The histone variant H2A.Z is dynamically expressed in the developing ...

Placenta 36 (2015) 1325e1328

Contents lists available at ScienceDirect

Placenta journal homepage: www.elsevier.com/locate/placenta

Short communication

The histone variant H2A.Z is dynamically expressed in the developing mouse placenta and in differentiating trophoblast stem cells Georgia R. Kafer a, b, *, Peter M. Carlton a, Sigrid A. Lehnert c a

Institute for Integrated Cell-Material Sciences (iCeMS), Kyoto University, Kyoto, Japan School of Biomedical Sciences, The University of Queensland, Brisbane, Australia c Commonwealth Scientific and Industrial Research Organization (CSIRO), Agriculture Flagship, St Lucia, QLD 4067, Australia b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 June 2015 Received in revised form 3 August 2015 Accepted 31 August 2015

The histone variant H2A.Z is important in establishing new chromatin environments necessary for permitting changes in gene expression and thus differentiation in mouse embryonic stem (mES) cells. In this study we show that H2A.Z is highly expressed in the early mouse placenta, and is specifically limited to progenitor-like trophoblast cells. Using in vitro models, we revealed distinct differences in H2A.Z abundance between undifferentiated, differentiating and differentiated mouse trophoblast stem (mTS) cells. Our work supports the hypothesis that in addition to roles in differentiating mES cells, H2A.Z is also involved in the differentiation of extra-embryonic tissues. © 2015 Published by Elsevier Ltd.

Keywords: H2A.Z H2A.Z Placenta Trophoblast Differentiation Progenitor

1. Introduction

2. Methods

The role of chromatin biology in mTS differentiation has received comparably little attention relative to mES counterparts. This is well illustrated by research into the histone “H2A.Z”, a highly conserved variant of the canonical histone H2A. H2A.Z typically replaces H2A in nucleosomes surrounding transcriptional start sites [1], [2] and [3]. The expression of H2A.Z in the inner cell mass is tightly linked to differentiation and mES cells lacking H2A.Z are able to proliferate and self-renew but are unable to differentiate [1] and [4]. Interestingly however, H2A.Z is first detectable in trophoblast cells [4] and H2A.Z/ preimplantation mouse embryos are viable up to and including the blastocyst stage, but die at a time of development that coincides with the initiation of trophectoderm outgrowth [5]. Despite evidence that H2A.Z may be required for trophoblast differentiation, H2A.Z has not been investigated in the context of placentation. Here, we have examined H2A.Z mRNA and protein abundance in the developing mouse placenta and during in vitro differentiation of mTS cells.

2.1. In situ hybridization

Abbreviations: mES, mouse embryonic stem; mTS, mouse trophoblast stem; EPC, ecto-placental cone; E, embryonic day; TGC, trophoblast giant cell; RA, retinoic acid; P-TGC, parietal trophoblast giant cell. * Corresponding author. http://dx.doi.org/10.1016/j.placenta.2015.08.018 0143-4004/© 2015 Published by Elsevier Ltd.

The Animal Ethics and Experimentation Committees of the University of Queensland approved all experiments on mice. Briefly, placental tissues from pregnant mice were dissected at 8.5, 9.5, 10.5, 12.5, 14.5 and 16.5 days of pregnancy, embedded in paraffin and sectioned. Serial sections of placentae isolated from at least 6 different animals were stained for H2A.Z mRNA by in situ hybridization with DIG-labeled probes and counterstained with NuclearFast red. Dissection, processing and in situ hybridization experiments were performed as previously described [6] and [7]. 2.2. In vitro cell culture TS cells were grown as previously described [8]. Differentiation media was RPMI devoid of growth factors and heparin. Where necessary, cells were treated with 5 mM retinoic acid (RA, Sigma) dissolved in ethanol. 2.3. Quantitative real-time PCR Total RNA was isolated from TS cells, immediately reverse

1326

G.R. Kafer et al. / Placenta 36 (2015) 1325e1328

transcribed and subjected to qRT-PCR procedures as previously described [6]. Expression of H2A.Z (F-GTGGTGTCATCCCACACATC; R-AAGCCTCCAACTTGCTCAAA), Errb (F-AACAGCCCCTACCTGAACCT; R-CTCATCTGGTCCCCAAGTGT), Elf5 (F-ATGTTGGACTCCGTAACCCAT; R-GCAGGGTAGTAGTCTTCATTGCT), Gcml (F-CATCTACAGCTCGGACGACA; R-CCTTCCTCTGTGGAGCAGTC), Mash2 (FGAGCAGGAGCTGCTTGACTT; R-TCCGGAAGATGGAAGATGTC) and Pl1 (F-CTGCTGACATTAAGGGCA; R-AACAAAGACCATGTGGGC) was normalized relative to internal housekeeping gene 18S, and represented as means of at least 3 individual experiments (±S.E.M). All

statistical analysis was performed using GraphPad Prism software.

2.4. Immunofluorescence Cells were grown on 0.1% gelatin-coated coverslips, fixed (4% PFA), permeablized (0.5% Triton-X), washed, blocked (4% BSA) and incubated with primary antibodies (Pl-I, 1:200 Santa Cruz (sc34713); H2A.Z, custom made Operon sequence directed against the C terminus, 1:50), incubated with secondary antibodies (Alexa Flour), counterstained (DAPI) and imaged on a wide-field DeltaVision

Fig. 1. H2A.Z expression during mouse placentation. Histological sections of E8.5 (A), E9.5 (B), E10.5 (C), E12.5 (D), E14.5 (E) and E16.5 (F) placentas stained for H2A.Z mRNA by in situ hybridization with DIG-labeled probes (F, GTGGTGTCATCCCACACATC; R, AAGCCTCCAACTTGCTCAAA) and counterstained with NuclearFast red. Black dotted lines indicate boundaries of gross placental features including the ectoplacental cone (epc), maternal decidua (dec), chorion (ch) (A), spongiotrophoblast zone (sp), labyrinth zone (lab) and presence of trophoblast giant cells (tgc) (B-F). Areas of immature spongiotrophoblast cell clusters (i-spt) and early cell clusters within the labyrinth zone (i-lab) are indicated by blue and magenta dotted lines respectively (BeE). Areas of immature glycogen trophoblast cell clusters (i-glyt) are indicated by green dotted lines (D). Black bar, 1 mm; red bar, 0.5 mm. Representative images from individual experiments performed on serial sections of placentae isolated from at least 6 different animals.


1327

Fig. 2. Temporal H2A.Z dynamics in differentiating mouse TS cells. TS cells were grown under conditioned media (supplemented with FGF4 and heparin) then switched to TS media only and treated with either ethanol (vehicle control, (-RA) or with 5 mM retinoic acid (þRA) dissolved in ethanol to encourage parietal trophoblast giant cells (P-TGC) differentiation. (A) Phase contrast images of Rs26 TS cells in vitro. At day 10 eRA differentiating cells appeared as a heterogeneous population of cells, however, cells differentiating in þRA conditions appeared to primarily form large P-TGC. (B) Quantitative reverse transcription PCR was performed on Rs26 TS cells isolated every two days for 10 days. Expression of H2A.Z, Errb, Elf5, Gcml, Mash2 and Pl-1 was assayed and normalized relative to internal housekeeping gene 18S, and represented as means of at least 3 individual experiments (±S.E.M). Comparisons are between eRA and þRA cells at like time points. (C) Pl-I, DAPI morphology and nuclear volume was assessed in undifferentiated TS3.5 cells and cells induced to differentiate for 4 days by Heparin/FGF4 withdrawal (-RA). (D) H2A.Z protein levels were quantified based on discernable H2A.Z spots relative to nuclear volume in TS cells and P-TGC and TGC identifiable by nuclear morphology (means ± S.E.M for 3 individual experiments, n ¼ 30 nuclei per cell type. For (C) and (D) images are representative and all post-capture processing was performed using identical parameters for like stains. Images were acquired using a 100x oil objective (immersion liquid refractive index 1.513) corrected for bleaching and lamp flicker, processed using constrained iterative deconvolution, chromatic aberration corrected through sub-pixel shifting. P-TGC and TGC populations compared to TS cell counterparts. Black scale bars ¼ 10 mm, white scale bars ¼ 5 mm. For all statistics, bonferroni post tests were performed to determine significant differences, represented as *P < 0.05, **P < 0.01 and ***P < 0.001.

1328


deconvolution system (Applied Precision). Quantitative analysis was performed using Imaris spot and volume functions (Bitplane). 3. Results and discussion At E8.5 the ecto-placental cone and chorionic regions of the immature placenta, which contain progenitor cells for the spongiotriphoblast and labyrinth placental zones respectively, were highly positive for H2A.Z (Fig. 1A). In later days (E9.5, 10.5 and 12.5), H2A.Z expression become increasingly restricted to smaller clusters of cells in the labyrinth and spongiotrophoblast zones which were likely pools of progenitor cells as they lacked the morphological characteristics of terminally differentiated trophoblast (Fig. 1B, C D). H2A.Z expression dramatically declined at E14.5 (Fig. 1E) and was absent 2 days later (Fig. 1F), coincident with the loss of all progenitor cell populations from the mouse placenta [9]. The differentiation of Rs26 TS cells in vitro by Heparin/FGF withdrawal results in decreased TS proliferation and triggers the differentiation of progenitor trophoblast cells that after several days develop into terminally differentiated trophoblast cell subtypes including trophoblast giant cells (TGC) (Fig. 2A). Treating TS cells with retinoic acid under these conditions results in a higher proportion of cells adopting a parietal TGC (P-TGC) fate and is known to accelerate P-TGC maturation [8], [10] and [11] (Fig. 2A). This in vitro system provided us with an avenue to study H2A.Z in populations of cells with differing rates of lineage commitment. Using qRT-PCR to we found that H2A.Z expression peaked 2 days following differentiation initiation, and was higher in eRA cells relative to þRA cells (Fig. 2B, P < 0.001). We assayed genes representing different types of trophoblast progenitor cells to determine if higher H2A.Z expression in eRA cells correlated to an increased proportion of progenitor cells relative to þRA populations. Errb and Elf5 are both expressed exclusively by multipotent TS cells [12] and [13] and both genes remained elevated for longer in eRA differentiating cells (Fig. 2B, P < 0.05), consistent with the notion that RA treatment induces terminal differentiation faster than Heparin/FGF withdrawal alone. Mash2, a gene transiently expressed in progenitor spongiotrophoblast cells [14] peaked at day 2 of differentiation in -RA differentiating cells (P < 0.001) but declined rapidly after RA treatment (Fig. 2B). Gcm1, a marker of labyrinth progenitors [15] was similarly elevated in cells differentiating with and without RA, but persisted for longer in þRA cells (Fig. 2B). Pl-I is expressed specifically in P-TGCs but is reduced once P-TGC mature. Both cells differentiating with and without RA displayed an immediate rise in Pl-I, however Pl-1 expression declined earlier in þRA cells (Fig. 2B, P < 0.001), indicating accelerated P-TGC maturation. Overall, we find that H2A.Z peaked in eRA cells at a time that coincided with the elevated expression of many progenitor genes relative to faster differentiating þRA cell counterparts. We used an independent mTS cell line (TS3.5) to investigate changes in H2A.Z protein levels. Individual P-TGC cells were identifiable from other TGC cells based on Pl-1 positivity and the presence of a large nucleolus. TGC were generally distinguishable from proliferating TS cells by increased nuclear volumes (Fig. 2C, P < 0.001). We found that H2A.Z protein levels were also reduced in differentiated cells, and confirmed that H2A.Z reductions were observed generally in TGC relative to undifferentiated, proliferating TS cells (Fig. 2D, P < 0.05). In summary we find that H2A.Z is more abundant in progenitor trophoblast cell populations relative to differentiated counterparts both in vivo and in vitro. Given that H2A.Z is known to be involved in enabling a dynamic chromatin environment that allows for changes in gene expression profiles [1] and [2], we suggest that this

function of H2A.Z is needed for trophoblast differentiation. Further, we speculate that the previously documented lethality associated with H2A.Z knockout embryos [5] may be to insufficient trophoblast differentiation and early placental insufficiency. Conflict of interest statement I, Dr. Georgia Kafer, hereby state that there is no potential conflict of interest associated with the submitted manuscript entitled “The histone variant H2A.Z is dynamically expressed in the developing mouse placenta and in differentiating trophoblast stem cells.” June 26th, 2015. Acknowledgments We thank Dr. David Simmons for valuable discussions regarding the manuscript and assistance with in situ hybridization experiments. We thank T Kunath and J Rossant for providing the Rs26 TS cells (to David Simmons) and S Tanaka for providing TS3.5 cells. During this work, an APA award, generous support from the School of Biomedical Sciences at The University of Queensland and a JSPS postdoctoral fellowship, supported G.R.K. References [1] M.P. Creyghton, S. Markoulaki, S.S. Levine, J. Hanna, M.A. Lodato, K. Sha, et al., H2AZ is enriched at polycomb complex target genes in ES cells and is necessary for lineage commitment, Cell 135 (4) (2008 Nov 14) 649e661. [2] M. Ku, J.D. Jaffe, R.P. Koche, E. Rheinbay, M. Endoh, H. Koseki, et al., H2A.Z landscapes and dual modifications in pluripotent and multipotent stem cells underlie complex genome regulatory functions, Genome Biol. 13 (10) (2012 Oct 3) R85. [3] R.M. Raisner, P.D. Hartley, M.D. Meneghini, M.Z. Bao, C.L. Liu, S.L. Schreiber, et al., Histone Variant H2A.Z Marks the 50 Ends of Both Active and Inactive Genes in Euchromatin, Cell 123 (2) (2005 Oct 21) 233e248. [4] D. Rangasamy, L. Berven, P. Ridgway, D.J. Tremethick, Pericentric heterochromatin becomes enriched with H2A.Z during early mammalian development, Embo J. 22 (7) (2003 Apr 1) 1599e1607. [5] R. Faast, V. Thonglairoam, T.C. Schulz, J. Beall, J.R. Wells, H. Taylor, et al., Histone variant H2A.Z is required for early mammalian development, Curr. Biol. Cb 11 (15) (2001 Aug 7) 1183e1187. [6] G.R. Kafer, S.A. Lehnert, M. Pantaleon, P.L. Kaye, R.J. Moser, Expression of genes coding for histone variants and histone-associated proteins in pluripotent stem cells and mouse preimplantation embryos, Gene Expr. Patterns Gep. 10 (6) (2010 Sep) 299e305. [7] D.G. Simmons, S. Rawn, A. Davies, M. Hughes, J.C. Cross, Spatial and temporal expression of the 23 murine Prolactin/Placental Lactogen-related genes is not associated with their position in the locus, BMC Genomics 9 (2008) 352. [8] S. Tanaka, T. Kunath, A.K. Hadjantonakis, A. Nagy, J. Rossant, Promotion of trophoblast stem cell proliferation by FGF4, Science 282 (5396) (1998 Dec 11) 2072e2075. [9] M. Ueno, L.K. Lee, A. Chhabra, Y.J. Kim, R. Sasidharan, B. Van Handel, et al., cMet-Dependent Multipotent Labyrinth Trophoblast Progenitors Establish Placental Exchange Interface, Dev. Cell 27 (4) (2013 Nov 25) 373e386. [10] D.G. Simmons, A.L. Fortier, J.C. Cross, Diverse subtypes and developmental origins of trophoblast giant cells in the mouse placenta, Dev. Biol. 304 (2) (2007 Apr 15) 567e578. [11] J. Yan, S. Tanaka, M. Oda, T. Makino, J. Ohgane, K. Shiota, Retinoic acid promotes differentiation of trophoblast stem cells to a giant cell fate, Dev. Biol. 235 (2) (2001 Jul 15) 422e432. [12] M. Donnison, A. Beaton, H.W. Davey, R. Broadhurst, P. L'Huillier, P.L. Pfeffer, Loss of the extraembryonic ectoderm in Elf5 mutants leads to defects in embryonic patterning, Dev. Camb. Engl. 132 (10) (2005 May) 2299e2308. re, Placental [13] J. Luo, R. Sladek, J.A. Bader, A. Matthyssen, J. Rossant, V. Gigue abnormalities in mouse embryos lacking the orphan nuclear receptor ERRbeta, Nature 388 (6644) (1997 Aug 21) 778e782. [14] M. Tanaka, M. Gertsenstein, J. Rossant, A. Nagy, Mash2 acts cell autonomously in mouse spongiotrophoblast development, Dev. Biol. 190 (1) (1997 Oct 1) 55e65. [15] L. Anson-Cartwright, K. Dawson, D. Holmyard, S.J. Fisher, R.A. Lazzarini, J.C. Cross, The glial cells missing-1 protein is essential for branching morphogenesis in the chorioallantoic placenta, Nat. Genet. 25 (3) (2000 Jul) 311e314.