The IL-4/IL-13/Stat6 signalling pathway promotes luminal mammary ...

RESEARCH ARTICLE 2739

Development 134, 2739-2750 (2007) doi:10.1242/dev.003194

The IL-4/IL-13/Stat6 signalling pathway promotes luminal mammary epithelial cell development Walid T. Khaled1, Eliot K. C. Read1, Sandra E. Nicholson2, Fiona O. Baxter1, Amelia J. Brennan1, Paul J. Came1,*, Naomi Sprigg2, Andrew N. J. McKenzie3 and Christine J. Watson1,† Naïve T helper cells differentiate into Th1 and Th2 subsets, which have unique cytokine signatures, activators and transcriptional targets. The Th1/Th2 cytokine milieu is a key paradigm in lineage commitment, and IL-4 (Il4), IL-13 (Il13) and Stat6 are important mediators of Th2 development. We show here, for the first time, that this paradigm applies also to mammary epithelial cells, which undergo a switch from Th1 to Th2 cytokine production upon the induction of differentiation. Thus, the Th1 cytokines IL-12 (Il12), interferon gamma (INF␥; also known as Ifng) and Tnf␣ are downregulated concomitantly with the upregulation of the Th2 cytokines IL-4, IL-13 and IL-5 (Il5) as epithelial cells commit to the luminal lineage. Moreover, we show that Th2 cytokines play a crucial role in mammary gland development in vivo, because differentiation and alveolar morphogenesis are reduced in both Stat6 and IL-4/IL-13 doubly deficient mice during pregnancy. This unexpected discovery demonstrates a role for immune cell cytokines in epithelial cell fate and function, and adds an unexpected tier of complexity to the previously held paradigm that steroid and peptide hormones are the primary regulators of mammary gland development.

INTRODUCTION Cytokines perform crucial functions in cell fate decisions. Within the immune system, cytokines play central roles in determining the differentiation of naïve CD4+ T helper (Th) cells into either of two lineages; T helper 1 (Th1) or T helper 2 (Th2) (Mosmann et al., 1986). The polarization of Th cells into either Th1 or Th2 is regulated, respectively, by IL-12 (Il12), which activates Stat4 (Jacobson et al., 1995; Thierfelder et al., 1996), and IL-4/IL-13 (Il4/Il13), which activate Stat6 (Kaplan et al., 1996). Disruption in the developmental control of Th1 and Th2 cells has been associated with diseases such as asthma, autoimmunity and cancer (Chatila, 2004; Moss et al., 2004). Elegant experiments using various transgenic mouse models have identified factors involved in the regulation of Th2 development (reviewed in Ansel et al., 2006; Farrar et al., 2002; Murphy and Reiner, 2002). Ablation of IL-4 (Kuhn et al., 1991), Stat6 (Kaplan et al., 1996; Shimoda et al., 1996; Takeda et al., 1996) or IL-13 (McKenzie et al., 1998) expression leads to perturbed Th2 cell development and reduced type-2 immunity in mice. It is now clear that Th2 cells activate Stat6 in response to IL-4/IL-13, which, in turn, activates the transcription factor Gata3 (Zheng and Flavell, 1997). Gata3 has been shown to be essential for Th2 development because it is required for chromatin remodelling at the IL-4 locus, which facilitates transcription of the IL-4, IL-13 and IL-5 (Il5) genes (Takemoto et al., 1998). This can occur even in the absence of Stat6 (Ouyang et al., 2000). There are other factors that have been identified as regulators of Th2 development, such as c-Maf (Maf) 1

Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QP, UK. 2Division of Cancer and Haematology, The Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Parkville, Victoria 3050, Australia. 3 Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 2QH, UK. *Present address: Faculty of Life Sciences, University of Manchester, Oxford Road, Manchester, M13 9PT, UK † Author for correspondence (e-mail: [email protected]) Accepted 30 May 2007

and NFAT1 (also known as Nfatc2). c-Maf is a transcription factor that is expressed predominantly in Th2 cells and induces the transcription of IL-4 (Ho et al., 1998). On the other hand, NFAT1 has been shown to be a negative regulator of Th2 development, because ablation of its expression leads to marked Th2 development (Xanthoudakis et al., 1996). The regulation of Th1/Th2 differentiation is complicated further by the involvement of the suppresser of cytokine signalling (SOCS) family of proteins. SOCS proteins are cytokine-inducible Src homology 2 (SH2)-domaincontaining proteins that negatively regulate cytokine signalling (Alexander and Hilton, 2004). Socs1 and Socs3 have been implicated in negatively regulating the Th1 cytokines IFN-␥ and IL12, respectively (Egwuagu et al., 2002; Fujimoto et al., 2002; Marine et al., 1999; Seki et al., 2003). Conversely, Socs5 has been shown to be expressed in Th1 cells, where it interacts with the IL-4R␣ chain and thereby attenuates IL-4 signalling, thus negatively regulating Th2 differentiation (Seki et al., 2002). Mammary epithelial cells undergo a massive expansion in number during pregnancy. The current paradigm in mammary gland biology is that proliferation and differentiation of these epithelial cells is primarily under the control of estrogen (E), progesterone (P) and prolactin (Prl) (Hennighausen and Robinson, 2001; Rosen, 2004). Progenitor cells differentiate into either luminal or myoepithelial cells; milk is produced by the luminal cells and expelled into ducts by contraction of the myoepithelial cells. The factors that control commitment to these lineages have not been well defined. Our previous microarray data indicated that Stat6 was abundantly expressed in mammary glands during development (Clarkson et al., 2004). Thus, we sought to address whether the Stat6 signalling pathway is involved in mammary gland development in addition to the roles of Stat5 (Liu et al., 1997) and Stat3 (Chapman et al., 1999) in different mammary developmental processes. Therefore, we characterized the cytokines, receptors and transcription factors that are involved in the Stat6 signalling pathway in both mammary gland in vivo and in mammary epithelial cells (MECs) in culture. Examination of mammary gland development in Stat6–/– and IL4–/–/IL-13–/– animals revealed a role for the Stat6 signalling pathway

DEVELOPMENT

KEY WORDS: Th2 cells, Cytokines, Mammary gland, Signalling, Mouse

2740 RESEARCH ARTICLE

MATERIALS AND METHODS Mice and cell lines –/–

CCCTCACACTCAGATCATCTTCT, Rev, GCTACGACGTGGGCTACAG; Gata3 Fwd, CTCGGCCATTCGTACATGGAA, Rev: GGATACCTCTGCACCGTAGC. All primers were purchased from SigmaAldrich. Analysis was performed using iCycler iQ Real-Time Detection System Software (BioRad). All real-time PCR products were sequenced and specificity was confirmed using BLAST. Whole mounts and H&E staining

For whole-mount analysis, abdominal glands (no. 4) were spread out using forceps on a glass slide and incubated in Carnoy’s fixative (6 parts 100 % ethanol, 3 parts chloroform and 1 part glacial acetic acid) overnight. The slide was washed in water and placed in carmine alum stain (1 g Carmine, 2.5 g aluminum potassium sulphate and 500 ml of dH2O) overnight. The slide was washed with ethanol and cleared in xylene for 1 day before documentation. For histological analysis, abdominal glands were fixed in 4% formaldehyde in PBS for 24 hours at room temperature. The glands were transferred to 70% ethanol and stored at –20°C until embedding and sectioning. All tissues were embedded in wax and sectioned at 5 ␮m before being stained with haematoxylin and Eosin (H&E).

Stat6 mice (Kaplan et al., 1996) were purchased from Jackson Laboratories and were maintained and bred in a positive pressure isolator within an SPF animal facility. Wild-type Balb/c mice were purchased from Harlan Laboratories. IL-4–/–/IL-13–/– mice (McKenzie et al., 1999) and corresponding wild-type Balb/c strain-matched controls were obtained from A.N.J.M. (co-author). IL-4–/–/IL-13–/– mice were maintained and bred in a positive pressure isolator. Socs5–/– mice (Brender et al., 2004) and corresponding wild-type BL/6 strain-matched controls were provided by Douglas Hilton (Walter and Eliza Hall Institute of Medical Research, Victoria, Australia). Non-obese diabetic (NOD) and NOD-severe combined immune deficiency (NOD-SCID) mice (Balb/c background) were from Anne Cooke (Department of Pathology, University of Cambridge, UK). All animals were treated according to local ethical committee and UK Home Office guidelines. Virgin female mice at 8- to 14-weeks old were mated, plug checked to confirm timing of mating and pregnancy was confirmed postmortem to avoid pseudo-pregnancies. At least three mice of each genotype and each time point were analysed. KIM-2 cells (Gordon et al., 2000) were grown to confluency in 1:1 DMEM:F12 (Invitrogen) media containing 10% FCS (Sigma), 0.8 mM Insulin (Sigma), 0.8 mM EGF (Sigma) and 17 mM Linoleic acid (Sigma). For differentiation induction, cells were grown to confluency and then differentiation media was added comprising 1:1 DMEM:F12, 10% FCS, 0.8 mM Insulin, 0.2 mM Prolactin (Sigma), 1 mM Dexamethasone (Sigma) and 17 mM Linoleic acid. Zero time-points were collected 24 hours post media change prior to the start of cytokine treatment. IL-4 and IL-13 (R&D) were used at the indicated concentrations (Fig. 6). EpH4 cells were grown in 1:1 DMEM:F12 supplemented with 10% FCS.

Lymph node-free abdominal mammary glands and cells were extracted with a lysis buffer containing 50 mM Tris-HCl pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1⫻ Cocktail protease inhibitors (Roche), 1 mM Na3VO4, and 1 mM NaF. Protein concentration was determined with the BCA colorimetric assay (Pierce) and samples were separated on criterion gels (BioRad). Immunoblotting and antibody detection using enhanced chemiluminescence (ECL, GE Healthcare) were performed as described previously (Abell et al., 2005). The following antibodies from Cell Signaling Technology were used: rabbit anti-pAkt (Akt is also known as Akt1)/PKB (Ser 473), rabbit anti-total Akt/PKB and mouse anti-pERK1/2. Other commercial antibodies used were mouse anti-ERK1/2 (Transduction Laboratories), mouse anti-pStat6 (Y641) (Abcam) rat anti-tubulin (Abcam) and goat anti-IL-4r␣ (R&D systems). Antibodies purchased from SCBT were: rabbit anti-Stat6 (M-20), rabbit anti-Gata3 and rabbit anti-c-Maf. Secondary HRP-conjugated antibodies were from Dako Cytomation. ␤-casein antibody was a kind gift from Bert Binas (Texas A & M University, Texas, TX).

RNA extraction and PCR primers

Immunohistochemistry

Mammary tissue was snap frozen in liquid nitrogen and ground to a fine powder using a mortar and pestle. Tissue (100 mg) was dissolved in 1 ml of Tri-reagent (Sigma). RNA extraction was performed using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. The RNA quantity and integrity was determined using a NanoDrop ND-1000 (NanoDrop Technologies). cDNA was synthesized by random hexanucleotide-primed reverse transcription from 2 ␮g of total RNA using the Transcriptor reverse transcription cDNA synthesis kit (Roche). Semi-quantitative detection of Il4ra, Il13ra1, Gata3, Gapdh and cyclophillin A (CypA, Ppia) was performed by PCR using Taq polymerase (Qiagen). The following primers were used (all primers are shown 5⬘-3⬘): Il4ra Fwd, TGGGCTGTCGATTTTGCTTTTGG, Rev, GTGCTGGGGTGGGAATCTGGTC; Il13r␣1 Fwd, GGCCATCCTGCAAAATAGTG, Rev, ACAGCGTCGGCAAGAACA; Gata3 Fwd, TGGGTGGGGCCTCATCCTCAG, Rev, ACCGGGTCCCCATTAGCGTTCCT; Gapdh Fwd, CGGCAAATTCAACGGCACAGTCAA, Rev, CTTTCCAGAGGGGCCATCCACAG; and Cyclophillin A Fwd, CCTTGGGCCGCGTCTCCTT, Rev, CACCCTGGCACATGAATCCTG. Quantitative real-time detection of cDNA was performed using iCycler supermix (BioRad) with the addition of fluorescein (BioRad) and SYBR-green (Sigma) according to the supplier’s recommendations. The real-time PCR reactions were run in an iCycler (BioRad) in triplicate. Sequences of the following primers used for real-time PCR were obtained using the PrimerBank (Wang and Seed, 2003) website (http://pga.mgh.harvard.edu/primerbank/): Il4 Fwd, GGTCTCAACCCCCAGCTAGT, Rev, GCCGATGATCTCTCTCAAGTGAT; Il13 Fwd, CCTGGCTCTTGCTTGCCTT, Rev, GGTCTTGTGTGATGTTGCTCA; Il5 Fwd, CTCTGTTGACAAGCAATGAGACG, Rev, TCTTCAGTATGTCTAGCCCCTG; Il12a Fwd, CTGTGCCTTGGTAGCATCTATG, Rev, GCAGAGTCTCGCCATTATGATTC; Ifng Fwd, ATGAACGCTACACACTGCATC, Rev, CCATCCTTTTGCCAGTTCCTC; Tnfa Fwd,

Immunoblotting

Paraffin-embedded mammary sections were de-paraffinized and antigen retrieval was performed using boiling 10 mM Tri-sodium citrate buffer, pH 6.0, for 10 minutes. Sections were blocked in 10% normal goat serum (normal rabbit serum in the case of IL-4r␣) (Dako) for 1 hour at room temperature. Sections were either incubated with primary antibody at 1:100 for phosphorylated Stat6 (pStat6); at 1:50 for Gata3, c-Maf and IL-4R␣ or with isotype control overnight at 4°C and detected using Cy3-conjugated secondary antibodies (Sigma) and bisbenzimide-Hoechst 33342 (Sigma). For intracellular KIM-2 cytokine staining, cells were grown on chamber slides (NUNC) and treated with Brefeldin-A 10 ␮g/ml (Sigma) for 4 hours prior to fixing in 1:1 acetone:methanol. Slides were blocked in 10% normal goat serum and stained with antibodies against IL-4 (1:50; R&D) or IL-13 (1:50; R&D). Microscopy and statistical analysis

Fluorescence microscopy was carried out using a Zeiss Axiovert S100TV microscope equipped with a Hamamatsu C4742-95 ORCA1 digital camera, with images visualized and manipulated using AQM 6 Advanced Kinetic Acquisition Manager software (Kinetic Imaging). The DAB IHC and H&E stains were visualized on a LEICA light microscopy. The mouse mammary gland whole mounts were visualised using the LEICA MZ75 light microscope. Quantification of images and immunoblots was performed using National Institutes of Health (NIH) ImageJ software. Statistical analysis was performed using the Sigma Stat 3.5 software package (Sysstat Software). Cytokine array

Medium (1 ml) from cultures of KIM-2 cells at day 0 and day 8 of differentiation was analysed using a Cytokine array I (RayBio) following the manufacturer’s protocol. Chemiluminescence was detected using ECLhyperfilm (GE Healthcare).

DEVELOPMENT

in branching morphogenesis, because development during gestation was found to be delayed. Conversely, deletion of Socs5, a negative regulator of Stat6, resulted in accelerated development. Furthermore, analysis of MECs in culture revealed a switch from Th1 to Th2 cytokine production coincident with the induction of differentiation to the luminal lineage.

Development 134 (15)

Stat6 controls mammary gland development

RESEARCH ARTICLE 2741

Microarray

cDNA from Stat6–/– mice was compared to wild-type cDNA via competitive hybridization to the arrays. A mouse exonic evidence based oligonucleotide (MEEBO) array was used (Pathology Department, Centre for Microarray Resources, Cambridge, UK). Each experiment was repeated with a dye swap for technical replicate (repeat hybridizations on separate slides using independent labelling of the same starting RNA preparations) and with three biological replicates. Total RNA from wild-type and Stat6–/– glands at day 5 of gestation was isolated using TRI reagent (Sigma) and cleaned using RNeasy columns (Qiagen), in accordance with to the manufacturer’s protocols. cDNA target preparation was amplified and labelled as described by Petalidis and co-workers (Petalidis et al., 2003), except that 5 ␮l of MgCl2 was added to the second-strand amplification reaction mix. A constant number of 14 cycles was used. For the labelling step, 2 ␮l of Cy3-dCTP or Cy5-dCTP was used with 22 ␮l of second-strand cDNA. The labelled products were purified using G50 columns, according to the manufacturer’s instructions (Amersham Biosciences UK). Labelled samples were combined and hybridized for 16 hours at 50°C with 4 ␮l of Cot-1 DNA, 1 ␮l PolyA (8 ␮g/␮l) and 1 ␮l yeast tRNA (4 ␮g/␮l). Arrays were scanned using an Axon 4100A (Axon Instruments) and signal quantification was performed using Blue Fuse 3.2 (BlueGnome). Analysis was performed using FSPMA (Sykacek et al., 2005).

RESULTS Stat6 signalling in MECs in vivo The Stat6 signalling pathway has not been described previously as having a role in mammary gland development. Therefore, we performed reverse transcriptase (RT)-PCR (see Fig. S1 in the supplementary material) and immunoblots for the primary factors involved in Stat6 signalling. Phosphorylation of Stat6 was induced at day 5 of gestation and maintained until lactation (Fig. 1A). Interestingly, levels of IL-4R␣ and Gata3 increased from day 10 of gestation, whereas c-Maf was increased later, from day 15 of gestation. To determine which cells express these factors, immunohistochemistry for phosphorylated Stat6 (pStat6), Gata3, cMaf and IL-4R␣ was carried out on sections of mammary tissue (Fig. 1B-I). This study revealed that pStat6 was expressed in a minority of virgin ductal epithelial cells, whereas, by day 5 of gestation, most ductal/luminal cells exhibited nuclear pStat6 (Fig. 1B,C). Interestingly, IL-4R␣ expression was localised to the apical surface of luminal cells during gestation only (Fig. 1D,E), whereas the transcription factors Gata3 and c-Maf were localised in the nuclei of epithelial cells (Fig. 1F-I).

DEVELOPMENT

Fig. 1. Stat6 is upregulated and activated at the onset of pregnancy. (A) Protein was extracted from inguinal mammary glands from virgin mice; from mice at day 5, 10 and 15 of gestation; and from mice at day 0 (day of birth), 5 and 10 of lactation. Immunoblotting was performed for phosphorylated Stat6 (pStat6), Stat6, IL-4R␣, Gata3, c-Maf and ␣-tubulin. pStat6 and Stat6 immunoblots were quantified using ImageJ software and plotted on a histogram (right). (B-I) Immunohistochemistry (IHC, right panels; left panels, merged with DAPI staining) was performed on mammary gland sections from wild-type mice for: pStat6 in virgin mice (B) and mice at day 5 of gestation (C); IL-4R␣ in virgin mice (D) and mice at day 15 of gestation (E); Gata3 in mice at day 5 of gestation (F); and c-Maf in mice at day 15 of gestation (G). (H) pStat6 staining in Stat6–/– mice at day 5 of gestation. (I) Rabbit isotype control staining on wild-type mice at day 5 of gestation.

2742 RESEARCH ARTICLE

Development 134 (15)

Stat6-deficient mammary glands exhibit delayed development We hypothesized, based on the above data, that Stat6 would be important for normal mammary gland development. Mice deficient for Stat6 (Kaplan et al., 1996) were mated and mammary tissue harvested at various time points. Whole-mount and histological analysis of mammary glands collected from 5-weekold virgin Stat6–/– mice displayed no apparent abnormality compared to wild-type mice (see Fig. S2 in the supplementary material). However, analysis of the gestational time points showed a striking reduction in the number of side branches and alveolar buds in the absence of Stat6 at day 5 compared with strainmatched wild-type controls (Fig. 2A). At days 10 and 15 of gestation, development progressed but was delayed, and the

density of the lobuloalveolar structures was diminished (Fig. 2B,C). This was clearly demonstrated in the haematoxylin and Eosin (H&E)-stained sections where the number of alveoli was approximately 70, 50 and 30% less at days 5, 10 and 15, respectively (Fig. 2D). The reduced number of epithelial cells suggests a defect in proliferation, and this was confirmed by immunostaining for Ki67, a marker of proliferation. Fig. 2E shows that the number of Ki67 positively staining cells was reduced by approximately 50% in the Stat6-deficient glands at day 5 of gestation. Interestingly, this reduction in proliferation was reversed by day 15 of gestation, suggesting a compensatory mechanism for the absence of Stat6. This ‘catch-up’ proliferation would account for the more subtle phenotype observed at the late gestation time points and the ability of Stat6–/– dams to nurse their pups.

DEVELOPMENT

Fig. 2. Delay in lobuloalveolar development in Stat6–/– mice. (A-C) Whole mounts (left panels) and haematoxylin and Eosin (H&E)-stained sections (right panels) of mammary glands at day 5 (A), 10 (B) and 15 (C) of gestation from wild-type (WT) and Stat6–/– mice. Images shown are representative of at least three mice. (D) The number of alveoli was scored in H&E images from wild-type and Stat6–/– mice at 40⫻ magnification and the area of the fat pad was measured using ImageJ software. The number of alveoli/mm2 was calculated and the percentage relative to wild type was plotted. Student’s ttest was performed and *, ** and *** indicate statistical significance with P values of P