endothelial (HCN) cells were evaluated for the production of Fas mRNA by reverse-transcription-polymerase chain reaction. Each corneal cell type yielded amplification bands of the expected size of 177 bp for Fas ligand mRNA. M = a 100 bp marker with sizes in bp (BP) indicated to the left. C = a simultaneous control reaction without added cDNA target. three major cell types of the cornea in primary culture (Fig. 4). Nucleic acid sequencing demonstrated that the amplification product of the expected size was identical to the known sequence for Fas ligand. After the genomic organization of the Fas ligand was reported,25 we also tested a second downstream PCR primer that gave a different-sized PCR product for mRNA and genomic amplifications (Table 1). Amplification product of the expected size for mRNA (750 bp), but not genomic, amplification was detected (not shown) with the second primer set. Fas ligand protein was detected by immunohistochemistry in corneal epithelial and endothelial, but not keratocyte, cells (Fig. 5). Thus, although Fas ligand mRNA was detected in primary cultures of corneal stromal fibroblasts, Fas ligand protein was not detected in keratocytes in freshfrozen human cornea. After 12 to 24 hours of exposure to anti-Fas antibody and depending on the donor, a large proportion of first-passage stromal fibroblast cells had rounded up and dissociated from the culture plate (Fig. 6A). Few stromal fibroblasts rounded up and dissociated in flasks treated with control IgM (Fig. 6B). In a representative experiment with cells plated at 1 X 104 cells/ cm2, 75% ± 8% (SD) of stromal fibroblast cells exposed to anti-Fas antibody had dissociated and 1 % ± 1% exposed to control antibody had dissociated at 24 hours. The difference was statistically significant (P — 0.0002). Results were similar in five experiments performed with stromal fibroblasts from different donors. There appeared to be no difference in the response of stromal fibroblasts to die anti-Fas antibody with varying plating densities between 5 X 102 to 1 X 105 cells/cm8. The Live/Dead Eukolight Viability/ Cytotoxicity Assay (Molecular Probes) demonstrated that cells rounding up and dissociating from the plate in response to the anti-Fas antibody were dead or dying (Fig. 6C). In addition, fluorescence microscopy with this assay showed that many cells exposed to Fasstimulating antibody had chromatin condensation and fragmentation consistent with apoptosis.

Internucleosomal DNA fragmentation was detected when human stromal fibroblasts were exposed to Fas-stimulating antibody, but not to control antibody (Fig. 7). DNA fragments less than approximately 1500 bp could not be detected in three separate experiments. Toluidine blue-stained stromal fibroblast cells exposed to anti-Fas antibody had cell shrinkage, blebbing with formation of membrane-bound bodies, and condensation and fragmentation of the chromatin consistent with apoptosis (Figs. 8A to 8D). Control antibody-treated stromal fibroblast cells maintained normal cellular morphology with few cells showing changes consistent with apoptosis (Figs. 8E, 8F). Electron microscopy of pelleted stromal fibroblasts that had been exposed to anti-Fas antibody revealed large numbers of cells with chromatin condensation and nucleosomal fragmentation (Figs. 9A to 9C). There were also numerous membrane-bound cell fragments, many of which contained cell organelles (Figs. 9A to 9D). Many cells in the anti-Fas-treated cultures were observed not only to have chromatin

A

FIGURE 5. Immunohistochemical detection of Fas ligand in human corneal cells. Fas ligand protein was detected in human corneal epithelial (A, between arrows) and endothelial (C, arrow) cells but not in keratocyte cells (A,C). Note that in both epithelial and endothelial cells, a staining pattern consistent with Fas ligand association with the cell membrane was noted. The morphology of the human endothelial cells was distorted by cryostat sectioning, but this did not influence immunohistologic staining. Staining was reduced markedly when antibody was preincubated with Fas ligand antigen (B,D), demonstrating the specificity of the detection in human corneal cells. Magnification, X200.

1587


FIGURE 6. Effect of Fas-stimulating antibody on first-passage stromal fibroblast cells from human cornea. (A) After 24 hours of exposure to Fas-stimulating antibody, a large proportion of stromal fibroblasts had rounded up and dissociated from the culture plate. Note the large numbers of small membrane-bound cell fragments that are visible (see Fig. 6D). (B) Almost all cells exposed to control IgM remained attached to the plate. (C) Stromal fibroblasts exposed to anti-Fas antibody for 24 hours were stained with the Live/ Dead Eukolight Viability/Cytotoxicity Assay and photographed under a fluorescent microscope. A composite of identical fields generated with fluorescein isothiocyanate and rhodamine filters is shown. Cells at different stages of cell death after exposure to the anti-Fas antibody are illustrated. One cell at an early stage of death (a) had residual calcein green fluorescence and homogeneous red ethidium staining of the nucleus. Another cell (b) has progressed to have little green staining with heterogeneous staining of the chromatin associated with chromatin condensation. A cell (c) with almost no green staining had two areas of red fluorescence (arrows) caused by chromatin fragmentation. Two other cells (d) remained viable without evidence of ethidium staining. More than 99% of cells in control antibodytreated cultures have staining identical to the cells labeled d, with no cells showing patterns consistent wiui apoptosis like cells labeled b and c (not shown).

condensation but to be disintegrating, and the formation of large numbers of membrane-bound cell fragments was consistent with apoptotic bodies (Figs. 9A to 9D). The majority of stromal fibroblast cells treated with control antibody appeared to have normal morphology (Figs. 9E, 9F), although, even in control cultures, a few cells were seen that appeared to have morphologic changes suggestive of apoptosis. Bax and Bcl-2 mRNAs were detected by RT-PCR in corneal epithelial, stromal fibroblast, and endothelial cells in primary culture (Figs. 10A, 10B). Bcl-X^ mRNA was detected by RT-PCR in corneal epithelial, stromal fibroblast, and endothelial cells in primary culture (Fig. 11). Nucleic acid sequencing demonstrated that the amplification products of the expected

size were the known sequences for Bax, Bcl-2, and Bcl-XL. ICE mRNA was amplified by RT-PCR in corneal epithelial, stromal fibroblast, and endodielial cells in primary culture (Fig. 12A), although the expected product was not detected in one corneal epithelial cell culture. Nucleic acid sequencing demonstrated that the amplification product of the expected size (424 bp) was die known sequence for ICE. A smaller alternative amplification product was present in the RT-PCR reactions from each corneal cell type. Nucleic acid sequencing revealed diat die expected and alternative amplification products were identical, except the smaller product had an internal 63 bp deletion corresponding to amino acids 92 to 112 of die ICE precursor protein (Fig. 12B). These residues do not contribute to die mature ICE protein, which is composed of residues 120 to 297 and 317-404 of the precursor.21 The relative levels of the expected and alternative amplification products (essentially an internal quantitative PCR amplification within each reaction) varied between individual cell cultures. The ratio of the levels of the ICE amplifications with a particular cDNA target did not appear to be cell specific (Fig. 12A). DISCUSSION Apoptosis has been shown to be as critical to development, homeostasis, and wound healing as prolifera-

1590


BAX

BCL-2

HSF BP

HCE

HCN

M .424 BP S361 BP

B BAX

-CTC TCA GCA GM GAT C M ACATCTGSA AAT TAC CTT AAT ATC CAA Leu Ser Ala Asp Gin Thr Ser Gy Asn Tyr Leu Asn Met Gin

BCL-2

GAC TCT CAA GSA GTACTTTCT TCC TTT CCA GCT CCT CAG GCA Asp Ser Qn Gly Val Leu Ser Ser Phe Pro Ala Pro Gin Ala

12. Interleukin-1 beta converting enzyme (ICE) production in corneal cells. (A) Primary cultures of human stromal fibroblast (HSF), corneal epithelial (HCE), and corneal endothelial (HCN) cells were evaluated for the production of ICE mRNA by reverse-transcription-polymerase chain reaction (RT-PCR). Each corneal cell type yielded PCR product of the expected size for ICE (424 bp). The expected product was not, however, detected in one epithelial culture (donor 1). An alternative band (361 bp) was detected in each cell. Note the variability of the relative levels of the expected and alternative products within individual cell cultures. (B) Partial sequences of the previously reported and alternative ICE mRNAs and expected translation products. The 63-nucleotide sequence deleted within die alternative 361 bp ICE mRNA amplification is underlined. Note that this deletion will not produce a frame shift in the sequence beyond the deletion and, therefore, the amino acid residues before and after the deletion should be identical to the previously reported ICE precursor.21 FIGURE

B FIGURE 10. Bax and Bcl-2 mRNA expression in human corneal cells. (A) Reverse-transcription-polymerase chain reaction amplification products of the expected size for Bax (482 bp) and Bcl-2 (332 bp) mRNAs were detected in primary human stromal fibroblast cells. For each primer pair, results are shown for cDNA prepared from cells from three different donors (donors 1, 2 and 3). C = a simultaneous control amplification without cDNA for each primer set. M = a 100 bp marker with sizes in bp (BP) indicated to the left. (B) Bax and Bcl-2 mRNAs were detected by RT-PCR in primary cultures of human corneal epithelial (EPI) and endothelial (HCN) cells.

late corneal tissue organization.3 The distribution of expression of Fas-Fas ligand in the cornea suggests that such signaling could occur from the epithelial and endothelial cells to keratocyte cells by this system. The IL-1 -ILrl receptor system has been shown to have a similar pattern of cell expression in vivo and to induce comparable effects on corneal cells.3 Whether the Fas-Fas ligand and 1L-1-IL-1 receptor systems function independently or are interrelated cannot be determined from the current study. If soluble Fas ligand is released from epithelial cells after injury, it

• - * - 379 BP

200 FIGURE U. Bcl-XL mRNA expression in human corneal cells. Primary cultures of human corneal epithelial (EPI), stromal fibroblast (SF), and endodielial (HCN) cells were evaluated for the production of Bcl-X|. mRNA by reverse-transcription-polymerase chain reaction. Each corneal cell type yielded amplification bands of the expected size of 379 bp for Bcl-XL ligand mRNA. M = a 100 bp marker with sizes in bp (BP) indicated to the left. C = a simultaneous control reaction without added cDNA target.

could have a role in mediating apoptosis of underlying keratocytes in response to such injury.3 Autocrine function within the epithelium and endothelium also is possible because these cells express both Fas and Fas ligand. Recent experiments have demonstrated that the Fas-stimulating antibody will trigger death of primary human corneal epithelial or endothelial cells, and the death of these cells is accompanied by electron microscopic morphologic changes consistent with apoptosis (Mohan R, Wilson SE, unpublished data, 1996). Brunner et al37 demonstrated simultaneous expression of Fas and Fas ligand on T-cell hybridoma cells. These investigators showed that Fas and Fas ligand interaction, resulting in apoptosis, could occur on a single cell. It is, however, unclear how these interactions occur on a single cell.37 Griffith and coworkersM also recently reported the expression of Fas ligand protein in corneal epithelial and endothelial cells, as well as many other cells of the eye. Similar to our results, these investigators did not detect Fas ligand production in keratocyte cells. They suggested that Fas ligand produced by ocular cells could stimulate apoptosis of inflammatory cells expressing Fas and that these interactions had a role in maintaining immune privilege within the cornea and other areas of the eye.38 Although their data


convincingly demonstrate that these types of interactions may occur between corneal and immune cells, our demonstration of Fas mRNA and protein expression in each corneal cell type and stimulation of apoptosis in stromal fibroblasts by anti-Fas-stimulating antibody suggests that the Fas-Fas ligand system could be involved in regulation of corneal cells. The current study also demonstrated that mRNA coding for several mediators (Bax, BCL-2, BCL-XL, and ICE) of the common final pathway of apoptosis (Fig. 1) are expressed in corneal epithelial, stromal fibroblast, and endothelial cells in primary culture. We have discovered a smaller alternative PCR amplification product for ICE that also is expressed in each corneal cell type. Nucleic acid sequencing revealed that the expected and alternative ICE amplification products were identical, except that the latter had an internal 63 bp deletion corresponding to amino acids 92 to 112 of the precursor protein (Fig. 11B). These residues do not contribute to the mature ICE protein, which is composed of two subunits containing residues 120 to 297 and 317 to 404 of the precursor. 21 It is unknown whether the corresponding 21-amino acid deletion from the ICE precursor protein contains signaling or other information that might have functional relevance to the corresponding alternative protein. If the Bax, Bcl-2, Bcl-XL, and ICE proteins are expressed in each corneal cell type, each cell is likely to be competent to undergo apoptosis in response to appropriate signals. Studies that identify cell-specific signals activating the final common pathway of apoptosis are likely to provide important insights into the normal physiology and pathophysiology of corneal cells. Key Words apoptosis, Bax, Bcl-2, cornea, Fas, Fas ligand, interleukin-1 converting enzyme Acknowledgments The authors thank Alisdar McDowell and John Gabrovsek for their expert assistance with electron microscopy. References 1. Cohen JJ. Apoptosis: Physiologic cell death. J Lab Clin Med. 1994;124:761-765. 2. Hoffman B, Liebermann DA. Molecular controls of apoptosis: Differentiation/growth arrest primary response genes, proto-oncogenes, and tumor suppresser genes as positive and negative modulators. Oncogene. 1994;9:1807-1812. 3. Wilson SE, He Y-G, Weng J, Li Q, Vital M, Chwang EL. Epithelial injury induces keratocyte apoptosis: Hypothesized role for the interleukin-1 system in the modulation of corneal tissue organization. Exp Eye Res. 1996;62:325-338. 4. Nakayasu K. Stromal changes following removal of

1591

epithelium in rat cornea. Jpn J Ophthalmol. 1988; 32:113-125. 5. Crosson CE. Cellular changes following epithelial abrasion. In: Beuerman RW, Crosson CE, Kaufman HE, eds. Healing Processes in the Cornea. Houston: Gulf

Publishing; 1989:3-14. 6. Campos M, Szerenyi K, Lee M, McDonnell JM, McDonnell PJ. Keratocyte loss after corneal deepithelialization in primates and rabbits. Arch Ophthalmol. 1994; 112:254-260. 7. Hengartner MO, Horvitz HR. Programmed cell death in Caenorhabditis elegans. Curr Opin Genet Dev. 1994;

4:581-586. 8. Steller H. Mechanisms and genes of cellular suicide. Science. 1995; 267:1445-1449. 9. White K, Grether ME, Abrams JM, Young L, Farrell K, Steller H. Genetic control of programmed cell death in Drosophila. Science. 1994;264:677-683. 10. Miura M, Zhu H, Rotello R, Hartwieg E, YuanJ. Induction of apoptosis infibroblastsby IL-1 beta-converting enzyme, a mammalian homolog of the C. elegans cell death gene ced-3. Cell. 1993; 75:653-660. 11. Tsujimoto Y, Croce CM. Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc Natl Acad Sci USA. 1986; 83:5214-5218. 12. Boise LH, Gonzalez-Garcia M, Postema CE, et al. BclX, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell 1993; 74:597608. 13. Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programed cell death. Cell. 1993; 74:609619. 14. Wilson SE, He Y-G, Lloyd SA. EGF, EGF receptor, basic FGF, TGF beta-1, and interleukin-1 alpha mRNA in human corneal epithelial cells and stromal fibroblasts. Invest Ophthalmol Vis Sci. 1992; 33:1756-1765. 15. Wilson SE, Schultz GS, Chegini N, WengJ, He Y-G. Epidermal growth factor, transforming growth factor alpha, transforming growth factor beta, acidic fibroblast growth factor, basic fibroblast growth factor, and interleukin-1 proteins in the cornea. Exp Eye Res. 1994; 59:63-70. 16. Wilson SE, Lloyd SA, He Y-G. Glucocorticoid receptor and interleukin-1 receptor messenger RNA expression in corneal cells. Cornea. 1994; 13:4-8. 17. Fabre EJ, Bureau J, Pouliquen Y, Lorans G. Binding sites for human interleukin 1 alpha, gamma interferon and tumor necrosis factor on cultured fibroblasts of normal cornea and keratoconus. Curr Eye Res. 1991; 10:585-592. 18. Taverne J. Transgenic mice in the study of cytokine function. Int J Exp Pathol. 1993; 74:525-546. 19. Wilson SE, Walker JW, Chwang EL, He Y-G. Hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), their receptors, FGF receptor-2, and the cells of the cornea. Invest Ophthalmol Vis Sci. 1993; 34:25442561. 20. Ng S-Y, Gunning P, Eddy R, et al. Evolution of the functional neta-actin gene and its multi-pseudogene family: Conservation of noncoding regions and chro-

1592

21.

22.

23.

24.

25.

26.

27.

28.

29.


mosomal dispersion of pseudogenes. Mol Cell Biol. 1985; 5:2720-2732. Cerretti DP, Hollingsworth LT, Kozlosky CJ, et al. Molecular characterization of the gene for human interleukin-1 beta converting enzyme (IL1BC). Genomics. 1994; 20:468-473. Itoh N, Yonehara S, Ishli A, et al. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell. 1991;66:233-243. Cheng J, Liu C, Koopman WJ, Mountz JD. Characterization of human Fas gene: Exon/intron organization and promoter region. J Immunol. 1995; 154:1239-1245. Alderson M. Fas ligand mediates activation induced cell death in human T lymphocytes. / Exp Med. 1995;181:7l-77. Takahashi T, Tanaka M, Inazawa J, Abe T, Suda T, Nagata S. Human Fas ligand: Gene structure, chromosomal location and species specificity. Int Immunol. 1994;6:1567-1574. Zhivotovsky B, Cedervall B, Jiang S, Nicotera P, Orrenius S. Involvement of Ca2+ in the formation of high molecular weight DNA fragments in thymocyte apoptosis. Biochem Biophys Res Commun. 1994; 202:120127. Michel-Salmin LA, Tosi-Couture E, Gautier A, McDowall AW, Dubochet J. Electron microscopy of the chromosomes of dinoflagellate Porocentrum viicans: Confirmation of bouligands liquid crystal hypothesis. / Ultrastruct Moke Struct Res. 1986; 97:10-30. Zakeri ZF, Quaglino D, Latham T, Lockshin RA. Delayed internucleosomal DNA fragmentation in programmed cell death. FASEBJ. 1993; 7:470-478. Fini ME, Strissel KJ, Girard MT, Mays JW, Rinehart WB. Interleukin 1 alpha mediates collagenase synthe-

30.

31. 32. 33.

34.

35. 36.

sis stimulated by phorbol 12-myristate 13-acetate. Chem. 1994; 269:11291-11298. Girard MT, Matsubara M, Fini ME. Transforming growth factor-beta and interleukin-1 modulate metalloproteinase expression by corneal stromal cells. Invest Ophthalmol Vis Sci. 1991; 32:2441-2454. Nagata S, Golstein P. The Fas death factor. Science. 1995;267:1449-1456. Ni R, Tomita Y, Matsuda K, et al. Fas-mediated apoptosis in primary cultured mouse hepatocytes. Exp Cell Res. 1994; 215:332-337. Oishi M, Maeda K, Sugiyama S. Distribution of apoptosis-mediating Fas antigen in human skin and effects of anti-Fas monoclonal antibody on human epidermal keratinocyte and squamous cell carcinoma cell lines. Arch Dermatol Res. 1994;286:396-407. Sayama K, Yonehara S, Watanabe Y, Miki Y. Expression of Fas antigen on keratinocytes in vivo and induction of apoptosis in cultured keratinocytes. / Invest Dermatol. 1994; 103:330-334. Tanaka M, Suda T, Takahashi T, Nagata S. Expression of the functional soluble form of human fas ligand in activated lymphocytes. EMBOJ. 1995; 14:1129-1135. Kimura K, Wakatsuki T, Yamamoto M. A variant mRNA species encoding a truncated form of Fas antigen in the rat liver. Biochem Biophys Res Commun.

1994; 198:666-674. 37. Brunner T, Mogil RJ, LaFace D, et al. Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature. 1995; 373:441-444. 38. Griffith TS, Brunner T, Fletcher SM, Green DR, Ferguson TA. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science. 1995; 270:11891192.