Journal of Oleo Science Copyright ©2013 by Japan Oil Chemists’ Society J. Oleo Sci. 62, (9) 717-727 (2013)
The Protective Effects of Cerebrosides from Sea Cucumber and Starfish on the Oxidative Damage in PC12 Cells Feng-Juan Wu1, a, Yong Xue1, a, Qing-Juan Tang1, Jie Xu1, Lei Du1, 2, Chang-Hu Xue1, Koretaro Takahashi2 and Yu-Ming Wang1, ＊ 1
College of Food Science and Engineering, Ocean University of China (No.5 Yushan Road, Qingdao, Shandong Province, 266003, P.R.China) Division of Marine Life Science, Faculty of Fisheries Sciences, Hokkaido University (Hakodate, 041-8611, Japan) a Feng-Juan Wu and Yong Xue contributed equally to this work. 2
Abstract: Neurodegenerative disorders are a class of diseases that have been linked to apoptosis induced by elevated levels of reactive oxygen species (ROS). The present study was undertaken to explore the effect of sea cucumber cerebrosides (SCC) and starfish cerebrosides (SFC) on the hydrogen peroxide (H2O2) and tert-butyl hydroperoxide (t-BHP)-induced oxidative damage in PC12 cells. Cell viability, the leakage of lactate dehydrogenase (LDH), reactive oxygen species (ROS) level and superoxide dismutase (SOD) activity were determined for their effect on oxidative damage. Quantitative real-time PCR was investigated to analyze the mitochondrial genes expression. These results showed that both SCC and SFC decreased the leakage of LDH and intracellular ROS in a dose-dependent manner. SCC and SFC could also increase the SOD activity compared with the model groups. In H2O2 damage model, 400 μg/mL SCC increased the SOD activity by 79%, which was stronger than SFC. The results demonstrated that SCC and SFC exhibited the protective effects, which may be related to their antioxidant action. In addition, SCC and SFC dramatically increased the gene expression of B-cell lymphoma 2 (Bcl-2) but significantly decreased the gene expression of Cytochrome c, caspase9 and caspase3 compared with H2O2 or t-BHP treatment. These results suggested that SCC and SFC might exert a protective function against oxidative damage by inhibiting mitochondriamediated apoptosis pathway. In conclusion, SCC and SFC played an important protective role in H2O2 and t-BHP-induced damage of PC12 cells, suggesting that the SCC and SFC may be a potential therapeutic agent against nervous system oxidative damage. Key words: cerebrosides, oxidative damage, antioxidant, mitochondria pathway 1 INTRODUCTION Age-associated neurodegenerative disorders are becoming more prevalent over the next few decades, and it is a common disease characterized by a progressive loss of cognitive function1）. Oxidative stress is implicated to play an important role in the etiology of neurodegenerative disorders2）. Hydrogen peroxide（H2O2）and tert-butyl hydroperoxide（t-BHP）are thought to be the major precursor of free radicals, they have been reported to induce apoptosis in the cells of the central nervous system3, 4）, and widely be used as damage factors for cell oxidative stress damage models. The rat pheochromocytomaline PC12 cell line, which is dopaminergic and neoplastic cell line, exhibits unique sensitivity to changes in oxygen availability and fre-
quently used as a cell model for neurological and neurochemical studies5, 6）. Sea cucumber and starfish both belong to the marine echinoderms. Sea cucumber is well known as traditional and precious seafood in Asian countries, especially consumed in Chinese Mainland, Hong Kong, Taiwan, Japan, and Korea, and its output value is considerable in China. It is often eaten more for their tonic value than for their seafood taste7, 8）. There are about more than 2000 kinds of starfish in the world. In China, starfish is mainly distributed in the Yellow sea and the Bohai Sea. Eating starfish is a custom of the Chinese, especially in coastal areas. In recent years, some reports have showed that sea cucumber and starfish contains numerous bioactive substances, including
＊
Correspondence to: Yu-Ming Wang, College of Food Science and Engineering, Ocean University of China, No.5 Yushan Road, Qingdao, Shandong Province, 266003, P.R. China E-mail:
[email protected] Accepted March 25, 2013 (received for review January 25, 2013)
Journal of Oleo Science ISSN 1345-8957 print / ISSN 1347-3352 online
http://www.jstage.jst.go.jp/browse/jos/ http://mc.manusriptcentral.com/jjocs 717
F.-J. Wu, Y. Xue, Q.-J. Tang et al.
collagen, acidic polysaccharides, triterpenoid saponins, and cerebrosides, etc 9, 10）. In physiological activity aspect, sea cucumber and starfish have anti-cancer, antivirus, antiflammatory activity, etc11, 12）. Cerebroside is a type of endogenous glycolipid, and widely exists in cell membranes of fungi, plants, animalcules and marine organisms13）. It is one of the simplest lipid classes of glycosphingolipids and consists of monosaccharides, an amide-linked fatty acid and sphingoid base which is also called long-chain base 14）. Cerebroside has been shown to display variety of biological activities such as antitumor, immune regulation and antihepatotoxic, etc15−17）. Studies also showed that the cerebroside can promote the growth of neurons, regeneration, repair, and the recovery of neural function18）. Compared with other sources, the contents of cerebrosides in marine organisms are lower, but due to the marine special ecological environment, cerebrosides in marine organisms have novel structures and stronger bioactivity 14）. The glycosphingolipids of marine invertebrates, including sea cucumber and starfish, have unique sphingoid bases with a conjugated diene19）. Recent （SCC） research have found that sea cucumber cerebrosides can attenuate the rat fatty liver induced by orotic acid20）, and starfish cerebrosides（SFC）has significant antitumor effects in vitro and vivo21）. In this study, we investigated whether the SCC and SFC have protective effects on the damage induced by H2O2 and t-BHP in PC12 cells, and discuss the mechanism thoroughly. We assayed the expression of Cytochrome c, B-cell lymphoma 2（Bcl-2）, Caspase9 and Caspase3 mRNA which are strongly associated with the mitochondrial pathway. Our results provide preliminary data supports on the development of marine organism as functional foods for neuroprotection.
2 EXPERIMENTAL PROCEDURES 2.1 Materials Sea cucumber （Acaudina molpadioides）was purchased from the Zhou-Shan Fishery Company（Zhejiang Province, China）in September, 2008. Starfish（Asterias amurensis） material was collected in southern Hokkaido in April, 2007. PC12 cell lines was purchased from Shanghai Institute of Cell Biology, Chinese Academy of Science; 3-（4,5-dimethylthiazol-2-yl）-2,5-diphenyl（MTT）was purchased from Sigma（ St. Louis, MO, USA）; Moloney murine leukemia virus reverse transcriptase（ MMLV）was obtained from Promega （Madison, WI） . TRIzol reagent was obtained from Invitrogen （Carlsbad, CA, USA） . Maxima SYBR Green qPCR Master mix was purchased from Fermentas（Glen Burnie, Maryland）, DMEM Medium was purchased from GIBCO （Grand Island, NY）. Fetal bovine serum（FBS）was purchased from Tianhang Biological Technology Co., Ltd.
（Zhejiang, China）. Leakage of lactate dehydrogenase （LDH） , Reactive oxygen species（ROS）and Superoxide dismutase（SOD）kit were purchased from Nanjing Jiancheng Bioengineering Institute（ Nanjing, China）. The other regents are analytic reagents（AR） . 2.2 The preparation and analysis of SCC and SFC SCC and SFC were prepared and analyzed using the procedure described by Xu et al 14） and Cong et al 22）. The preparation of SCC and SFC solution was followed by the liposome preparation done by Z. Hossain et al23）with minor modifications, and diluted to the appropriate concentration by medium for following experiments. 2.3 Cell Culture PC12 cells were cultured in DMEM medium supplemented with 10％ fetal serum, 100 U/mL penicillin, and 100 μg/ mL streptomycin in a water-saturated atmosphere of 5％ CO2 at 37℃. The medium was changed every other day. Before treatment, cells were plated at an appropriate density on culture plates according to each experimental scale and cultured for 24 h. To produce oxidative stress, H2O2 and t-BHP were freshly prepared from stock solution prior to each experiment, SCC and SFC were preincubated for 24h before H2O2 or t-BHP was added. 2.4 Measurement of Cell Viability PC12 cells were plated at a density of 1.0×105 cells/100 μL in 96-well plates, and the cell viability was determined by MTT assay. At the end of incubation time, the medium was aspirated, cell was washed and MTT（0.5 g/L）, dissolved in DMEM, was added to each well. After additional 4 h incubation at 37℃ in CO2 incubator, removed the medium, and 200 μL acidated dimethylcarbinol was added to each well. The absorbance at 570 nm of solubilized MTT formazan products was measured using a microplate reader（BioRad, USA） . Cell viability was expressed as a percentage of the value in the control. 2.5 Determination of LDH activity The LDH assay was used to measure cell membrane damage as a function of the amount of cytoplasmic LDH released into the medium. The LDH activity can be used as an indicator of relative cell viability as a function of membrane integrity. LDH activity was measured using a LDH s protocol. diagnostic kit according to the manufacturer’ LDH release was calculated as the percentage of LDH in the medium versus total LDH activity. 2.6 ROS activity The 2’ , 7’-Dichlorodihydrofluorescin diacetate（DCFHDA）method was used to measure intracellular ROS production24）. DCFH-DA was a fluorescent dye that crosses the cell membrane and was enzymatically hydrolyzed by
718
J. Oleo Sci. 62, (9) 717-727 (2013)
The neuroprotection activities of cerebrosides from sea cucumber and starfish
intracellular esterases to nonfluorescent DCFH. The cells were plated at a density of 5×105 cells per 6-well plates, after cultured with or without treatments, the cells were incubated with DCFH-DA at a final concentration of 10 μM for 20 min at 37℃, then cells were washed three times with PBS, and harvested for fluorescence activated cell sorting（FACS）analysis. ROS levels were measured using the FACS can with excitation and emission wavelengths of 488 nm and 525 nm, respectively. The value for each treatment group was converted to the percentage of the control value. 2.7 SOD enzyme activity The cells were plated at a density of 5×105 cells per 6-well plates. After cultured with or without treatments, the cells were washed with PBS, scraped from the plates into ice-cold PBS and homogenized. The SOD activity was measured using a SOD activity assay kit at a wavelength of 450 nm according to the manufacturer’s protocol. Values for each treatment group are expressed as a percentage of the control value. 2.8 RNA preparation and quantitative real-time PCR For analysis of gene expression, total cellular RNA was extracted from PC12 cells using Trizol reagent according s recommended procedures. The to the manufacturer’ quantity and integrity of extracted RNA was assessed by
spectrophotometry at A260/A280 and the denaturing agarose gel electrophoresis. 1 μg of total RNA from each sample was converted to first strand cDNA using MMLV reverse transcriptase and random primers. Quantitative real-time PCR assay was carried out as described previously21）. The prime sequences are listed in Table 1. The expression signal of the house keeping gene β-actin served as an internal control for normalization. The gene expression level was analyzed by relative quantification using the standard curve method. 2.9 Statistical analysis The data are reported as the mean±S.D. Statistical comparisons were performed using one-way analysis of variance（ANOVA）, followed by a Tukey’ s post hoc test. P value less than 0.05 was considered statistically significant.
3 RESULTS 3.1 Chemical structure analysis of SCC and SFC The chemical structure of SCC and SFC were analyzed by GC-MS. As shown in Fig. 1, the glycosyl group of SCC and SFC was glucose. The long-chain base of SCC only contained d17:1, SFC was complicated than SCC mainly containing d18:3 and d18:2. The amide-linked fatty acid units also differed greatly, SCC was composed by C18:0h,
Table. 1 Sequences of the primers used in the quantitative RT-PCR. Gene
Forward Primers
Reverse Primers
Cytochrome c
ATCTCCACGGTCTGTTCGG
GCCCTTTCTCCCTTCTTCTTA
Bcl-2
TGGGATACTGGAGATGAAGACT
CCACCGAACTCAAAGAAGG
Caspase9
GCCTCATCATCAACAACGTG
CCTGGTATGGGACAGCATCT
Caspase3
GACGACAGGGTGCTACGAT
ACAGACCAGTGCTCACAAGG
β-actin
GCAGATGTGGATCAGCAAGC
GTCAAAGAAAGGGTGTAAAACG
Fig. 1 The chemical structure of SCC and SFC. 719
J. Oleo Sci. 62, (9) 717-727 (2013)
F.-J. Wu, Y. Xue, Q.-J. Tang et al.
C22:1h, C23:1h and C24:1h, however, the composition of SFC was mainly C24:1h. 3.2 Effects of SCC and SFC liposome on the cell viability in PC12 cells As shown in Fig. 2, SCC and SFC liposome had no toxiferous or inhibitory phenomenon on the growth of PC12 cells with increasing dose. The findings demonstrated that SCC and SFC were no harm to PC12 cells at the tested concentration range.
3.3 Effects of H2O2 and t-BHP induced cytotoxicity on PC12 cells H2O2 and t-BHP are very common chemical oxidants, neurons are very vulnerable to H2O2 and t-BHP for their relatively low levels of antioxidant enzymes. In order to study the protective effects of SCC and SFC in pathological conditions, we investigated two kinds of oxidative stresses respectively. Cell viability under oxidative stress was measured by MTT assay. Our results showed that the viability of cells exposed to 500 μM H2O2 or 300 μM t-BHP for 4 h reduced cell viability to about 50％ of control group（Fig. 3）. So we chose 500 μM H2O2 or 300 μM t-BHP to treat PC12 cells for 4 h, respectively, for following experiments.
Fig. 2 Effects of SCC and SFC on the cell viability in PC12 cells. PC12 cells were treated with various concentrations of SCC and SFC liposome for 24, 48 and 72 h. SCC and SFC did not inhibited PC12 cells growth. Data represent the mean ± S.D. of three independent experiments.
Fig. 3 Effects of H2O2 and t-BHP induced cytotoxicity on PC12 cells. PC12 cells were treated with various concentrations of H2O2 (400, 500, 550, 600, 650, 700 μmol/L) or t-BHP (50, 100, 200, 300, 400, 500 μmol/L) for 4 h, then measured with MTT method and chose 500 μM H2O2 and 300 μM t-BHP for followed experiments. 720
J. Oleo Sci. 62, (9) 717-727 (2013)
The neuroprotection activities of cerebrosides from sea cucumber and starfish
3.4 Effect of SCC and SFC on PC12 cells survival treated with H2O2 and t-BHP To determine whether SCC and SFC could prevent cytotoxicity induced by H2O2 and t-BHP in PC12 cells, we investigated the protective effects of SCC and SFC on cell survival. The cellular morphological change was observed
by inverted microscope（Olympus, Japan）. While the H 2O2 and t-BHP treated cells exhibited heterogeneity in shape, cells changed to round and cells number reduced, SCC and SFC-pretreated cells showed resistance to damaging effects of H2O2 and t-BHP, restored uniform neuronal shape and the number closed to the normal group （Fig. 4A）. MTT
Fig. 4 Effect of SCC and SFC on PC12 cells survival treated with H2O2 and t-BHP. A PC12 cells were pretreated with SCC (400 μg/mL) and SFC (400 μg/mL) for 24 h,then the cells were exposed to 500 μM H2O2 or 300 μM tBHP for 4 h, cellular morphology was observed under inverted microscope. B PC12 cells were pretreated with 100 and 400 μg/mL SCC for 24h, then the cells were exposed to 500 μM H2O2 for 4 h. Normal: without H2O2, and SCC or SFC; C PC12 cells were pretreated with 100 and 400 μg/mL SFC for 24 h,then exposed to 300 μM t-BHP for 4 h Normal: without t-BHP, and SCC or SFC. Data represent the mean ± S.D. of three independent experiments. #p
