The Fatty Acid Amide Hydrolase ( FAAH) Gene ...

Short Communication

75

The Fatty Acid Amide Hydrolase (FAAH) Gene Variant rs324420 AA/AC is not Associated with Weight Loss in a 1-Year Lifestyle Intervention for Obese Children and Adolescents

Affiliations

N. Knoll1, A.-L. Volckmar1, C. Pütter2, A. Scherag2, M. Kleber3, J. Hebebrand1, A. Hinney1*, T. Reinehr3* 1

Department of Child and Adolescent Psychiatry, University of Duisburg-Essen, Essen, Germany Institute for Medical Informatics, Biometry and Epidemiology, University of Duisburg-Essen, Essen, Germany 3 Vestische Hospital for Children and Adolescents, University of Witten/Herdecke, Datteln, Germany 2

Abstract ▼ Adult obese carriers of the A allele of SNP rs324420 in the fatty acid amide hydrolase (FAAH) gene lose more weight and improve associated phenotypes better than non-carriers during an intervention. We aimed to replicate this finding in obese children and adolescents undergoing a one year lifestyle intervention (Obeldicks program). A total of 453 overweight and obese children and adolescents (10.8 ± 2.6 years, BMISDS 2.4 ± 0.5; 55 % girls) were genotyped for rs324420 (C/A) by restriction fragment length polymorphism (RFLP) analysis. Participants were prescribed a balanced diet, containing 55 En % carbohydrates, 30 En % fat, and 15 En % proteins. Moreover, they took part in an exercise therapy once a week. Blood was taken at baseline and after 1 year of intervention. Anthropometric (height, weight, BMI, and BMI-SDS) and plasma received 19.07.2011 accepted 05.10.2011 Bibliography DOI http://dx.doi.org/ 10.1055/s-0031-1291306 Published online: November 8, 2011 Horm Metab Res 2012; 44: 75–77 © Georg Thieme Verlag KG Stuttgart · New York ISSN 0018-5043 Correspondence A. Hinney Department of Child and Adolescent Psychiatry University of Duisburg-Essen Virchowstraße 174 45147 Essen Germany Tel.: +49/201/9597 025 Fax: +49/201/7227 302 [email protected]

Abbreviations ▼ BMI-SDS FAAH HOMA LDL/HDL MAF RFLP TAG TC

Body mass index-standard deviation score Fatty acid amide hydrolase Homeostasis model assessment Low/high density lipoprotein Minor allele frequency Restriction fragment length polymorphism Triacylglycerides Total cholesterol

Introduction ▼ The endocannabinoid system is involved in the control of food intake. Fatty acid amide hydrolase (FAAH) inactivates the orexigenic effect of the * These authors contributed equally to this work.

parameters (total cholesterol, LDL-cholesterol, HDL-cholesterol, triacylglycerides, glucose, insulin, and HOMA) as well as blood pressure were measured. Both mean BMI and BMI-SDS improved significantly. The mean systolic blood pressure was also lowered and concentrations of HDL-cholesterol increased significantly. However, none of the measured changes were associated with FAAH rs324420 AA/AC genotype. We did not detect evidence for an association of FAAH genotypes with weight reduction in overweight and obese children and adolescents. Hence, the previous finding in adults could not be confirmed. As the length (1 year as compared to 3 months) and mode of treatment (hypocaloric diet in adults vs. physical activity plus balanced meals) of the interventions varied, these parameters might have influenced the inconsistent results.

endocannabinoid N-arachidonoylethanolamine (anadamide) by a rapid hydrolysis to ethanolamine and arachidonic acid [1–3]. We previously genotyped rs324420 of the FAAH gene in 368 obesity trios (comprising 1 extremely obese child or adolescent and both parents) and 235 independent obesity families (more than 1 obese child). Initially, we detected evidence for a negative association of the A allele of rs324420 (nominal p = 0.02) with childhood obesity. The results could not be confirmed in 8 491 adults of a population-based study (KORA) and in 985 obese adults vs. 588 normal and underweight controls [3]. A study in obese and dislypidemic adults showed that carriers of the A allele of rs324420 had a stronger decrease in triacylglyceride (TAG) levels and total cholesterol (TC) after a 6-week low-fat diet compared to homozygotes for the C allele [4]. Recently, de Luis et al. [5] reported that obese adult homo- or heterozygous carriers of the A allele showed larger improve-

Knoll N et al. FAAH Polymorphism and Weight Loss … Horm Metab Res 2012; 44: 75–77

This document was downloaded for personal use only. Unauthorized distribution is strictly prohibited.

Authors

76 Short Communication

Subjects and Methods ▼ Subjects A total of 453 German individuals (10.8 ± 2.6 years, BMI-SDS 2.4 ± 0.5; 55 % girls) completed a 1-year intervention within the program “Obeldicks”. The ascertainment and intervention strategy has previously been described in detail [6–8]. Briefly, participating individuals had to prove their motivation before entering the intervention program. BMI was expressed as standard deviation score (BMI-SDS) to quantify the degree of overweight [9]. Fasting serum insulin, glucose, triglyceride, total cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol were determined. Blood pressure was measured according to the guidelines of the National High Blood Pressure Education Program [10]. Subjects were prescribed an “optimized mixed diet”, containing 55 % carbohydrates of total dietary energy (En %), including 5 % sugar, 30 En % fat and 15 En % proteins. Moreover, individuals took part in a physical session once a week. The study was approved by the ethics committees of the Universities of Witten/Herdecke and Duisburg-Essen. All individuals and, in the case of minors, their parents gave written informed consent. The study was carried out according to the Declaration of Helsinki.

Genotyping All 453 overweight and obese children and adolescents were genotyped for rs324420 (C/A) using restriction fragment length polymorphism (RFLP) analysis. Primers were established via Primer3 (http://frodo.wi.mit.edu/primer3/; F: TTAAAAGGCCA GTTCTACATGAT; R: ATGACCCAAGATGCAGAGCA). The resulting 300 bp PCR product was digested with StyI (37 °C; 3 h; C allele: 168 bp and 132 bp, A allele: undigested). For validity of genotypes, alleles were rated independently by at least 2 experienced individuals. Discrepancies were resolved unambiguously either by reaching consensus or by retyping.

Statistics Hardy-Weinberg equilibrium was fulfilled (p ≥ 0.01; exact test; [11]). Following de Luis et al. [5], all analyses were performed under a dominant genetic model for the A allele (AA/CA carriers were tested against CC carriers). Linear regression with sex, age and baseline measurement as covariates was used for all changes ▶ Table 1). Analyses without baseline of the analyzed variables (● measurements as covariates had no impact on the conclusions. Nominal 2-sided p-values and descriptive statistics (mean ± SD) by genotype group are provided. Due to the fact that we were not able to find evidence for a significant genetic association (e. g., at a significance level of 5 %), correction for multiple testing was not performed. A significance level of 5 % was applied to explore genotype-independent changes in the variables after the intervention. Power calculations were done using QUANTO Version 1.2.3 (http://hydra.usc.edu/gxe) with the estimates from de Luis et al. [5] – a minor allele frequency (MAF) of ~13 % and a

decrease in weight of 2.4 ± 3.8 kg for CC carriers compared to 3.5 ± 3.6 kg for AA/CA carriers. A total of 453 obese children and adolescents who completed the intervention were estimated to yield a power of 0.84/0.76 to detect such an effect (α = 0.05; 1-sided for confirmation/2-sided of the directional hypothesis). Thus, the study should be well powered to confirm the initial findings even for the case of larger MAF as, for example, reported for the HapMap CEU samples or the latest 1 000 Genomes data base freeze (04/19/2011).

Results ▼ ▶ Table 1; Both BMI and BMI-SDS were on average lower (● explorative p < 0.05) after completing the one-year intervention program “Obeldicks” (n = 453). The mean systolic blood pressure of the subjects was also lowered, and average levels of HDL-cholesterol increased (explorative p < 0.05). Regarding the primary focus of our paper, the genotype-dependent effects on these intervention (change) outcomes, we observed that none of the 13 change outcomes analyzed was significantly (p > 0.05) different for AA/CA allele carriers of FAAH rs324420 as compared to ▶ Table 1). CC allele carriers (●

Discussion and Conclusion ▼ Two studies reported that overweight or obese adult carriers of the A allele of rs324420 had larger improvements in several plasma and anthropometric parameters after an intervention than noncarriers [4, 5]. We investigated the effect of the A allele of rs324420 on change outcomes of 453 obese children and adolescents undergoing a 1-year intervention program and observed no evidence for a genotype-dependent effect on any of the 13 intervention outcomes studied (all p > 0.05). Our study was well powered to confirm the previously reported findings for rs324420. Despite the possibility of an originally false positive finding there are other reasons why we potentially could not confirm the previous findings of Aberle et al. [4] and de Luis et al. [5]. First, the lengths and mode of treatment of the interventions differed. Subjects of de Luis et al. [5] were prescribed a 3-month hypocaloric diet while the subjects in Aberle et al. [4] were prescribed a 6-week low fat diet. The “Obeldicks” intervention, in contrast, comprised the prescription of a balanced diet for 1 year plus physical activity once a week. It is possible that genotypedependent effects only have an effect on short term diet induced interventions. Secondly, the populations of the 3 studies differed. The mean age of the subjects of one study was 43.6 ± 10.5 years [4], and subjects of the other study were 45.9 ± 14.3 years [5] while in our study only children and adolescents (10.8 ± 2.6 years) were included. Thus, the A allele of rs324420 might have an impact on weight loss and associated outcomes in adults but not in children and adolescents. Thirdly, it is also possible that the genotype-dependent effects on the outcomes are relatively weaker in children and adolescents as compared to adults. Comparing the results of the previous studies and our study on a descriptive level we observed that the BMI-SDS, which is the adequate measurement in children to detect weight loss, decreased to the same extent (ΔBMISDS = 0.3) in both CC and AA/CA carriers in our study. By contrast, the decrease for CC carriers was 2.4 ± 3.8 kg compared to



ments in body mass, waist circumference, total cholesterol (TC), and low-density lipoprotein (LDL) cholesterol after a 3-month hypocaloric diet. Here we investigated whether the AA/CA genotype of rs324420 has an impact on the level of weight reduction or associated phenotypes in obese children and adolescents undergoing a 1- year lifestyle intervention (Obeldicks program, [6]).

Short Communication

77

Table 1 Changes in anthropometric and plasma variables. CA or AA (n = 151) T1

T0

T1

p

(baseline)

(1 year after

(baseline)

(1 year after

(dominant genetic

intervention onset)

model)#

intervention onset) 2

BMI (kg/m )* BMI-SDS* Weight (kg)* Height (cm)* TC (mg/dl) LDL-cholesterol (mg/dl) HDL-cholesterol (mg/dl)* TAG (mg/dl) Glucose (mg/dl)* HOMA* Insulin (mU/l) RRdias (mm Hg)* RRsys (mm Hg)*

27.3 ± 4.6 2.4 ± 0.5 63.5 ± 20.1 150.2 ± 15.5 170.0 ± 30.8 103.3 ± 71.3 49.1 ± 13.9 102.3 ± 52.8 83.9 ± 17.1 2.6 ± 4.2 14.6 ± 12.5 65.1 ± 12.5 114.6 ± 17.1

26.9 ± 4.9 2.1 ± 0.6 67.1 ± 20.4 156.2 ± 14.6 168.5 ± 32.0 97.0 ± 34.1 50.8 ± 14.6 101.2 ± 54.3 86.5 ± 32.6 4.3 ± 3.9 15.7 ± 11.4 64.5 ± 12.6 111.2 ± 15.3

27.5 ± 4.1 2.4 ± 0.5 64.8 ± 18.1 152.1 ± 13.7 174.7 ± 38.5 107.1 ± 38.7 49.4 ± 13.9 113.8 ± 65.4 84.0 ± 15.2 2.8 ± 3.6 15.3 ± 11.3 66.6 ± 12.5 117.2 ± 18.0

26.8 ± 4.0 2.1 ± 0.6 68.0 ± 17.9 157.9 ± 13.4 174.5 ± 37.0 101.4 ± 34.5 51.9 ± 13.8 105.3 ± 48.6 87.0 ± 19.5 4.5 ± 3.7 15.7 ± 8.9 65.9 ± 12.8 114.2 ± 17.3

0.37 0.74 0.59 0.96 0.35 0.44 0.58 0.58 0.89 0.81 0.49 0.99 0.44

Values are mean ± SD #

For the Wald test statistics of the linear regression with sex, age, and baseline measurement as covariates when no transformations were applied to the data – however, running the same analysis on log10-transformed outcomes, or omitting the baseline as covariate did not alter the conclusions

*p ≤ 0.05 different compared to baseline BMI-SDS: BMI standard deviation score; HOMA: Homeostasis Model Assessment; TAG: triacylglycerol; TC: total cholesterol

3.5 ± 3.6 kg for AA/CA carriers in the study of de Luis et al. [5]. Moreover, CC carriers in the study of de Luis et al. [5] increased TAG levels by 9.7 mg/dl and CA/AA carriers decreased TAG by 15.7 mg/dl on average. A stronger effect was reported in Aberle et al. [4]: a reduction of 34.9 mg/dl in CC carriers vs. a reduction of 101 mg/dl in AA/CA carriers. Descriptively, the TAG reduction in our study was smaller, but had the same direction when comparing genotype groups (1.1 mg/dl [CC carriers] vs. 8.5 mg/dl [AA/CA carriers]). Weight reduction and associated change outcomes in overweight and obese children and adolescents, which underwent a 1-year intervention trial, were not associated with FAAH genotypes. Thus, we did not confirm previous findings in adults being subjected to short-term dietary intervention programs.

Acknowledgements ▼ We would like to thank all participants for their voluntary contribution. We would like to acknowledge the excellent technical assistance of S. Düerkop. This study was supported by grants of the German Federal Ministry of Education and Research (BMBF 01KU0903; NGFNplus: 01GS0830, 01GS0820) and the IFORES program of the University of Duisburg-Essen. The funders had no role in study design, data collection and analysis, decision to

publish, or preparation of the manuscript. This study is registered at clinicaltrials.gov (NCT00435734).

References 1 Di Marzo V, Bifulco M, De Petrocellis L. Nat Rev Drug Discov 2004; 3: 771–784 2 Williams CM, Kirkham TC. Physiol Behav 2002; 76: 241–250 3 Müller TD, Brönner G, Wandolski M, Carrie J, Nguyen TT, Greene BH, Scherag A, Grallert H, Vogel CI, Scherag S, Rief W, Wichmann HE, Illig T, Schäfer H, Hebebrand J, Hinney A. BMC Med Genet 2010; 11: 2 4 Aberle J, Fedderwitz I, Klages N, George E, Beil FU. Horm Metab Res 2007; 39: 395–397 5 de Luis DA, Gonzalez Sagrado M, Aller R, Izaola O, Conde R. Metabolism 2011; 60: 730–734 6 Reinehr T, de Sousa G, Toschke M, Andler W. Am J Clin Nutr 2006; 84: 490–496 7 Reinehr T, Temmesfeld M, Kersting M, de Sousa G, Toschke AM. Int J Obes 2007; 31: 1074–1077 8 Reinehr T, Hebebrand J, Friedel S, Toschke AM, Brumm H, Biebermann H, Hinney A. Obesity (Silver Spring) 2009; 17: 382–389 9 Kromeyer-Hauschild K, Wabitsch M, Kunze D, Geller F, Geiß HC, Hesse V, von Hippel A, Jaeger U, Johnson D, Kiess W, Korte W, Kunze D, Menner K, Müller M, Niemann Pilatus A, Remer T, Schaefer F, Wittchen HU, Zabransky S, Zellner K, Hebebrand J. Monatsschr Kinderheilkd 2001; 149: 807–818 10 National High Blood Pressure Education Program Working Group on High Blood Pressure in Children and Adolescents. Pediatrics 2004; 114 (Suppl 2, 4th report): 555–576 11 Wigginton JE, Cutler DJ, Abecasis GR. Am J Hum Genet 2005; 76: 887–893



CC (n = 302) T0

Copyright of Hormone & Metabolic Research is the property of Georg Thieme Verlag Stuttgart and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.