The Myogenin Gene Is Activated during Myocyte Differentiation by Pre ...

Val. 269, No. 25, Issue of June 24, pp. 17289-17296, 1994 Printed in U.S.A.

T H E JOURNAL OF B r o w c l c ~CHEMISTRY ~ 0 1994 by The American Soeiety for Biochemistry and Molecular Biology, Inc

The Myogenin GeneIs Activated during Myocyte Differentiation by Pre-existing, Not Newly Synthesized Transcription FactorMXF-Z* (Received for publication, December 20, 1993, and in revised form, March 11, 1994)

Astrid Buchberger, Karsten Ragge, and Hans-Henning Arnold+ From the Department of Cell and Molecular Biology, University of Braunschweig, Spielmannstrasse 7, 38106 Braunschweig, Federal Republic of Germany

roles for the four myogenic factors The myogenin gene,a member of the gene family en- tempts to assess individual coding muscle-specific basic-helix-loop-helix transcrip-in transfected cells, however, have been hampered by the fact that each protein indiscriminately directs nonmuscle cells into tion factors, is activated in myoblasts at the onset of the myogenic lineage resulting in the activation of a plethora of differentiationandcanbeinduced in fibroblastsby cross-activation of the forced expressionof MyoD or its relatives. Here, were- muscle-specific genes and auto- and port that a small proximal promoter region of Myf-4 the myogenic bHLH protein genesthemselves (for review, see gene, the human myogenin homolog, suffices to direct Buckingham (1992)). Circumstantial evidence also suggests muscle-specific expression and up-regulation by MyoD. negative regulation between some of the bHLH family memThe minimal promoter contains an E-box anda MEF-2 bers (Peterson et al., 1990; Rudnicki et al., 1992; Braun and consensuselement.Paradoxically,wefindthatthe Arnold, 1994). These regulatory interactions in culture cells MEF-2binding site but not the E-box is necessary for cell have made it difficult to study the authenticmechanisms and type-specific expression and activation by MyoD in tis- circuits controlling the expression of the muscle regulatory sue culture cells. This suggests an activating mechanism genes themselves as well as additional transcription factors which is independent of direct protein interactions at which may also be involved in muscle differentiation. the E-box. MEF-2 binding complexes were detected in Interestingly, all establishedmuscle cell lines express MyoD myoblasts and myotubes, as well as in fibroblasts with andor Myf-5 in committed myoblasts and activate transcripno strict correlation to myogenin expression. Moreover, transcription of myogenin could be induced in the pres- tion of myogenin only when induced to differentiation. These findings have been interpreted that Myf-5 and MyoD, but not ence ofpotentinhibitorsofproteinsynthesis.From these results we conclude that myogenin expressionis myogenin, may define the myoblast stage and under appropriactivation not mediated primarily through de novo synthesis of ate conditions cause or essentially contribute to the MEF-2 but rather involves a post-translational mode of of the myogenin gene. Expression of myogenin then leads to overt terminal muscle differentiation. Evidence for this view activation. was provided by mouse mutants carrying inactivated myogenic regulatory genes. Animalslacking functional Myf-5 show a conThe formation of skeletal muscle in vertebrates involves a siderable delay of myotome formation and myogenin expresfamily of myogenic regulatory genes encoding the basic-helix- sion, but myogenesis proceeds apparently undisturbed during loop-helix (bHLH)l transcription factors Myf-5, myogenin, subsequent steps of development (Braun et al., 1992). MyoD MyoD, and MRF-4 (for review, see Olson (1990), Weintraub et null mutant mice develop normal skeletal muscle and syntheal. (1991), Emerson (19901, and Arnold and Braun (1993)). size myogenin, most likely due to a sustained high level of Each of these genes can activate myogenesis in a variety of Myf-5 expression (Rudnicki et al., 1992). Significantly, double transfected tissue culture cells in vitro, suggesting that they mutants lacking Myf-5 and MyoD genes fail to expressmyogemay play an important role in muscle cell determination and nin and develop no skeletal muscles nor myogenic precursor differentiation. During embryonicdevelopment,members of cells (Rudnicki et al., 1993). Taken together, this then suggests this gene family are expressed only in skeletal muscle cells that both Myf-5 and MyoD can activatemyogenin expression in within the myotomal compartment in somites, visceral arches, a functionally overlapping fashion and both may constitute and limb buds. Their spatio-temporal expression patterns are upstream regulators of muscle cell specification. In contrast to consistent withspecific myogenic functions in vivoand support single Myf-5 and MyoD mutations with no or rather mild efthe idea of successive transcriptional events leading to cell fects on myogenesis, inactivation of the myogenin gene inmice determination and differentiation (Sassoon et al., 1989; Ott et results in dramatically reduced levels of differentiated myofial., 1991; Bober et al., 1991; Hinterberger et a l . , 1991). At- bers, although these animalscontain apparently normal numbers of myoblasts (Hasty et al., 1993; Nabeshima et al., 1993). * This work was supported by a fellowship of the “Deutsche Muskel- This indicates thatmyogenin plays a crucial role in executing schwundhilfe e. V.” ( t o K. R.) and grants from “Deutsche Forschungs- the terminalmuscle differentiation program in vivo,consistent of publication of with its presumed function in cultured muscle cells. gemeinschaft”and the European Community. The costs this article were defrayed in part by the payment of page charges. This Activation of many muscle-specific genes appears to be dearticle must therefore be hereby marked “advertisement”in accordance pendent on the DNA consensus sequence CANNTG, referred to with 18 U.S.C. Section 1734 solely to indicate this fact. as E-box, which constitutes the binding site for the bHLH tran$ To whom correspondence should be addressed: Dept. of Cell and A + T-rich sequence element is Molecular Biology, Institute of Biochemistry and Biotechnology, Univer- scription factors. In addition, an Braunschweig, Ger- frequently associated with regulatory regions of muscle genes sity of Braunschweig, Spielmannstrasse 7, 38106 many. Tel.: 0531-391-5735; Fax: 0531-391-8178. and hasbeen shownto control cell type-specific gene activation The abbreviations used are: bHLH, basic helix-loop-helix; CHX, cycloheximide; CAT, chloramphenicol acetyltransferase; EMSA, electro- (Gossett et al.,1989). This cis-element bindsthe muscle-specific phoretic gel mobility shift assay; PCR, polymerase chain reaction; enhancer binding factor MEF-2 which belongs t o the family of RSRF, response serum-related factor; ER, estradiol receptor. serum response factor related (RSRF) MADS-box proteins en-

17289

17290

Regulation of Myogenin Gene Expression

coded by four related vertebrate genes (Pollock and Treisman, 1991, Yu et al. 1992; Breitbart et al., 1993; Martin et al., 1993; McDermott et al., 1993). The mouse myogenin promoter contains an E-box and a MEF-2 binding site which together mediate its correct spatio-temporal expression in transgenicmice (Yee and Rigby, 1993; Cheng et al., 1992, 1993). In established muscle cell lines MEF-2 binding activity appears up-regulated during differentiation and can be induced by myogenin or MyoD in 10TU2 cells (Gossett et al., 1989; Cserjesi and Olson, 1991; Lassar et al., 1991). Positive autoregulation of the mouse myogenin promoter in culturecells is believed to be controlled by an indirect pathwayinvolving the MEF-2 binding site (Edmondson et al.,1992). Thus, an autoregulatory circuit was postulated in which bHLH proteins and MEF-2 can mutually activate each other's expression, thereby providing a mechanism for stable maintenance of the muscle phenotype. The importance of MEF-2 induction as a cell type-specific determinant for myogenin expression, however, has been controversial.Some of the MEF-2 genes are constitutively transcribed andDNA-binding activity was found to be present innonmuscle cells as well as in myoblasts (Pollock and Treisman, 1991; Horlick et al., 1990; Chambers et al., 1992; Breitbart et al., 1993). On the other hand, expression of the recently cloned MEF2C gene appears to be restricted to skeletal muscle and brain (McDermott et al., 1993; Martin et al., 1993; Leifer et al., 1993). Tissuespecific processing of MEF-2 isoforms has also been described (Yu et al., 1992; Breitbart et al., 1993). Taken together, these various observations suggest that both, transcriptional and post-transcriptional mechanisms, may regulate theMEF-2 factors. However, the precise nature of MEF-2 complexes responsible for muscle-specific transcription is presently unclear. In an attempt t o study the role of MEF-2 in the transcriptional activation of the myogenin gene, we analyzed the human myogenin (Myf-4) promoter. Here, we demonstrate thata short proximal promoter sequence encompassing a MEF-2 site and an E-box suffices t o mediate muscle-specific expression and transactivation by MyoD. Interestingly, the MEF-2 binding site but not the E-box is most important for the up-regulation of myogenin transcripts by MyoD.We find MEF-2 binding activity in fibroblasts and myoblasts prior to myogenin expression and no evidence for a requirement of de novo synthesis. These results suggest that myogenin transcription duringmyoblast differentiation is not dependenton induction of MEF-2 but rather involves a post-translational mechanism for activation. MATERIALS AND METHODS

from Amershamandthe following oligonucleotide primers: Myf-4mMEF1,GGCACCCAGCTGTGCGTGAGG; Myf-4-mMEF2, TTGGCTAGAGGGATCTCTGGTTC. The Myf-5-ER construct was obtained by in-frame fusionof the Myf-5 cDNA sequence (Braun et al., 1989b) with the hormone-binding domain of the human estrogen receptor (amino acids 282-595, Kumar et al. (1986)). To this end, the Myf-5stop codon was mutated to a BamHI restriction site and both fragments were ligated via the appropriate BamHI linker. The chimeric Myf-5-ER construct wassubcloned into the expression plasmid pEMSV-a scribe using EcoRI linkers. This Myf5-ER plasmid exhibits estradiol-dependent (3 p~ estradiol) transactivation of the 4R-tk CAT reporter plasmid (data not shown). Electrophoretic Gel Mobility Shift Assays(EMSAI-Nuclear extracts from tissue culture cells were prepared as described previously (Braun et al.,1989a). Cells suspended in 0.4 ml of 10 mM HEPES, pH 7.9,lO mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 1 pg/ml leupeptin, 1 pg/ml pepstatin, 1 pg/ml Trasylol, and 40 pg/ml bestatin were lysed by the addition of 0.7% Nonidet P-40. Isolated nuclei were resuspended in 40 p1 of ice-cold 20 m HEPES,pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride,1pg/ml aprotinin, 40 pg/ml bestatin followed by dialysis against 50 mM HEPES, 50 m NaCl, 1m dithiothreitol, and0.2 mM EDTA. RSRF C4 andR2 proteins were synthesized in rabbit reticulocyte lysate using the corresponding cDNA plasmids (Pollock and Treisman, 1991).$'P end-labeled, doublestranded oligonucleotides (0.2 pg; core sequences: Myf-4-MEF2, l T G GCTATAT'MATCTCTGG, Myf-4-mMEF2, TTGGCTAGAGGGATCTCTGG; MCK-MEF2, CTCGCTCTAAMATAACCCT octamer, G G GATCCATATGCAAATCAATT) wereincubatedwith 5 pl of cRNA primed reticulocyte lysate or nuclear extracts corresponding to approximately 20 pg of protein and1pg of poly(d1-dC).Following incubation for 30 min a t 4 "C, complexes were separated on 5% polyacrylamide gels according to standard methods.Specific competition of complex formation was performed with a n excess of unlabeled oligonuceleotides. Supershifted immuno-complexes were obtained with 1 p1 of specific antiRSRF C4 antiserum(a kind gift of Dr. Treisman, London). RNA Analysis-Total cellular RNA wasextracted by theguanidinium thiocyanate method (Auffray andRougeon, 1980), glyoxylated, separated on 1% agarose gels, and transferred to a Nylon membrane (PALL Biodyne A) for Northern blot analysis. Hybridizations were performed in buffer containing 50% formamide, 5 x Denhardt's solution (Ficoll, polyvinylpyrrolidone,and bovine serum albumin5 mg/ml each), 0.1% SDS, 50 mM sodium phosphate,5 x SSPE, and50 pglml denatured salmon sperm DNA at 42 "C. 1-2 x lo6 d p d m l of 32P-labeledprobe generated by random priming to specific a activity of 1x 10' d p d p g was used for hybridization. The myogenin and glyceraldehyde-3-phosphate dehydrogenase hybridization probes were isolated from rat myogenin and mouse glyceraldehyde-3-phosphate dehydrogenase cDNks, respectively (Arnold and Salminen,1993). Reverse Zkanscriptase Polymerase Chain Reaction (PCR)-2 pg of total RNA was transcribed using0.5 pg of oligo p(dT),, primer and 15 units of avian myeloblastosisvirus reverse transcriptasefor 1h at 42 "C in a total of 25 pl of buffer containing 50 m Tris-HC1, pH 8.3, 50 mM KC1, 10 m MgCI,, 0.5 m spermidine, 10 mM dithiothreitol, 1 mM dNTPs, and 25 units of RNase inhibitor. The reaction mixture was diluted 4-fold and 5 pl were usedfor PCR performed in 100 plof buffer containing 100 pmol of each primer, 0.2 mM dNTPs, 2.5 units of Taq DNA polymerase, 10 mM Tris-HC1, pH 9.0, 50 mM KCI, 1.5 mM MgCl,, 0.1% Triton X-100, and 0.2 mg/ml bovine serum albumin. The myogenin-specific primerswere 5'"ACCAGGAGGAGCGCGATCTCCG-3' (nucleotides 536-565 in exon 1) and 5'-AGG-CGGCTGTGGGAGlTGCATTCACT-3' (nucleotides 621-596 in exon 2; Montarras etal. (1991)). The predicted sizeof the amplified fragment is 85 base pairs. After 35 cycles, 20 pl of the reaction were separated on a 4% NuSieve GTCagarose gel. The gel was blotted onto a nylon membrane and probed with myogenin-specific cDNA.

Cell Culture a n d Zkansfections-Mouse C2 myoblasts and 10T1/2 fibroblastswereculturedin Dulbecco's modified Eagle's medium supplemented with10% fetal calf serum. Differentiation was induced in Dulbecco's modified Eagle's medium supplemented with 10% horse serum and 5 pg/ml insulin. Primary breast muscle cells and skin fibroblasts were prepared from 12-day chicken embryos as described previously (Rosenthal et al., 1990). To inhibit protein synthesis, 10 pg/ml cycloheximide (CHX) or emetine (2 p ~ was ) added to the culture medium. To activate Myf-5-ER hybrid protein, 3 p estradiol was used. as described preTransfections were performed with calcium phosphate viously (Braun et al., 1989a). In transient assays,cells were shifted to differentiation medium 24 h after transfection and cultured for a n additional 48 h. Chloramphenicol acetyltransferase (CAT) and p-galactosidase activities were determinedin cell extracts according to standard RESULTS procedures(Gorman,1985).Transactivationassays in 10T1/2 fibroA MEF-2 Consensus Sequence in the Proximal Myf-4 Problasts were performed using10 pg of pEMSV-MyoD transactivator, 10 Region Is Requiredto Direct Muscle Cell-specific pg of various Myf4-CAT reporter, and 5 pg of Rous sarcoma virus-p- moter galactosidase plasmids. Activation-We have shown previously that 211 nucleotides of Plasmid Constructs-Myf-4-1142 plasmid is equivalent to the previ- the human Myf-4 (myogenin) promoter direct expression in ously described Myf-41-CAT reporter construct (Salminen et al., 1991). skeletal muscle cells but not in fibroblasts (Salminen et al., The 5' deletion constructs were obtained through digestion with appro1991). Similar results havebeen obtained for the mouse myopriate restriction enzymesor by limited digestion with exonuclease111 genin gene (Edmondson et al., 1992). To delineate the required (Henikoff, 1984). Site-directed point mutations were generated in the plasmid Myf-4-211 using the oligonucleotide-mediated mutagenesis kit sequence elements inmore detail, fragments carrying 5'-trun-


17291

promoter, suggesting that themechanism of activation did not depend on direct DNA-binding ofMyoD. In contrast, MyoDq I CAT 1 Myf4-Zll r dependenttransactivation of themutantreporter plasmid -108 40 Myf-4 mMEF2 which fails to bind MEF-2 (data notshown) was la*,,n,,M t / / A I CAT I I Myf4-168 .1u 40 drastically reduced, albeit low residual activation was still obI- I r//A I CAT I Myf4-1S4 I served. The double mutant Myf-4 mMEF112retained only very 40 -111 I CAT 1 ~yf4-m low basal activity. Taken together,these results and the expres40 -88 sion data in muscle cells (see Fig. 2), strongly argue for the / CAT I I Myf4-96 importance of the MEF-2 binding site for muscle-specific myo40 JII GlirJ - I CAT I Myf4-mMEp1 genin transcription.Weak, but consistently observed activity in -111 40 r r//A I nayicmMEFZ CAT J the promoter mutant Myf-4 mMEF2 may indicate that the a -811 conserved E-box or other, yet unidentified elements also conCAT I MYf4"l/S r -1 tribute to Myf-4 promoter function to some extent. FIG.1. Schematic representation of Myf-4promoter containThe Enhancer-binding Complex MEF-2 Is Present in Muscle ing CAT reporter constructs.Wild-type MEF-2- and MEF-1-binding and Nonmuscle Cells and Binds to the Myf-4 Promoter-The A sites are indicatedby dotted and stippled boxes, respectively. Black solid boxes indicate mutations as detailed under "Materials and Methods." + T-rich element at -65 to -55 of the Myf-4 promoter is similar Fragment sizes are indicated by numbers relative to the transcription but not identical t o the MEF-2 binding site, originally identistart site as determined previously (Salminen et al., 1992). fied in the MCK enhancer (Gossett et al., 1989). To date, four MEF-2 genes, designated MEF2A to MEFSD, have been idencationsbetweennucleotides -211 and -96 upstream of the tified by virtue of a shared MADS-box motif which mediates (+50)to transcriptional start site were linked with their 3' ends DNA binding (Breitbart et al., 1993; Yu et al., 1992; Pollock and the bacterial CAT reporter gene(Fig. 1). In addition, point Treisman, 1991; Martin et al., 1993; McDermott et al., 1993). In mutations were introduced into two consensus sequences reorder t o determine whether the putative MEF-2 element in the sembling the binding sitesfor MyoD (MEF-1) and MEF-2 comMyf-4 promoter actually interactswith one of the correspondplexes which are located between nucleotides -12 and -7 and ing proteins,we performed electrophoretic mobility shift assays -65 and -55, respectively. Both elements are highly conserved in the mouse, rat, and human myogenin promoters. The CAT using theA + T-rich oligonucleotide sequence of the Myf-4 proconstructs were transiently transfected into primary cells from moter and nuclear extracts from 10T112 fibroblasts, C2 myofetal chicken breast muscle and skin, grown in horse serum blasts, and myotubes, or in vitro synthesized RSRF C4 and R2, containing medium. As shown in Fig. 2, all constructs carrying the equivalentsof hMEF2A and hMEFXB, respectively (Breitprogressively deleted Myf-4 promoter fragments wereactive in bart et al.,1993). The analogous MEF-2 binding oligomer of the breast muscle cells at levels comparable to the 1.1-kilobase MCK enhancerwas also used for comparison. Individual Myf-4 promoter fragment which served as a positive control. In nuclear extracts were standardized by DNA binding to the contrast, no or marginal activity was obtained with all con- Oct-1sequence, known to detect a constitutivelyexpressed structs in skin fibroblasts (data not shown). These results in- nuclear factor (Fig.40).Fig. 4A shows that RSRF C4 produced dicate that 96 nucleotides of the proximal Myf-4 promoter are in reticulocyte lysate efficiently bound to the putative Myf-4RSRF R2 failed sufficient t o mediate myogenin expression in skeletal muscle MEF2 binding site, whereas the related protein to bind. Full-length RSRF R2 also did not form complexes with cells and strictly confer cell type-specificity. The role of the putative MEF-1 andMEF-2 protein-binding DNA when addedtogether withRSRF C4, suggesting thatboth sites for the activity of the Myf-4 promoter was examined proteins probably do not readily interact witheach other. This previously published data within the-211 to +50 promoter fragment with either element observation is in agreement with mutated individually or both mutated together. While the mu- showing that only a C-terminal truncation of RSRF R2 was tant Myf-4 mMEFl carrying an altered E-box retained most of able tobind DNA and presumably form protein dimers (Pollock wild-type promoter activity, the mutantMyf-4 mMEF2 contain- and Treisman, 1991). The specificity of RSRF-binding to Myfing a disrupted MEF-2 binding site lost 80-90% activity (Fig. 4-MEF2 wasdemonstrated by competition withunlabeled 2). When both sites were inactivated together, promoter activ- MEF-2 oligomer and lack of competition with large excess of known to ity was almost completely abolished. These results suggest thatmutant oligonucleotide containing base substitutions the MEF-2 binding siteis crucial for myogenin gene expression, abolish MEF-2 binding (Gossett et al., 1989). These results while the E-box contributes topromoter activityin this assay toclearly indicate that theA + T-rich element in the Myf-4 proa considerably lesser extent. moter can form specific complexes with MEF-2 proteins and The endogenous myogenin gene can be activated in non- therefore constitutes a genuine MEF-2 binding site. muscle cells by overexpression ofMyoD or the other family When EMSAs were performed with the Myf-4-MEF2 oligomembers of myogenic bHLH transcription factors. We wanted nucleotide and extracts from 10T112 fibroblasts or C2myoto know whether the truncated and mutated promoter frag- blasts which do not express themyogenin gene, or with extracts ments would still be responsive to transactivation by MyoD in from myogenin expressing C2 myotubes, slowly migrating 10T112 fibroblasts. Cotransfection of the various Myf-4-CAT MEF-2 protein complexes were observed in all cells (Fig. 4B). reporter constructs withpEMSV control vector alone revealed These band shifts, although less intense in 10T112 cells, were that all Myf-4 promoter fragments were essentially silent in indistinguishable fromthose generated on the MCK-MEF2 10T112 fibroblasts, but aquired considerable activity (10-15- binding site using the samecellular extracts. Moreover, these fold stimulation) in thepresence of pEMSV-MyoD transactiva- complexes migrated with similar or identical mobilities as the tor plasmid(Fig. 3). Similar data werealsoobtainedwhen largest of the authenticRSRF C4 complexes (data notshown). not The fidelity and specificity of these DNA-protein interactions myogenin or Myf-5 were used as transactivators (data shown). These results indicate that the elements responsible was confirmed by competition with unlabeled homologous Myffor positive auto- andcross-regulation of the Myf-4 gene reside 4-MEF2 and analogous MCK-MEF2 binding oligonucleotides within 96 nucleotides of the proximal promoter region. Inter- and thelack of competition with excess of mutated versions of estingly, the mutantpromoter mMEFl carrying an inactivated these sequences. Interestingly, an additional complex CX was E-box was transactivated byMyoD similar to the wild-type found on the Myf-4-MEF2 oligonucleotide which was not seen -1124

Myf4-1124

I

k

I

MEFY

r - . ' :

MEPI*

I

r//Al

CAT

40

4411

j

,I

,(,'y":

"'"i"

--

I

17292

Regulation of Myogenin Gene Expression mMEFl -1122 -211

pG conversion

FIG.2. Activity of Myf-4 promoter fragments in transiently transfected chicken primary breast muscle cells. The CAT reporter plasmids listed inFig. 1 andthecytoplasmicp-actinpromoterCAT control vector (10 pgeach)were transfected in primary cultures. Relative CAT activity was determined 48 h later. Cotransfected Rous sarcoma virus-p-galactosidase plasmid was used as internal control.

mMEF2 -121 -134 -168 50

68

34

I

+

,

6

I* colutruct

I

CAT

0

4

0

.

mMEFl

I 53

- 168

3

5

16

3

38

95

0.3

6

-121

+

+ 3

2

6

3

2

7

2

3

~~

mMEF2

38

-

- 134

+

9

48

e..

- 211 +

90

Bact. mMEF1/2

* * a

L -1122

11

-96

9

2

control

-96

mMEF1/2

36

2

3

FIG.3. Transactivation ofMyf4 promoter fragments by MyoD in 10T112 fibroblasts. Experimental conditions were a s described in legend to Fig. 2 and under “Materials and Methods.” pEMSV-a scribe was usedas control.

3

*

with the MCK enhancer-derived oligomer. This complex was competed by the MYF4-MEF2 (data not shown) but notby the MCK-MEF2 oligonucleotide (Fig. 4B).Whether theCX complex plays a role for myogenin promoter function is currently being investigated. Evidence that MEF-2 proteins in extracts from 10T1/2 cells, C2 myoblasts, and C2 myotubes were all immunologically related toMEF-2 protein came from EMSAs in the presence of anti-RSRF C4 antibody raised against the C-terminal portion of this protein (a kindgift from R. Treisman). This antiserum recognizes MEFBA, MEFBD, and presumably MEFSC, but not MEF2B.2 As shown in Fig. 4C, most of the MEF-2 complexes obtained with cellular extracts were supershifted by the antiserum similar to authentic RSRF C4 protein.

* R. Treisman, personal communication.

Taken together, these observations indicate that in our hands all studied cell lines contain appreciable levels of MEF-2 binding activity comprised of RSRF C4 or closely related proteins, regardless whether they activate the myogenin promoter or not. Activation of Myogenin Dunscription in Muscle and Nonmuscle Cells Is Initiated in the Absence of Protein SynthesisThe observation that the MEF-2 binding site is critical for activation of the myogenin promoter but cognate proteins appear tobe present in tissue culture cells regardless whether the myogenin gene is transcribed or not raises the question about the actual mechanism of activation. It hasbeen proposed that muscle-specific MEF-2 isoforms are induced at the onset of terminal differentiation prior to myogenin expression (Gossett et al., 1989; Cserjesi and Olson, 1991; Lassar et al., 1991; Ed-

Regulation of Myogenin Gene Expression A MVFI .MEII2 ~CIWLItDI

2 :

. o E :

retie.

-

,y*

RSRF RZ

RSRP C4

pmtrin

,,I,

M Y N -MBF7

-

. -

B

.

2

E

g g

-

-

$ $ z z gsgg..

1 4

L

M(.K."IYI

cx-

I: 1

1

17293

mondson investigate the whether et al., to 1992). order In activating factors are indeed newly synthesized or may be already present, we examined the accumulation of myogenin mRNA in response to induction of differentiation in several myogenic cell lines in the presence ofCHX or emetine to prevent protein synthesis. The minimal deviation rhabdomyosarcoma cell BA-Han-1C can be triggered to rapid differentiation by the addition of pertussis toxin or suramin (Arnold et al., 1992). As illustrated in Fig. 5A, both inducers lead to rapidaccumulation of myogenin mRNA within 30 min following the addition of the drugs. Significantly, the induction of myogenin transcripts was not diminished in the presence of CHX a t concentrations that completely inhibited cellular protein synthesis. When CHX treatment wasextended for more than 3 h, a slight decrease in myogenin mRNA levels was observed which may reflect the relatively short half-life required of the cell components, possibly one of thetranscription factors.Usingreverse transcriptase-PCR, we also assayed theaccumulation of myogenin mRNA in C2 myoblasts which were induced to differentiate by serum withdrawal in the presence of emetine. MyoD transcripts were determined as internal, constitutively expressed control. As shown in Fig. 5B, no or few myogenin transcripts were detectedin cells growing in 20% fetal calf serum, whereas myogenin mRNA was clearly induced in cells cultured inhorse serum containing mediumfor 24 h.The level of myogenin transcripts in these differentiatingC2 cells was comparable in the absence and presence of emetine, indicating thatprotein synthesis was not required. The activation of myogenin transcription wasalso examined in 10T1/2 fibroblasts which have been induced for myogenic differentiation by hormone-dependent activation of the regulated Myf-5-ER hybrid protein.This protein was constructed by fusing the complete Myf-5 coding sequence at its C terminus with the hormone-binding domain (ER) of the estrogen receptor. Upon constitutive expressionof Myf-5-ER under thecontrol of the Molony's sarcoma virus long terminal repeat(MSV-LTR) promoter, Myf-5 activity was strictly dependent on the addition of estradiol to the culture m e d i ~ mAs . ~ shown in Fig. 6, myogenin mRNA accumulated to considerable concentrations over a period of 72 h in hormone-treated 10T1/2 fibroblasts which were transiently transfected with Myf-5-ER expression plasmid. In contrast, essentially no myogenin mRNA was made in the absence of hormone or in cells transfected with pEMSV control vector. This indicates that the induction of myogenin transcripts was dependent on Myf-5 activity. Most significantly, addition of CHX or emetine at fully inhibitory concentrations did not prevent the accumulation of myogenin mRNA but reK. Ragge and H. Arnold, unpublished results.

unbound

FIG.4. Gel mobility shift assays of MEF-2 complexes with nuclear extracts from C2C12 muscle cells and 10T112 fibroblasts, and in vitro synthesized RSRFs. A, cell-free translation productsof

RSRF C4 and R2 were incubated with labeled oligonucleotide representing theA + T-rich sequence element inthe Myf-4 promoter ("Materials and Methods"). Complex formation was competed either with unlabeledbinding oligonucleotide ( w t ) or withanon-binding mutant oligonucleotide (rnut.).r.1. stands for unprimed reticulocyte lysate.Note that C4 but not R2 binds to the Myf-4-MEF2 site. B, nuclear extracts from 10TV2 fibroblasts, C2 myoblasts (undiff.),and C2 myotubes(dif.) form similar MEF-2 complexes on A + T-rich oligonucleotides of the MCK enhancer (MCK-MEFB) and the Myf-4 promoter (Myf-4-MEF2). The specificity of complex formation is demonstrated by competition. MEF-2 binding is represented by the slowest migrating complex. CX indicates an unknown protein complex on the Myf-4 promoter outside the MEF-2 binding site. The faster migrating signals have not been investigated. C, the MEF-2 complexes are immunologically related to RSRF C4 a s indicated by supershifts (MEF2 ss) in the presence of anti-RSRF C4antibody. Note that most of the triplecomplex remains at the origin and some residual MEF2complex was not shifted.D,standardization of nuclear extract preparations by constitutively expressed Oct-1 protein.


17294

A

pTx I I

1

HRS

0

+

+

+

-

0.5

+

+

-

+ 1

+

+

-

+ 3

+

+

G I

-1%

+

I N

6

cells

OT1/2

1

C

Iv

Myf5-ER

construct hormone

+ + + + + -

CHX

"

Emetine

- - -

time (h)

3

6

1

2

+

"

"

"

pEMSV

+ + -

+

-

"

-

- -

+

"

6

. ,&e 1 2 24 24 24 72 72 72 72 -F3 " .C

3

4

5

6

7

8 9 10111213

-

.+G

&*

\?,

I

B

cells

FIG.6. Accumulation of myogenin mRNA in 10T1/2cells induced by hormone-activated Myf-5-ER h y b r i d protein in the absence of protein synthesis. Total RNA was isolated from 10T1/2 fibroblasts transiently transfected with Myf-5-ER transactivator plasmid or pEMSV control plasmid a t various times after the additionof 3 mM estradiol. CHX or emetine were added together with hormone where indicated. Myogenin transcriptswereanalyzed by reverse transcriptase-PCR (see "Materials and Methods") and hybridization with the myogenin cDNA probe. The specificity of the PCR reaction was controlled with RNA from differentiated C2C12 cells and with cloned myogenin cDNA. Note the elevated expression of myogenin mRNA in the presence of protein synthesis inhibitors.

c2c12

20% FCS 10% HS Emetine time (h)

al., 1993; Nabeshima et al., 1993; for review, Olson (1993)). To begin to study some of the underlying mechanisms, we investigated the sequence requirements of the human Myf-4 gene promoter for its muscle-specific expression and tried to define thestatus of transcription factors participatinginthis regulation. A MEF-2 Binding Site in the Proximal Myf-4 Promoter Is Necessary for Danscriptional Activity and Mediates Dansactiuation by MyoD-Similar to the mouse myogenin gene, we found that less than 100 nucleotides of the proximal Myf-4 1 2 3 4 5 6 7 promoter are sufficient to direct high level expression in skelFIG.5.Induction of m y o g e n i n m R N A i nthe rat rhabdomyosarby myogenic c o m a cell BA-Han IC and C2 myoblasts in the presence of CHX etal muscle cells andmediatetransactivation or emetine. A, Northern blots of cells induced for differentiation by bHLH transcription factors in fibroblasts. Not surprisingly, pertussis toxin ( P T X ) or suramin are shown. RNA loading was con- this region is highly conserved in the mouse, rat, and human trolled by hybridization with glyceraldehyde-3-phosphate dehydrogen- genes, all containing E-box and MEF-2 consensus sequences ase (GAPDH)cDNA. Probes are indicated under "Materials and Methods." Therelativelyhighbasal level of myogenin mRNA in this (Edmondson et al., 1992; Salminen et al., 1991)." Within the particular experiment was due to a small proportionof spontaneously context of the 211-base pair human myogenin promoter, the differentiating cells and was not seenrecloned in subpopulations of this E-box contributes tomaximal activityin muscle cells but can be cell line. B , reverse transcriptase-PCR of myogenin and MyoD tran- inactivated with only a minor reduction in muscle-specific acscripts in C2 myoblasts growing incalf fetal serum or horse serum( H S ) for 24 h in the absence and presence of emetine. The blotted PCR tivity and transactivationby MyoD (and myogenin, not shown). As mutant Myf-4 mMEFl shows absolutely no MyoD-binding products were hybridized with myogenin and MyoD cDNA. but neverthelesscan be transactivated by MyoD (and the other sulted in even elevated levels as compared to untreated con- myogenic bHLH transcription factors), the mechanism of actitrols. This effect may be due to stabilization of mRNA by in- vation must be independent of direct MyoD-DNA interactions. hibitors of protein synthesis as hasbeen demonstrated before This result differs from data obtained in transgenic mice in in several instances. These results provide further evidence which an intactE-box is absolutely required for correct spatiothat induction of myogenin transcription can occur in the ab- temporal myogenin expression, although thepromoter without sence of de nouo protein synthesis in different myogenic cell the E-box shows activity in some cells (Yee and Rigby, 1993; systems using unrelatedmethods of induction and two distinct Cheng et al., 1992, 1993). While this discrepancy clearly indiinhibitors of protein synthesis. Therefore, it appears reasona- cates thatnot all requirements for correct developmental reguble to assume that myogenin activation in culturedcells may be lation of the myogenin gene are precisely reflected in cultured or parallel pathways of actigenerally independent of newly synthesized transcription fac- cells, it suggests that alternative tors. Together with the demonstratedcritical role of the MEF-2 vation may be operative under certain conditions. In fact, a site for myogenin expression, our results argue for a post-trans- myogenin promoter-LacZ transgene lacking the proximal E-box lational mechanism of activation, most likely involving the is properly expressed in somites but shows delayed, nevertheless cell type-specific activation in limb budsand visceral MEF-2 complex. arches (Cheng et al., 1993). This observation shows that myogenin gene activation during development proceeds differently DISCUSSION

+Myogenin

The activation of the myogenin gene represents a nodal point in thedifferentiation process of skeletal muscle cells (Hasty et

W. Wright, personal communication.


17295

in different cell lineages and culturedmuscle cells can provide both transcriptional and post-transcriptional mechanisms. A Post-translationalMechanism Possibly Mediated Through a model system for some aspects of this gene regulation. A MEF-2 consensus sequence,the second cis-element of criti- the MEF-2 Binding Site Activates Myogenin Danscription at cal importance for muscle-specific myogenin expression in vivo the Onset of Differentiation-Strong support thatMEF-2 is not and in vitro, has recently been described for the mouse myo- necessarily induced for the onset of differentiation, but can be genin promoter (Edmondson et al., 1992; Yee and Rigby, 1993; activated by other means, comes from experiments performed Cheng et al., 1993). Our mutational analysisof the Myf-4 pro- in thepresence of cycloheximide and emetine,two inhibitors of moter confirms the essentialrole of the A + T-rich sequence for protein synthesis. Under conditions which completely prevent the humanpromoter. The Myf-4 mMEF2 reporter plasmid lack- de novo proteinsynthesis, considerable levels of myogenin ing thefunctional MEF-2site exhibitsapproximately 20% wild- mRNA accumulate in myogenic cell lines upon induction of type activity in muscle cells. Paradoxically, transactivation by differentiation and also in fibroblasts when Myf-5 is activated MyoD predominantly dependson the intactMEF-2 binding site in thesecells. Using a hormone-activated Myf-5-ER hybrid proinactive form priorto the addition and presumably the proteins binding to it. In agreement with tein that accumulates in an numerous reports showing that MEF-2 binding complexes are of hormone and inhibitorsof protein synthesis has made these up-regulated during myoblast differentiation and are induced experiments possible. A similar approach with a conditional in fibroblasts upon forced expression of MyoD (Gossett et al., MyoD transcription factor also demonstrated recently that the 1989; Csejesi andOlson, 1991; Lassar et al. 19911, Edmondson myogenin gene constitutes a primary MyoD target (Hollenberg et al. (1992) proposed recently a n indirect pathwayfor positive et al., 1993). If one accepts the central importance of MEF-2 binding and the less critical influence of the E-box for the autoregulation of the myogenin promoter. In theirmodel, MyoD activation of the endogenous myogenin gene in cultured cells, (or myogenin) induces expression of MEF-2. Since MEF-2 also our observations strongly argue for a post-translational activaactivates the myogenin gene, the mutual relationshipof these tion mechanismmediatedthroughthe MEF-2 cis-element. factors appears not hierarchical but rather seems to represent Nevertheless, we cannot absolutely exclude the possibility that a regulatory circuit which amplifies the expression of the conMyoD or Myf-5 when overexpressed t o high levels activates the trol factors and stably maintains themuscle-phenotype. endogenous myogenin promoter through the E-box. However, MEF-2 BindingActivity Does Not Strictly Correlate with we find this rather unlikely since physiological levels of MyoD Myogenin Expression in Cultured Cell Lines-As mentioned in C2 and rhabdomyosarcoma cells activate the endogenous above, MEF-2 binding complexes have beendescribed as a myogenin gene and the E-box mutant Myf-4 mMEFl equally muscle-specific activity (Gossett et al., 1989; Cserjesi and 01- well, whereas theMEF-2 mutant is basically inactive (data not son, 1991; Lassar et al., 1991; Edmondson et al., 1992). More shown). Under these assumptions,we are faced with the pararecent work with cloned hMEFSA, hMEFBB, and hMEF2C has doxical situation thatmyogenic E-box-binding proteins lead to demonstrated a strict correlationbetween the presence of myogenin transcription without apparent binding to the proMEF-2 proteinandthe cell type-restricted distribution of moter. Instead, theMEF-2 binding site appears be to necessary. MEF-2 activity in skeletal, cardiac, and smooth muscle cells An indirect pathway which in MyoD or Myf-5 induces MEF-2 or and certain neural cells (Yu et al., 1992; Leifer et al., 1993; any othernew protein seemsincompatible with our results and McDermott et al., 1993). In contrast, other laboratories rethose of Hollenberg et al. (1993). How then stimulate bHLH ported a ubiquitous MEF-2 binding activity(Horlick et al., transcription factor myogenin expression? A possible explana1990; Pollock and Treisman, 1991; Chambers et al., 1992). Our tion could be that myogenic bHLH proteins, independent of DNA-binding assayswithnuclearextractsprepared from E-box binding, interact with MEF-2 proteins t o form the acti10T1/2 fibroblasts, undifferentiated C2 myoblasts, and exten- vating complex or remove an inhibitory factor. So far, there is sively differentiated C2 myotubes revealed that all of these no experimental evidence for direct protein interactions. In any cells contained proteins thatspecifically bind to theMEF-2 site case, post-translational modifications of bHLHfactors or withinthe Myf-4 promoter. Interestingly, Breitbart etal., MEF-2 proteins or both are likely to be involved in the initial (1993) detected abundant MEF2D protein not only in differen- activation of the myogenin gene. tiated myotubes but also in undifferentiated myoblasts where Acknowledgments-We thank Dr. R. Treisman(London) for the MEF2A and MEF2C were entirely absent. It is therefore reaC4 antibody and C4 and R2 cDNA plasmids, and R. Eilers (Heisonable to assume that most or all of the complexes that we RSRF delberg) for the ER plasmid. We acknowledge the expert technical asobserved in C2 myoblasts were comprised of MEF2D. That sistance by H. Eberhardt and secretarial help by C. Klaue. these complexes were supershifted with anti-RSRF C4 (hMEF2A) antiserum is consistent with the high degree of seREFERENCES quence conservation between hMEF2A and hMEF2D. In fact, Arnold, H. H., and Braun, T. (1993) inAdvances in Developmental Biology (Wascross-reaction of the used antibody with hMEF2D has been sarman, P., ed) Vol. 2, pp. 111-158, JAI Press, Greenwich, CT demonstrated.2 Our result that 10T1/2 fibroblastsalso con- Arnold, H. H., and Salminen, A. (1993) Cell. Mol. Biol. Res. 39, 303-314 Arnold, H. H., Gerharz, C.D., Gabbert, H. E., and Salminen, A. (1992)J . Cell Biol. tained MEF-2 binding activity, albeit at a lower level than 118,877-887 skeletal myoblasts, cannot bereconciled with thecontradictory Auffray, C., and Rougeon, F. (1980) Eur. J. Biochem. 107,303314 Bober, E., Lyons, G. E., Braun, T., Cossu, G., Buckingham, M., and Arnold, H. H. data by others. Slightdeviations in theprotocols used to extract (1991) J. Cell Biol. 113, 1255-1265 nuclear proteins and perform EMSAs may account for these Braun, T.,and Arnold, H. H. (1994) Deu. Biol., in press different observations. Despitethe discrepancies, however, it is Braun, T., Tannich, E., Buschhausen-Denker,G., and Arnold, H. H. (1989a)Mol. Cell. Biol. 9, 2513-2525 quite clear that10T1/2 cells which have been stably converted Braun, T., Bober, E., Buschhausen-Denker, G., Kotz, S., Grzeschik, K. H., and H.H. (1989b) EMBO J. 8, 36174625 Arnold, to muscle cells express much higherlevels of MEF-2 activity. It Braun, T., Rudnicki, M.A.,Arnold, H. H., and Jaenisch, R.(1992)Cell 71,369-382 is also apparent from earlier studies that the stable differenti- Breitbart, R. E., Liang, C., Smoot, L. B., Laheru, D. A,, Mahdavi, V., and Nadalated phenotype of established myogenic cell lines isassociated Ginard, B. (1993) Development (Camb. 118, 1095-1106 withand possibly maintained by de novo accumulation of Buckingham, M. (1992) Dends Genet. 8, l l P 1 1 8 Chambers, A. E., Kotecha, S., Towers, N., and Mohun, T. J. (1992) EMBO J. 11, MEF-2 activity which is preventedby cycloheximide (Gossett et 49814991 al., 1989). This later phase of MEF-2 expression in stably dif- Cheng, T.C., Hanley, T. A., Mudd, J., Merlie, J. P., and Olson, E. N. (1992)J. Cell B i d . 119, 1649-1656 ferentiated muscle cells has notbeen addressed here. Thus, the Cheng, T. C., Wallace, M. C., Merlie, J. P., and Olson, E. N. (1993) Science 261, regulation of the MEF-2 factors appears complex involving 215-218

17296


Csejesi, P., and Olson, E. N. (1991) Mol. Cell. Biol. 11,4854-4862 Montarras, D., Chelly, J . , Bober, E., Arnold, H. H., Ott,M. 0.. Gros, F., and Pinset, Edmondson, D.G., Cheng, T. C., Csejesi, P., Chakraborty, T., and Olson, E. N.C. (1991) New Biol. 3, 592400 (1992) Cell. Mol. Biol. 12, 36653677 Nabeshima, Y., Hanaoka, K., Hyasaka, M., Esumi, E., Li, S., Nonaka, M., and Emerson, C. P. (1990) Cum Opin. Cell Biol. 2, 1065-1075 Nabeshima, Y. (1993) Nature 364,532435 Gorman, C. (1985) in DNA Cloning I1 (Glover, D. M., ed) pp. 143-190, IRL Press, olson, E, N. (1990) ~e~~ & D ~4, ~1454-1461 , Oxford Olson, E. N. (1993) Circ. Res. 72, 1-6 L. A., Kelvin, D. J . , Sternberg, E. A., and Olson, E. N. (1989) Mol. Cell. Ott, M,-o,, ~ o b e rE,, , L ~G,, Arnold, ~ ~H, H,, ~ and,Buckingham, M, (1991)~ ~ Biol. 9, 5022-5033 opment (Cumb.) 111, 1097-1107 Hasty, P., Bradley, A., Moms, J. H., Edmondson, D. G., Venuti, J. M., Olson, E. N., peterson, C. A., h r d o n , H., ~ d lz., w., paterson, B. M., and ~ lH. ( 1 ~ 9 9 ~~cell ) , and Klein, W. H.(1993) Nature 364, 501-506 62,493-502 Henikoff, S. (1984) Gene (Amst.) 2 8 , 3 5 1 4 5 9 Hinterberger, T.J., Sassoon, D. A,, Rhodes, S. J., and Konieczny, S. F. (1991) Deu. Pollock' R'' and Treisman' R. (1991) Genes " 2327-2341 Rosenthal, N., Berglund, E. B., Wentworth, B. M., Donoghue, M., Winter, B., Bober, Biol. 147, 144-156

'

Hollenberg, S. M., Cheng, P. F., andWeintraub, H. (1993) Proc. Nutl. Acud. Sci. U. S. A. 9 0 , 8 0 2 H 0 3 2 Horlick, A,, Hobson, G. M., Patterson, J. H., Mitchell, M.T., and Benfield, P. A. (1990) Mol. Cell. Biol. 10, 4 8 2 H 8 3 6 K ~v., G ~ ~s., ~ Staub, ~ ~ ~A,, ,and ~ Chambon, , p. (1986) EMBO J . 5, 2231-2236 Lassar, A. B., Davis, R. L., Wright, W. E., Kadesch, T., Murre, C., Voronova, A,, Baltimore, D., and Weintraub, H.(1991) Cell 66, 305315 Leifer, D., Krainc, D., Yu,Y-T., McDermott, J. Breitbart, R., Heng, J., Neve, R., Kosofsky, B., Nadal-Ginard, B., and Lipton, S. (1993) Proc. Nutl. Acud. Sci. U. S. A. 90,154&1550 Martin, J. F., Schwarz, J. J., and Olson,E. N. (1993)Proc. Nutl.Acud. Sci. U.S. A. 90,52824286 McDermott, J. C., Cardoso, M.C.,Yu,Y.-T., Anders, V., Leifer, D., Krainc, D., Lipton, S. A,, and Nadal-Ginard, B. (1993) Mol. Cell. Biol. 13,2564-2577

E', Braun, T'*and H' H' (1990) Acids Res' 18* 6239-6245 Rudnicki, M. A,, Braun, T., Hinuma, S., and Jaenisch, R. (1992) Cell 71, 383-390 Rudnicki, M. Schnegelsberg, p. N., Stead, R. N., Braun, T., H. H., and Jaenisch, R. (1993) Cell 76, 1351-1359 Salminen, A., Braun, T., Buchberger, A., Jurs, S., Winter, B., and b o l d , H. H. (lggl)J . Bioi. 1159 905-917 Sassoon, D., Lyons, G., Wright, W. E., Lin, V., Lassar, A., Weintraub, H., and Buckingham, M. (1989)Nature 3419 303-307 Weintraub, H., Davis, R., Tapscott, S. J., Thayer, M., C a u s e , M., Benezra, R., Blackwell, T. K., Turner, D., Rupp, R., Hollenberg, S., Zhuang, Y., and Lassar,A. (1991) Science 261, 761-766 Yee, S. P., and Rigby, P. W. (1993) Genes & Deu. 7, 1277-1289 Yu, Y.-T., Breitbart, R. E., Smoot, L. B., Lee, Y., Mahdavi, V.,and Nadal-Ginard, B. (1992) Genes & Deu. 6, 1783-1798

~

~