The putative ABC transporter YheH/YheI is ... - Wiley Online Library

The putative ABC transporter YheH/YheI is involved in the signalling pathway that activates KinA during sporulation initiation Sanae Fukushima1, Mika Yoshimura1, Taku Chibazakura1, Tsutomu Sato2 & Hirofumi Yoshikawa1 1

Department of Bioscience, Tokyo University of Agriculture, Sakuragaoka, Setagaya-ku, Tokyo, Japan and 2International Environmental and Agricultural Science, Tokyo University of Agriculture and Technology, Fuchu, Tokyo, Japan

Correspondence: Hirofumi Yoshikawa, Department of Bioscience, Tokyo University of Agriculture, Sakuragaoka, Setagaya-ku, Tokyo 156-8502. Tel.: 181 3 5477 2758; fax: 181 3 5477 2668; e-mail: [email protected] Present address: Mika Yoshimura, Graduate School of Biological Science, Nara Institute of Science and Technology, Takayama, Ikoma, Nara 630-0101, Japan Received 12 September 2005; revised 29 November 2005; accepted 6 December 2005. First published online 23 January 2006.

Abstract The primary kinases that control the supply of phosphate to the phosphorelay are KinA and KinB, although it is not yet known what type of signal(s) activates these kinases. Our systematic study of protein-protein interactions using yeast twohybrid analysis revealed an interaction between KinA and YheH. YheH with the preceding gene product YheI is categorized as an ABC transporter. Overexpression of yheH/yheI in the kinB mutant resulted in a reduced sporulation efficiency. Moreover, reporter assays using Spo0AP dependent promoters revealed that the deficiency in sporulation is probably due to a failure in the activation of Spo0A. Our results further suggest that the N-terminal region of YheH may play an important role in sensing the signal to be delivered to the C-terminally bound KinA.

doi:10.1111/j.1574-6968.2006.00104.x Editor: Ezio Ricca Keywords Bacillus subtilis; sporulation initiation; ABC transporter; phosphorelay.

Introduction The initiation of sporulation in Bacillus subtilis is controlled primarily by the level of phosphorylation of the transcription factor Spo0A (Trach & Hoch, 1993). Spo0A belongs to a family of response regulator proteins of prokaryotic twocomponent signal transduction system (Perego & Hoch, 2002). Whereas many proteins normally acquire phosphate directly from a histidine protein kinase, Spo0A, rather, is phosphorylated via a multicomponent phospho-transfer pathway known as phosphorelay, including Spo0F and Spo0B. Multiple histidine protein kinases, KinA, KinB, KinC, KinD (YkvD), KinE (YkrQ), have been identified to phosphorylate Spo0F (Jiang et al., 2000), suggesting that phosphate input in the phosphorelay pathway depends on the various kinases whose activity is regulated by a variety of specific signals, the nature of which remains unknown (Perego et al., 1989; Antoniewski et al., 1990; Burbulys et al., 1991; Trach & Hoch, 1993; Kobayashi et al., 1995; LeDeaux & Grossman, 1995; Jiang et al., 1999; Jiang et al., 2000; Perego & Hoch, 2002). The kinases supply the 2006 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

c

phosphoryl groups into the relay by phosphorylating Spo0F. Spo0FP, in turn, transfers the phosphoryl groups to Spo0B, which in the final step of the relay, phosphorylates Spo0A to yield Spo0AP (Burbulys et al., 1991). Among the five kinases, KinA and KinB are the two major kinases since a kinA/kinB double mutant exhibits five to six order reduction in sporulation frequency (LeDeaux et al., 1995). These major kinases have been thought to differ not only in their respective contribution to the sporulation process but also in their structural properties and cellular localization (Dartois et al., 1996). While KinA appears to be a cytoplasmic protein (Perego et al., 1989; Antoniewski et al., 1990), KinB is likely membrane-bound due to presence of six trans-membrane domains. The idea that B. subtilis has evolved with two-functionally distinct sensor kinases capable of activation through different input signals argues against the redundancy of the pathways leading to phosphorylation of Spo0F due to the difficulty in uncovering any positive or negative effectors of either kinases. KinA is active as a dimer and is composed of an aminoterminal signal-sensing domain and a carboxyl-terminal FEMS Microbiol Lett 256 (2006) 90–97

91

ABC transporter involved in sporulation initiation

kinase domain. The signal-sensing domain contains three PAS domains, PAS-A, PAS-B, and PAS-C, which are found in many proteins from prokaryotic and eukaryotic cells, where they monitor changes in overall energy level of the cell, redox potential, oxygen and light, as well as mediate protein-protein interactions (Taylor & Zhulin, 1999). It has been shown that PAS-B/PAS-C domains of KinA are involved in homodimerization (Wang et al., 2001) while PASA domain is essential for the activity of the sensor kinase. Thus the PAS-A domain signal ligand(s) are likely to be involved in the regulation of the initiation of sporulation in B. subtilis by means of the activation of phosphorelay sensor kinase A. In this communication, we present evidences suggesting that the member of ABC transporter YheH/YheI is involved in the activation pathway of KinA. Our results raise the possibility that KinA is being kept inactive by being trapped at the inner surface of the cytoplasmic membrane.

Materials and methods Bacterial strains, plasmids, and genetic technique The bacterial strains used in this study are listed in Table 1. Bacillus subtilis strains were maintained on Schaeffer’s sporulation medium (Schaeffer et al., 1965) and transformed with chromosome or plasmid DNA according to

the method of Anagnostopoulos and Spizizen (Anagnostopoulos & Crawford, 1961). Selection, when required, was done on kanamycin or chloramphenicol at 5 mg mL1, and on spectinomycin at 100 mg mL1. The efficiency of sporulation was measured by growing B. subtilis cells in 2 SG medium (Asai et al., 1993) at 37 1C for 24 h. The number of spores (CFU) per milliliter of culture was determined as the number of heat-resistant (80 1C, 10 min) colonies on LB plate. When necessary the genes were overexpressed by cloning in multicopy plasmid pDG148 (Stragier et al., 1988) and induced with 1 mM IPTG. The primers used in these cloning also contain artificially added ribosome binding sites and are shown in Table 2.

Construction of the Bacillus subtilis strains carrying the various deletion mutations Gene disruptant strains were constructed via homologous recombination of PCR-generated fragment. The primary PCR-generated fragments contain around 600–700 bp of the upstream (using primers named -11 and -12, Table 2) and downstream (primers -23 and -24) sequence of the target gene, both of which overlap either end of the PCRgenerated fragment containing the antibiotic gene marker (primers -For and -Rev). Templates used for the antibiotic marker is Tn554 of Staphylococcus aureus for spectinomycin (spc) resistant. For the generation of the desired PCR construct, recombinant PCR method (Higuchi, 1989) was applied, wherein the secondary-stage PCR products were

Table 1. Genotype of bacterial strains and plasmids used in this study Strain or plasmids Bacillus subtilis strains 168 168 (kinA::erm) KK104 NBS136 NBS088 NBS089 NBS090 NBS093 NBS094 RL2456 NBS149 NBS153 NBS157 NBS096 NBS179 NBS180 Plasmids pGBTK pGADT7 pDG148 pDL2

FEMS Microbiol Lett 256 (2006) 90–97

Genotype

Source

trpC2 trpC2 kinA::erm trpC2 pheA1 kinB::cat trpC2 kinB::cat trpC2 kinA::erm kinB::cat trpC2 yheH::spc trpC2 yheI-yheH::spc trpC2 kinB::cat yheH::spc trpC2 kinB::cat yheI-yheH::spc amyE::PspoIIG-lacZ spc trpC2 amyE::PspoIIG-lacZ spc trpC2 kinB::cat amyE::PspoIIG-lacZ spc trpC2 kinA::erm kinB::cat amyE::PspoIIG-lacZ spc trpC2 kinB::spc trpC2 amyE::PkinA-lacZ cat trpC2 kinB::spc amyE::PkinA-lacZ cat

Laboratory stock F. Kawamura Kobayashi et al. (1995) This study, KK104 ! 168 This study, 168 (kinA::erm) ! NBS136 This study This study This study, NBS136 ! NBS089 This study, NBS136 ! NBS090 M. Fujita This study, RL2456 ! 168 This study, RL2456 ! NBS136 This study, 168 (kinA::erm) ! NBS153 This study This study This study, NBS179 ! NBS096

kan TRP1 bla LEU2 bla kan bla cat

Yoshimura et al. (2004) TaKaRa Stragier et al. (1988) Fukuchi et al. (2000)

2006 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

c

92

S. Fukushima et al.

Table 2. Oligonucleotide primers used for cloning in this study Primer Gene disruption yheI-11 yheI-12 yheI-spcFor yheH-11 yheH-12 yheH-spcFor yheH-spcRev yheH-23 yheH-24 kinB-11 kinB-12 kinB-spcFor kinB-spcRev kinB-23 kinB-24 Overexpression yheH 1aa 5Sal yheH 673aa 3Sph yheI 1aa 5Sal yheI 585aa 3Sph yheHDN 300aa 5Sal yheHDC 480aa 3Sph kinA-lacZ fusion AterEco5 ABam3 Specificity test of yeast two-hybrid analysis kinA5 0 Eco kinA3 0 Bam yheH5 0 Eco yheH3 0 Bam yheI5 0 Eco yheI3 0 Bam kinB5 0 Eco kinB3 0 Bam kinC5 0 Eco kinC3 0 Bam kinD5 0 Eco kinD3 0 Bam kinE5 0 Bam kinE3 0 Xho

Sequence (5 0 –3 0 ) ATAGATCATTGGCTCAGGTG CATATAATTTTTGAACCTATCCCCATCTCCTCATC ATGGGGATAGGTTCAAAAATTATATGG TTACGGTGCGAAAAGGGCAG CATATAATTTTTGAACGCCCCTGCTCCCCCTTC GAGCAGGGGCGTTCAAAAATTATATGG TTGAGCGTTAGGCCTAATTGAGAGAAG CAATTAGGCCTAACGCTCAAAAACCCAA TATAATGAAAGGCGAGGAGG CCGTTCGCTTCGCTCTCTGA CATATAATTTTTGAACTTATCGTGTGAAATCCTTTCG TTTCACACGATAAGTTCAAAAATTATATGG CGATTTGCTATTACTAGGCCTAATTGAGAGAAG CAATTAGGCCTAGTAATAGCAAATCGATTGGAAC GGAGACCGGACATTGACGGG GCGTCGACTAAAAGGAGGTTGTAAACATGAAAATAGGAAAAACGTTATGGAG GCGCATGCTTATGCAATGGAATGTTTCTG GCGTCGACTAAAAGGAGGTTGTAAACATGTTTTCAGTTTTGAAAAAGCTTGGCTG GCGCATGCTGCCCCTGCTCCCCCTTC GCGTCGACTAAAAGGAGGTTGTAAACATGACCATTATTCAGGCTTTCCG GCGCATGCATAAAAACGAAACAGAAGATTCAAAATCG GCGAATTCTATCCACGCCTACGCAGAG GGGCGGATCCCCTAGTATGATTCGCTAG GCGAATTCGTGGAACAGGATACGCAGC GCGGATCCCGATTTCAGCATCAATTCTTCTG GCGAATTCATGAAAATAGGAAAAACGTTATGG GCGGATCCTGCAATGGAATGTTTCTGTC GCGAATTCATGTTTTCAGTTTTGAAAAAGCTTGG GCGGATCCTGCCCCTGCTCCCCCTTCTT GCGAATTCATGGAAATTCTAAAAGACTATCTTCTGC GCGGATCCCTAGTGAGGAAGATCAGCGG GCGAATTCATGAGAAAATATCAAGCTCGTATC GCGGATCCCCTCTCAGCTGTCTGATTTTAAAGG GCGAATTCATGTTGGAGCGATGCAAATTG GCGGATCCTGATGCGGATACGGGGAGGG GCGGATCCTGGAAACTCTTGGTGTCCAG GCCTCGAGCATTCATCATTCCTTCTTTCTTCAG

Additional sequences that do not correspond to the sequences of relevant genes are indicated by italics and restriction sites are underlined. SD

sequences for the overexpression constructs are indicated by boldface type.

generated using the three-piece primary PCR fragments. PCR primers used in this study are listed in Table 2. Pyrobest DNA polymerase or ExTaq DNA polymerase (TaKaRa, Shiga) were used for PCR.

Construction of the strain carrying a kinA-- lacZ fusion in the amyE locus The B. subtilis strain carrying the lacZ gene fused to the promoter of kinA gene was constructed as follows. A 150 bp of the promoter region of kinA gene was PCR amplified with 2006 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

c

a primer pair described in Table 2. The PCR product was digested with EcoRI and BamHI and cloned in into plasmid pDL2 (Fukuchi et al., 2000). Plasmid DNA was used to transform B. subtilis strain 168 to chloramphenicol resistance to obtain a strain carrying the kinA–lacZ fusion at the amyE locus.

b-Galactosidase assay Bacillus subtilis cells harboring lacZ fusions were grown at 37 1C in 2 SG medium and portions of the culture were FEMS Microbiol Lett 256 (2006) 90–97

93


withdrawn for the assay of b-galactosidase activity as previously described (Sonenshein, 1989).

LWHA plate containing 5 mM 3-aminotriazol and incubated for 7 days.

Yeast two-hybrid analysis

Results

Yeast two-hybrid analysis for the library screening was carried out according to the method previously described (James et al., 1996; Noirot-Gros et al., 2002). Bacillus subtilis genomic library for the screening was constructed by using plasmid pGADT7 (TaKaRa) (Yoshimura et al., unpublished). The plasmids were transformed into yeast PJ694Aa for the pGBTK (Yoshimura et al., 2004) derivatives and PJ69-4Aa, for the pGADT7 derivatives, haploid strains using TRP1 and LEU2 as selective markers respectively. These yeast strains were mated to obtain diploids. Positive protein-protein interaction between the bait and the prey was detected by the ability of the cells to grow onto plates of SCLWH (synthetic complete (SC) plates lacking Leu, Trp and His) supplemented with 5 mM 3-aminotriazol and of SCLWA (SC plates lacking Leu, Trp and Ade). The pGADT7 derivatives were extracted from diploid yeast and insert junctions with the GAL4 activation domain were sequenced and compared with the B. subtilis genome database. Specificity test of the yeast two-hybrid analysis was carried out as described elsewhere (Yoshimura et al., 2004). PCR-amplified fragments from B. subtilis genomic DNA were cloned into pGBTK or pGADT7. Oligonucleotide primers used in this specificity test are listed in Table 2. Diploid cells for testing were grown and spotted onto SC-

(a)

During our comprehensive study of the protein–protein interactions using yeast two-hybrid screening against Bacillus subtilis genomic library, a bait containing kinA gene successfully fished many independent clones. After sequencing more than 100 clones, we could identify reliable data and categorized them into fragments derived from five genes. Among them, the largest number (36) of clones contained fragments corresponding to the C-terminal region of YheH. The specificity test including representative prey clones of yheH as well as other kinase genes was shown in Fig. 1. The YheH protein, in combination with the adjacent gene product YheI, is categorized as an ABC transporter (http://bacillus.genome.jp/). The fragments of YheH contained in the prey plasmid library that coupled with KinA as bait protein correspond to parts of the Cterminal region which is presumably a cytosolic domain of the putative membrane protein. The interaction of YheH seems to be specific with KinA among the five kinases (Fig. 1). Alternatively, we carried out two-hybrid screening by converting yheH clone into bait construct. That is, one of the prey clone of yheH obtained by the screening was extracted and the insert was isolated and transferred to the bait

(b)

pGBTK

Yh

pG

AD T eH 7 Yh (1) eH Yh -(2 eH ) Yh -(3 e ) Ki H-(4 nC ) Ki nD Ki nE

(Preys)

Specific interaction between KinA and YheH

YheH: 673aa

KinA (1) (2) (3) (4)

(Baits)

YheH YheI KinB KinC KinD KinE

Fig. 1. Specific interaction between KinA and putative ABC transporter YheH. (a) Specificity test with the yeast two-hybrid analysis. Diploid strains were constructed by mating PJ69-4Aa containing pGBTK or its derived plasmid harboring various kinases or putative ABC transporters (bait) with PJ69-4Aa containing pGADT7 or its derivatives harboring fragments of YheH or kinases (prey). (b) The regions of the YheH fragments harbored in four independent YheH prey clones obtained with KinA as bait protein are schematically represented along with the full length YheH showing motifs predicted by SOSUI (http://sosui.proteome.bio.tuat.ac.jp/sosuiframe0.html) and PFAM (http://www.sanger.ac.uk/Software/Pfam/). The region of each fragment correspond to amino acid residues of wild type protein as follows: (1), from 435 to 537 aa; (2), from 547 to 657 aa; (3), from 570 to 599 aa; (4), from 516 to 632 aa. Gray boxes, Trans-membrane domain; Hatched box, ABC transporter.



c

94

S. Fukushima et al.

plasmid pGBTK, then screening against genomic library was done. Several proteins were fished by the YheH clone, and it should be noted that only KinA fragments were multiply obtained among kinases (data not shown). These results raised the idea that the membrane-bound YheH interacts with KinA via its cytosolic domain.

Overexpression of yheH/yheI ABC transporter genes results in reduced sporulation efficiency In order to establish the probable role of YheH on the phosphorylation of KinA, we then analyzed the effect of the deletion or overproduction of YheH on the sporulation frequency. First we analyzed the effects of deletion of either or both yheH and/or yheI on sporulation. Neither single nor double null mutation of these ABC transporter components had any effect on the sporulation efficiency of the cell and the same was true in the kinB mutant background (Table 3). However, when both yheH and yheI genes were propagated as a multicopy plasmid in kinB mutant, sporulation frequency was notably reduced (Table 3). Note that this effect was not observed when only one of the genes was propagated.

Sporulation deficiency of yheH/yheI overexpressing cells was probably due to lower Spo0A activation To test whether the deficiency of sporulation of the cells overexpressing yheH and yheI in the kinB mutant is due to the failure of activation of Spo0A, the lacZ gene was fused with the promoter of spoIIG, whose transcription is under the control of Spo0AP (Satola et al., 1991; Bird et al., 1993). b-Galactosidase activity of this promoter fusion was

assayed in the wild type, kinB mutant, kinA/kinB double mutant, and yheH/yheI overexpressing strain in the kinB mutant. Results showed that transcription of spoIIG is reduced when the plasmid encoded yheH/yheI genes were overexpressed, achieved through the addition of IPTG. In the absence of KinB, the expression of spoIIG–lacZ was considerably diminished and the synergistic effect of yheH/ yheI overexpression resulted in further reduced b-galactosidase activity, the level resembling that of kinA/kinB mutant at the early stage of sporulation (Fig. 2a). Similar results were observed with other Spo0AP dependent gene fusions, spoIIE–lacZ (data not shown). Note that the kinB disruption significantly reduced the spoIIG–lacZ expression, and same was true in the case of spoIIE–lacZ, indicating that both KinA and KinB contribute almost equally to the phosphorylation of Spo0A. Apparently, these results suggest that overexpression of yheH/yheI inhibited the activation of Spo0A probably due to the failure in KinA activation. Note that kinA gene itself was expressed substantially in the yheH/ yheI overexpressing strain (Fig. 2b).

Discussion The differentiation program to endospore formation in Bacillus subtilis is induced under conditions of nutritional stress (Schaeffer et al., 1965; Sonenshein, 1989) and high cell density (Grossman & Losick, 1988) and is regulated by the cellular level of phosphorylated Spo0A transcription factor, which results from the phosphorelay activated by kinases (LeDeaux & Grossman, 1995). Elucidating the control mechanism of the activation of these kinases is crucial to the understanding of the cellular mechanism responsible for sporulation initiation. The potential activators or inhibitors of kinases, including KinA and KinB, remain elusive.

Table 3. Sporulation frequencies of various strains CFU mL1 Strain 168 NBS088 NBS089 NBS090 NBS136 NBS093 NBS094 NBS136 NBS136 NBS136 NBS136 NBS136 NBS136

Relevant genotype or plasmid Wild type DkinA DkinB DyheH DyheH/yheI DkinB DkinB DyheH DkinB DyheH/yheI DkinB pDG148 DkinB pDG148-yheH DkinB pDG148-yheI DkinB pDG148-yheH/yheI DkinB pDG148-yheHDC/yheI DkinB pDG148-yheHDN

Viable cells 8

8.1 10 8.0 108 1.1 109 9.6 108 1.3 109 7.8 108 8.4 108 7.8 108 8.4 108 8.0 108 9.6 108 1.6 109 7.5 108

Spores

Frequency 8

7.5 10 2.0 103 6.6 108 6.9 108 7.6 108 5.7 108 5.4 108 4.7 108 2.3 108 2.0 108 2.4 107 1.9 107 2.9 108

0.92 2.5 104 0.60 0.71 0.58 0.73 0.64 0.60 0.27 0.25 0.025 0.012 0.38

Sporulation frequencies were measured at least three times and representative results were shown.


c


95


(b) 15

(a) 120

Previous report identified a membrane protein KbaA to be involved in activation of the KinB pathway though the information about the input signal is still unknown (Dartois et al., 1996). In the course of a B. subtilis functional genomics project, the result was obtained that a cytosolic protein YaaT plays a significant role in the transduction of signals to the phosphorelay, though it is considered to control the Spo0AP level through Spo0E activity which is a specific phosphatase of Spo0AP (Hosoya et al., 2002). It was reported that acetoin probably stimulates sporulation by increasing phosphorylation of Spo0A independent on the upstream kinases (Quisel et al., 2001). In the case of KinA, no regulatory protein or signal has been identified. Our discovery of the specific interaction between KinA and YheH may contribute to the understanding of the specific control of the KinA activity. Inhibitory effect of overexpression of both yheH and yheI genes on the sporulation efficiency and on the expression of spoIIG–lacZ demonstrate that Spo0A was less phosphorylated, presumably due to the insufficient KinA activation. Since the expression of kinA gene itself was not affected by the overexpression of yheH and yheI, the initiation process of phosphorelay by KinA might be repressed. The necessity of expressing both yheH and yheI genes to exhibit the inhibitory effect is probably due to the need for their simultaneous expression to actually overproduce the membrane proteins which function coordinately. This phenomenon has occasionally been found in the case of membrane proteins which constitute protein complexes in the membrane (Matsuyama et al., 1990; Tang et al., 1995). It is also important to note that the spoIIG, but not spoVG expression is reduced in the kinA mutant (Chung et al., 1994). An explanation to this is that spoIIG expression depends on Spo0AP and kinA

mutant phosphorylates Spo0A less efficiently, while SigH is responsible for the expression of spoVG which is not ultimately affected by kinA deletion. The result shown in Fig. 2a demonstrated that spoIIG expression was similarly affected by kinB mutation, which had no effect on spoVG expression (data not shown). Therefore, KinA and KinB seem to contribute almost equally to facilitate phosphorelay and interestingly, the synergistic effect of kinB null mutation and yheH/yheI over expression appears to mimic that of kinA/kinB double mutation. The results presented in this paper may suggest that YheH/YheI ABC transporter traps KinA at inner surface of the membrane. Even though it is a cytoplasmic soluble protein, KinA might be activated in response to as yet unknown signal ligands from outside the cell, though the possibility that the transporters may deliver the signals from inside the cell cannot be ruled out. However, the result of overexpression of yheHDC, which lacks the interacting domain of YheH with KinA, wherein sporulation is inhibited to similar level with that of full length of YheH (Table 3), suggests that trapping of KinA on the membrane is not a requirement for the inhibitory effect. The YheH/YheI ABC transporter may function to transduce signals for sporulation initiation to KinA through the C-terminus of YheH. Overproduction of the transporter therefore results in dilution of the signals which then are inefficiently delivered to KinA, and in concomitant failure of activation of Spo0A. The fact that the disruption of either or both yheH and yheI had no effect on sporulation frequency (Table 3) strongly suggests the existence of other factor functionally equivalent to the YheH/YheI ABC transporter. Further investigation of these components will shed light on this activation pathway of phosphorelay through KinA.

β-galactosidase activity (Miller units)

Hours after initiation of sporulation

Fig. 2. Expression profile of b-galactosidase from spoIIG–lacZ (a) and kinA–lacZ (b) fusions. The time of transition from exponential growth to stationary phase is designated as time zero (T0). Each strain carrying the lacZ fusions was grown in 2 SG medium and the b-galactosidase activities were assayed. Assays carried out more than three times yielded similar patterns and representative data were shown. Symbols: (a) open circles, NBS149 (wild type); open squares, NBS153 (DkinB); closed triangles, NBS153 harboring pDG148-yheH/yheI; closed squares, NBS153 harboring pDG148; closed circles, NBS159 (DkinA DkinB); (b) open circles, NBS179 (wild type); open squares, NBS180 (DkinB); closed triangles, NBS180 harboring pDG148-yheH/yheI.

80

10

40

5

0

0 0

1

2


3

4

0

1

2

3

4


c

96

Acknowledgements We are grateful to M. Fujita (Harvard University) for providing a strain carrying spoIIG–lacZ and for helpful discussion. We thank A. Hirose for technical assistance and also thank D. Y. Reyes (Oregon Health and Science University) for critical reading of the manuscript. This work was supported by a Grant-in-Aid for Scientific Research on Priority Area (C) (Genome Biology) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

References Anagnostopoulos C & Crawford IP (1961) Transformation studies on the linkage of markers in the tryptophan pathway in Bacillus subtilis. Proc Natl Acad Sci USA 47: 378–390. Antoniewski C, Savelli B & Stragier P (1990) The spoIIJ gene, which regulates early developmental steps in Bacillus subtilis, belongs to a class of environmentally responsive genes. J Bacteriol 172: 86–93. Asai K, Kawamura F, Hirata A, Yoshikawa H & Takahashi H (1993) SecA is required for three distinct stages of sporulation in Bacillus subtilis. J Gen Appl Microbiol 39: 583–596. Bird TH, Grimsley JK, Hoch JA & Spiegelman GB (1993) Phosphorylation of Spo0A activates its stimulation of in vitro transcription from the Bacillus subtilis spoIIG operon. Mol Microbiol 9: 741–749. Burbulys D, Trach KA & Hoch JA (1991) Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64: 545–552. Chung JD, Stephanopoulos G, Ireton K & Grossman AD (1994) Gene expression in single cells of Bacillus subtilis: evidence that a threshold mechanism controls the initiation of sporulation. J Bacteriol 176: 1977–1984. Dartois V, Djavakhishvili T & Hoch JA (1996) Identification of a membrane protein involved in activation of the KinB pathway to sporulation in Bacillus subtilis. J Bacteriol 178: 1178–1186. Fukuchi K, Kasahara Y, Asai K, Kobayashi K, Moriya S & Ogasawara N (2000) The essential two-component regulatory system encoded by yycF and yycG modulates expression of the ftsAZ operon in Bacillus subtilis. Microbiology 146: 1573–1583. Grossman AD & Losick R (1988) Extracellular control of spore formation in Bacillus subtilis. Proc Natl Acad Sci USA 85: 4369–4373. Higuchi R (1989) Using PCR to engineer DNA. PCR Technology (Erlich HA, ed.), pp. 61–70. Stockton Press, the United States and Canada. Hosoya S, Asai K, Ogasawara N, Takeuchi M & Sato T (2002) Mutation in yaaT leads to significant inhibition of phosphorelay during sporulation in Bacillus subtilis. J Bacteriol 184: 5545–5553. James P, Halladay J & Craig EA (1996) Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144: 1425–1436.


c

S. Fukushima et al.

Jiang M, Tzeng YL, Feher VA, Perego M & Hoch JA (1999) Alanine mutants of the Spo0F response regulator modifying specificity for sensor kinases in sporulation initiation. Mol Microbiol 33: 389–395. Jiang M, Shao W, Perego M & Hoch JA (2000) Multiple histidine kinases regulate entry into stationary phase and sporulation in Bacillus subtilis. Mol Microbiol 38: 535–542. Kobayashi K, Shoji K, Shimizu T, Nakano K, Sato T & Kobayashi Y (1995) Analysis of a suppressor mutation ssb (kinC) of sur0B20 (spo0A) mutation in Bacillus subtilis reveals that kinC encodes a histidine protein kinase. J Bacteriol 177: 176–182. LeDeaux JR & Grossman AD (1995) Isolation and characterization of kinC, a gene that encodes a sensor kinase homologous to the sporulation sensor kinases KinA and KinB in Bacillus subtilis. J Bacteriol 177: 166–175. LeDeaux JR, Yu N & Grossman AD (1995) Different roles for KinA, KinB, and KinC in the initiation of sporulation in Bacillus subtilis. J Bacteriol 177: 861–863. Matsuyama S, Akimaru J & Mizushima S (1990) SecE-dependent overproduction of SecY in Escherichia coli. Evidence for interaction between two components of the secretory machinery. FEBS Lett 269: 96–100. Noirot-Gros MF, Dervyn E, Wu LJ, Mervelet P, Errington J, Ehrlich SD & Noirot P (2002) An expanded view of bacterial DNA replication. Proc Natl Acad Sci USA 99: 8342–8347. Perego M & Hoch JA (2002) Two-component systems, phosphorelays, and regulation of their activities by phosphatases. Bacillus subtilis and its Closest Relatives from Genes to Cells (Sonenshein AL, Hoch JA & Losick R, eds), pp. 473–481. ASM Press, Washington, DC. Perego M, Cole SP, Burbulys D, Trach K & Hoch JA (1989) Characterization of the gene for a protein kinase which phosphorylates the sporulation-regulatory proteins Spo0A and Spo0F of Bacillus subtilis. J Bacteriol 171: 6187–6196. Quisel JD, Burkholder WF & Grossman AD (2001) In vivo effects of sporulation kinases on mutant Spo0A proteins in Bacillus subtilis. J Bacteriol 183: 6573–6578. Satola S, Kirchman PA & Moran CP Jr (1991) Spo0A binds to a promoter used by sigma A RNA polymerase during sporulation in Bacillus subtilis. Proc Natl Acad Sci USA 88: 4533–4537. Schaeffer P, Millet J & Aubert JP (1965) Catabolic repression of bacterial sporulation. Proc Natl Acad Sci USA 54: 704–711. Sonenshein AL (1989) Metabolic regulation of sporulation and other stationary-phase phenomena. Regulation of prokaryotic development (Smith I, Slepecky RA & Setlow P, eds), pp. 109–130. American Society for Microbiology, Washington, DC. Stragier P, Bonamy C & Karmazyn-Campelli C (1988) Processing of a sporulation sigma factor in Bacillus subtilis: how morphological structure could control gene expression. Cell 52: 697–704. Tang H, Billings S, Wang X, Sharp L & Blair DF (1995) Regulated underexpression and overexpression of the FliN protein of


97


Escherichia coli and evidence for an interaction between FliN and FliM in the flagellar motor. J Bacteriol 177: 3496–3503. Taylor BL & Zhulin IB (1999) PAS domains: internal sensors of oxygen, redox potential, and light. Microbiol Mol Biol Rev 63: 479–506. Trach KA & Hoch JA (1993) Multisensory activation of the phosphorelay initiating sporulation in Bacillus subtilis: identification and sequence of the protein kinase of the alternate pathway. Mol Microbiol 8: 69–79.


Wang L, Fabret C, Kanamaru K, Stephenson K, Dartois V, Perego M & Hoch JA (2001) Dissection of the functional and structural domains of phosphorelay histidine kinase A of Bacillus subtilis. J Bacteriol 183: 2795–2802. Yoshimura M, Asai K, Sadaie Y & Yoshikawa H (2004) Interaction of Bacillus subtilis extracytoplasmic function (ECF) sigma factors with the N-terminal regions of their potential anti-sigma factors. Microbiology 150: 591–599.


c