Copyright 1999 by the Genetics Society of America
The STE12a Homolog Is Required for Haploid Filamentation But Largely Dispensable for Mating and Virulence in Cryptococcus neoformans Changli Yue,* Lora M. Cavallo,*,† J. Andrew Alspaugh,*,‡ Ping Wang,* Gary M. Cox,‡ John R. Perfect‡,§ and Joseph Heitman*,†,‡,§,** *Department of Genetics, **Departments of Pharmacology and Cancer Biology, §Department of Microbiology, ‡Department of Medicine and the †Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina 27710 Manuscript received April 17, 1999 Accepted for publication August 17, 1999 ABSTRACT Cryptococcus neoformans is a fungal pathogen that causes meningitis in immunocompromised hosts. The organism has a known sexual cycle, and strains of the MATa mating type are more virulent than isogenic MATa strains in mice, and they are more common in the environment and infected hosts. A C. neoformans homolog of the STE12 transcription factor that regulates mating, filamentation, and virulence in Saccharomyces cerevisiae and Candida albicans was identified previously, found to be encoded by a novel region of the MATa mating type locus, and shown to enhance filamentous growth when overexpressed. We have disrupted the C. neoformans STE12 gene in a pathogenic serotype A isolate. ste12 mutant strains exhibit a severe defect in filamentation and sporulation (haploid fruiting) in response to nitrogen starvation. In contrast, ste12 mutant strains have only modest mating defects and are fully virulent in two animal models compared to the STE12 wild-type strain. In genetic epistasis experiments, STE12 functions in a MAP kinase cascade to regulate fruiting, but not mating. Thus, the C. neoformans STE12a transcription factor homolog plays a specialized function in haploid fruiting, but it is dispensable or redundant for mating and virulence. The association of the MATa locus with virulence may involve additional genes, and other transcription factors that regulate mating and virulence remain to be identified.
M
ANY yeast and fungi are dimorphic and grow as either budding yeast cells or filamentous hyphal forms. For example, in response to nitrogen starvation, the yeast Saccharomyces cerevisiae differentiates to a filamentous pseudohyphal form (Gimeno et al. 1992). Similarly, the human pathogen Candida albicans, which typically grows in vitro as a yeast, exhibits both hyphal and pseudohyphal growth in response to multiple environmental signals, and mutants that do not filament are avirulent (Lo et al. 1997). The plant fungal pathogen Ustilago maydis also has a prominent hyphal growth form, and the filamentous dikaryon is the infectious form of this organism (Banuett 1998). Recent studies reveal that filamentous growth in these diverse microorganisms is regulated by two conserved signal transduction pathways: a MAP kinase cascade and a pathway involving a conserved Ga protein, adenylyl cyclase, cAMP, and cAMP-dependent protein kinase (Liu et al. 1993; Gold et al. 1994; Lorenz and Heitman 1997; Alspaugh et al. 1998; Du¨rrenberger et al. 1998; Kronstad et al. 1998; Kru¨ger et al. 1998; Robertson and Fink 1998; Pan and Heitman 1999). Cryptococcus neoformans is an opportunistic fungal pathogen with worldwide distribution. It is the leading
Corresponding author: Joseph Heitman, 322 CARL Bldg., Box 3546, Research Dr., Duke University Medical Center, Durham, NC 27710. E-mail:
[email protected] Genetics 153: 1601–1615 ( December 1999)
cause of fungal meningitis, which is uniformly fatal if untreated (Casadevall and Perfect 1998). C. neoformans is a basidiomycete with a known sexual cycle (Kwon-Chung 1975, 1976). The organism is heterothallic and has a bipolar mating system with both MATa and MATa mating types. Mating requires two signals: pheromone and nutrient deprivation. Mating results in cell fusion, filamentation, and nuclear migration to form heterokaryotic cells linked by fused clamp connections. The tips of the hyphae differentiate to form rounded structures, called basidia, in which nuclear fusion and meiosis occur and chains of spores are then produced by budding from the surface of the basidia (reviewed in Alspaugh et al. 1999). Interestingly, mating type of C. neoformans is linked both to prevalence in the environment and to virulence. Isolates of the MATa mating type are 40-fold more abundant in the environment than MATa strains, and MATa isolates are 30-fold more prevalent than MATa strains in clinical specimens from infected individuals (KwonChung and Bennett 1978). Moreover, in a direct comparison of congenic strains, a MATa strain was more virulent than a MATa strain in a murine model of systemic cryptococcal infection (Kwon-Chung et al. 1992a). In response to severe nitrogen starvation and desiccation, MATa strains of C. neoformans differentiate to a filamentous form known as monokaryotic (or haploid) fruiting (Wickes et al. 1996). This filamentous growth
1602
C. Yue et al.
form involves the production of filaments, with nuclear migration along the monokaryotic hyphal cells, which are joined by unfused clamp connections. Similar to mating, terminal basidia form at the ends of the hyphae. However, in contrast to sporulation following mating, only short chains of spores are produced by monokaryotic fruiting, and all spores are of the MATa mating type. MATa strains do not undergo haploid filamentation. Infection by C. neoformans is likely to be initiated by inhalation of the infectious particle, thought to be either small, dessicated yeast cells or spores, both of which are small enough to efficiently deposit into the alveoli of the lung (Neilson et al. 1977). It has been proposed that one role of monokaryotic fruiting may be to generate infectious spores, and that this might explain the increased prevalence of MATa strains in the environment and in clinical samples (Wickes et al. 1996). However, this hypothesis fails to explain the association of MATa and virulence because MATa cells are inherently more virulent than MATa cells in a murine model in which the organism is delivered intravenously, bypassing entry through the lung (Kwon-Chung et al. 1992a). Alternative roles for haploid fruiting might be to generate spores to survive environmental stress under conditions when a mating partner is not readily available, or to disperse MATa spores to locate more distant MATa mating partners. The link between MATa mating type and both environmental prevalence and virulence has focused research interest on the structure and encoded products of the MATa locus. An z40-kb region of the MATa locus was identified previously and found to contain a gene encoding a small peptide pheromone homolog (Moore and Edman 1993). A second distinct region of the MATa locus was found to encode a homolog of the STE12 transcription factor (Wickes et al. 1997), a homeobox DNA-binding protein (Yuan and Fields 1991) known to regulate mating, invasive growth, and filamentation in S. cerevisiae and filamentation and virulence of C. albicans (Liu et al. 1993, 1994; Lo et al. 1997). Overexpression of the C. neoformans STE12a homolog stimulates monokaryotic fruiting and production of the virulence factor melanin in a serotype D strain (Wickes et al. 1997). Here, we have isolated the STE12 gene homolog from a pathogenic serotype A isolate of C. neoformans and disrupted the gene by homologous recombination. ste12 mutant strains exhibited only modest defects in mating. On the other hand, ste12 mutant strains were completely defective for monokaryotic fruiting, and reintroduction of the wild-type STE12 gene complemented these mutant phenotypes. Overexpression of STE12 suppressed the haploid fruiting defect but not the mating defect of a mutant lacking the Gb protein GPB1. Lastly, ste12 mutant strains were fully virulent in the rabbit meningitis model and in the murine systemic infection model at several different inoculum sizes. Our findings reveal
that the C. neoformans STE12a homolog is specialized to regulate filamentous growth during monokaryotic fruiting, but does not play a primary role in either mating or virulence during systemic or central nervous system infections. We propose that a conserved MAP kinase cascade regulates monokaryotic fruiting in C. neoformans, and that other transcription factors that regulate mating and virulence, as well as additional genes within the MATa locus linked to mating and virulence, remain to be identified.
MATERIALS AND METHODS Strains, media, and growth conditions: The C. neoformans serotype A MATa strain H99 and its derivative, the ade2 mutant M049, were used in this study (Perfect et al. 1993). All mating assays of these strains were performed with the serotype D MATa strain JEC20 or congenic auxotrophic derivatives (Moore and Edman 1993). The serotype A strain 450 from Eric Jacobson (DUMC 133.96) was generously provided by Wiley Schell through the Duke University Mycology Research Unit Fungal Collection, and the congenic serotype D MATa strain JEC21 and MATa strain JEC20 were provided by Jeff Edman. ura5 auxotrophic derivatives of the wild-type strain H99, the ste12 mutant, and the ste12 1 STE12 reconstituted strains were isolated by selection for 5-FOA resistance, as described previously (Kwon-Chung et al. 1992b). Standard yeast media and genetic manipulations were as described (Sherman 1991). Limiting nitrogen medium contains 0.17% yeast nitrogen base without amino acids or ammonium sulfate, 2% dextrose, 2% Bacto-agar and 50 mm ammonium (SLAD; Gimeno et al. 1992). All other media were prepared as described (Wickes et al. 1996; Alspaugh et al. 1997). Isolation of the C. neoformans serotype A STE12 gene: Two primers, 59-TCTGAGGAATCTCAAACCGG (1557) and 59TCGTCGTTGGTTCCAACCC (1558), from the C. neoformans serotype D STE12 conserved homeodomain region (Wickes et al. 1997) were used to PCR amplify a 420-bp fragment of the STE12a gene from genomic DNA. The resulting 420-bp fragment was used as a probe for Southern blot analysis of genomic DNA isolated from the serotype A strain H99. A 10kb HindIII fragment hybridized to this 420-bp STE12 probe, and a HindIII 8- to 12-kb size-selected genomic library was constructed in the plasmid pBluescript. Clones containing the desired HindIII fragment were identified by colony hybridization. Nylon membranes (Zeta-probe blotting membranes; BioRad, Richmond, CA) were used for colony lifts, and subsequent hybridization and washes were as described (Sambrook et al. 1989). Sequence analysis revealed that this HindIII fragment was missing the 39 end of the STE12 gene. A 6- to 8-kb size-selected KpnI library was subsequently constructed in pBluescript to retrieve the 39 end of the STE12 gene by colony hybridization. Overlapping regions of both the 10-kb HindIII fragment and the 7-kb KpnI fragments were sequenced across the STE12 gene at the Duke University DNA sequencing facility using synthetic primers. Preparation of probes: Probes used for library screening, Southern blots, and Northern blots were prepared from restriction fragments or PCR-amplified fragments, as described in the text. Probes were labeled using the DIG nonradioactive nucleic acid labeling system (Boehringer Mannheim, Indianapolis). Southern hybridization: Genomic DNA (10 mg) was digested with various restriction enzymes and electrophoresed in 0.8%
C. neoformans STE12a Homolog agarose DNA gels. The DNA was then transferred to nylon membranes (Boehringer Mannheim) using standard protocols (Sambrook et al. 1989). Hybridization, washing, and detection of hybridized bands were performed according to the instructions from the manufacturer (Boehringer Mannheim). 39-RACE analysis: The C terminus of the STE12a protein was confirmed, and the polyadenylation site of the STE12 transcript established by RACE was performed using the 39RACE system kit from GIBCO-BRL (Gaithersburg, MD). Firststrand cDNA synthesis was performed using 10 mg of total RNA from C. neoformans serotype A strain H99 grown in YPD liquid medium at 308. The nested PCR was performed using an internal primer, 59-GGAGAGATACGAGTGAAC (2520), the universal amplification primer (UAP) 59-CUACUACUACU AGGCCACGCGTCGACTAGTAC, as well as a PCR program of 3 min at 948, 30 cycles of 45 sec at 948, 25 sec at 558, 3 min at 728, and a final 5-min extension step at 728. The resulting 700-bp PCR RACE product was ligated into the TA vector (Invitrogen, Carlsbad, CA) and sequenced. Disruption of the C. neoformans serotype A STE12 gene: The full-length, 2.9-kb serotype D genomic ADE2 gene was bluntended and ligated into the blunted XbaI site of a 3.9-kb SacIBamHI STE12 gene fragment cloned in pBluescript (see Figure 1). The 3.9-kb SacI-BamHI fragment of STE12 had been cloned by a three-way ligation of a 1.5-kb SacI-HindIII and a 2.4-kb HindIII-BamHI fragment into pBluescript vector cleaved with SacI and BamHI. Note that the ADE2 gene was inserted into the STE12 gene such that the two genes were transcribed in opposite directions. A total of 5 mg of the ste12::ADE2 disruption plasmid was precipitated onto 0.6-mg gold microcarrier beads (Bio-Rad) and biolistically transformed into the ade2 mutant strain M049 as described (Toffaletti et al. 1993). Transformants were selected on regeneration medium (synthetic medium with 1 m sorbitol and lacking adenine). Genomic DNA from 24 ADE1 transformants was prepared using the smash-and-grab protocol (Pitkin et al. 1996). PCR was performed using the following STE12-specific primers flanking the site of insertion of the ADE2 gene: 59-CTGAG GAATCTCAAACCGGG (1671) and 59-GCTTCGGATCATAC CTGACG (2189). A PCR program of 5 min at 948, 30 cycles of 30 sec at 948, 30 sec at 558, 3.5 min at 728 and a final 7 min at 728 was used to determine whether the STE12 gene had been disrupted. PCR amplification of the ste12::ADE2 disruption allele yielded a diagnostic 3400-bp fragment, whereas amplification of the wild-type STE12 gene yielded a 550-bp fragment. Transformants in which the 550-bp wild-type product was missing and the 3400-bp fragment was present were identified and confirmed to contain ste12::ADE2 gene replacements by Southern and Northern blot analyses. Reintroduction of the wild-type serotype A STE12 gene: A 6.3-kb EcoRV-BamHI fragment containing the wild-type STE12 gene was blunt-end ligated (as an EcoRV fragment where the second EcoRV site was adjacent to the BamHI site in the vector polylinker) into a blunt-ended XbaI site in the plasmid pTelHyg (Cox et al. 1996). The resulting plasmid was cleaved with NotI to release a linear fragment and remove the telomeric DNA sequences present in pTelHyg. The fragment containing the STE12 gene and the linked hygromycin-B-resistance gene was purified and biolistically transformed into the ste12 deletion mutant strain as described (Cox et al. 1996). Stable transformants were selected on YPD medium containing 200 mg/ ml hygromycin B (Sigma, St. Louis). Transformants that contained the wild-type STE12 gene were identified by restoration of wild-type mating on SLAD medium with the MATa mating type tester strain JEC20. Genomic DNA isolated from four hygromycin-B-resistant transformants was analyzed by PCR with primers 1671 and 2189 described above, revealing that both the ste12::ADE2 disruption allele and the wild-type STE12
1603
locus were now present in three of the four transformants tested. The presence of the wild-type STE12 gene was confirmed by Southern and Northern blot analyses. Northern hybridization: Total RNA from the C. neoformans wild-type STE12 strain H99, the ste12 mutant strain, and the ste12 1 STE12 reconstituted strain grown in liquid YPD or liquid SLAD media was isolated using the Qiagen RNeasy Midi kit. Total RNA (15 mg) was electrophoresed in a 1% agarose formaldehyde gel and then transferred overnight by capillary action to a nylon membrane (Boehringer Mannheim) using standard protocols (Sambrook et al. 1989). Northern hybridization, washing, and detection of hybridized bands were performed according to the instructions from Boehringer Mannheim, and the probe used was the same as that described for the Southern blot analysis. Mating and haploid filamentation assays: Strains of opposite mating types were grown on YPD medium for 48 hr at 308, cocultured on V8 or SLAD mating medium, and incubated at room temperature. Matings were scored microscopically for filamentation. For haploid filamentation assays, the Ras1Q67L mutant protein ( J. A. Alspaugh, L. M. Cavallo, J. R. Perfect and J. Heitman, unpublished results) was expressed by introducing linear DNA fragments containing the mutant RAS1 gene linked to either the hygromycin-B-resistance gene or the URA5 gene as selectable markers by biolistic transformation and selection for Ura1 or hygromycin-resistant colonies, respectively. Isolates containing the Ras1-Q67L mutant allele were identified by PCR amplification of genomic DNA with primers flanking the RAS1 gene and subsequent cleavage with XbaI to identify the restriction site introduced at the site of the Q67L mutation. Haploid filamentation was assayed by incubating spotted suspensions of cells on filament agar at 248 for up to 4 wk. Quantitative mating assay: As a measure of relative mating efficiency, the rate of recombinant basidiospore appearance was quantified within identical mating reactions of various serotype A strains. The STE12 wild type, three independent ste12 mutant strains, and two independent ste12 1 STE12 reconstituted strains were grown in liquid YPD medium for 18 hr, pelleted, and resuspended in water at 108 cells/ml. A similar cell suspension (108 cells/ml) was made for the serotype D MATa strain JEC53 (MATa ura5 lys1). Mating mixtures for each of the serotype A strains (MATa URA5 LYS1) were made by mixing 100 ml of each cell suspension with 100 ml of the JEC53 cell suspension. Subsequently, 5 ml of each mating mixture were plated as drops on 10 identical V8 medium plates supplemented with uracil and lysine. These mating plates were incubated at 258. Every 48 hr, the mating reactions on one plate were excised as agar plugs, placed in 2 ml sterile water, and vortexed for 2 min. A total of 300 ml of this cell/spore suspension was plated on 5-fluoroorotic acid medium (Sherman 1991) lacking lysine to select for ura5 LYS1 recombinant progeny. Colonies were counted at 72 hr. Control incubations of parental strains alone failed to yield any recombinant isolates on this medium, indicating that all ura5 LYS1 isolates were attributable to mating. Photomicroscopy: All single-colony photographs were taken directly from Petri plates using a Nikon Eclipse E400 microscope with a 310 or 350 primary objective and a 32.5 trinocular camera adaptor for a final magnification of 325 or 3125, as indicated. Capsule induction: All strains assayed for capsule production were incubated on YPD medium at 308 for 48 hr and subsequently inoculated into 10 ml low-iron medium with 56 mm ethylenediamine-di(o-hydroxy-phenylacetic acid) (Vartivarian et al. 1993). After 72 hr incubation with shaking (250 rpm) at 308, the cells were pelleted and resuspended in water at 2.5 3 108 cells/ml (confirmed by duplicate hemacy-
1604
C. Yue et al.
tometer counts). The cell suspensions were treated with 10% formalin and added to heparinized microhematocrit capillary tubes (Fisher, #02-668-66), the ends of which were sealed with clay. Capillary tubes were spun for 10 min in a Microhematocrit centrifuge, model MB (International Equipment Co.). Packed cell volume was measured analogously to a hematocrit as the length of the packed cell phase divided by the length within the capillary tube of the total suspension (Granger et al. 1985). Melanin production: Whole-cell laccase activity was assayed as described previously, with minor modifications (Williamson 1994). Cells were inoculated from fresh cultures grown on YPD agar into liquid minimal asparagine medium (MM) with 0.1% dextrose and incubated at 308 for 16 hr in a shaking incubator (250 rpm). Cells were pelleted, washed once with MM without dextrose, and resuspended in the same medium. Cells were incubated for an additional 5 hr at 308, pelleted, washed once with water, and resuspended in 5 ml PBS at 258. The cell suspensions were normalized to 108 cells/ml in PBS at 258. One-milliliter aliquots were removed and placed on ice to serve as T0 controls. To the original cell suspensions, 1 mm epinephrine was added as a substrate for melanin production. The samples were incubated at 258 for 30 min, and the OD475 of the supernatant was determined on a Beckman DU640 spectrophotometer. One unit of laccase activity was defined as 0.001 OD475. Data points represent the mean of triplicate samples 6 standard error. Urease and phospholipase B production: Strains were tested for urease activity using Christensen’s urea agar and broth (Becton Dickinson, Cockeysville, MD). The tubes containing the suspensions of the transformants in Christensen’s medium were incubated with agitation overnight at 308. Christensen’s medium contains 300 mm urea and phenol red as a pH indicator. In Christensen’s medium, urease activity converts urea to ammonia and increases the pH, which is reflected by a color change of the medium from yellow to bright pink. C. albicans has no urease activity and was used as a negative control. Phospholipase B activity was quantitated on egg yolk agar, as described (Chen et al. 1997). Phospholipase activity was quantitated by measuring the zones of precipitation surrounding colonies grown on egg yolk agar. The zones of precipitation were controlled for colony size by dividing the diameter of the precipitation zone by the diameter of the colony. Rabbit virulence model: Strains were incubated on YPD medium for 48 hr at 378 and resuspended in phosphate-buffered saline [PBS, pH 7.4 (Sigma)] at 3 3 108 cells/ml. Twelve New Zealand white male rabbits weighing 2–3 kg (four for each strain) were administered 2.5 mg/kg cortisone acetate intramuscularly before intrathecal injection of a 0.3-ml suspension of cryptococcal cells. Daily intramuscular cortisone injections were continued throughout the course of the experiment. Cerebrospinal fluid (CSF) was obtained by cisternal punctures at days 4, 7, 11, and 14 after infection. The CSF was immediately serially diluted, and each dilution was plated on YPD medium and incubated at 308 for 48 hr for quantitative analysis. Rabbits were sedated with 10 mg xylazine and 100 mg ketamine given intramuscularly before all cisternal inoculations or withdrawals (Perfect et al. 1993). Student’s t -test was used in evaluating the colony counts from the rabbit experiments. Murine virulence model: C. neoformans wild-type STE12, ste12 mutant, and ste12 1 STE12 reconstituted strains were grown in liquid YPD media at 308 for 48 hr and resuspended in PBS, pH 7.4 (Sigma) at 1 3 105, 1 3 106, 1 3 107, or 1 3 108 cells/ ml. A total of 0.1 ml of cell suspension (for a total of 104, 105, 106, or 107 cells) was injected into the lateral tail vein of each mouse (10 or 15 mice were used for the wild-type STE12 strain, and 10 were used for each of the ste12 mutant strains and the
ste12 1 STE12 reconstituted strain). Mice were 4- to 6-wk-old female BALB/c mice (Charles River Labs, Raleigh, NC). The number of mice were recorded twice daily. Mice that appeared moribund or in pain were killed using CO2 inhalation. Survival data from the mouse experiments were analyzed by a Wilcoxon test for censored data using True Epistat (Standard Version, Epistat Services).
RESULTS
Isolation of the serotype A STE12 gene: A C. neoformans homolog of the STE12 transcription factor was recently identified and found to stimulate haploid filamentation and melanin production when overexpressed (Wickes et al. 1997). These findings, and the fact that the STE12 gene is only present in MATa cells, suggested that STE12 might be responsible for the known association of the MATa mating type with virulence. However, the STE12 gene was not disrupted in these studies, and it has not been established if STE12 is required for either mating or virulence of this organism. To determine the functions of STE12, we have capitalized on the ability to disrupt genes by homologous recombination at high efficiency in serotype A strains of C. neoformans (Lodge et al. 1994; Alspaugh et al. 1997; Odom et al. 1997; Del Poeta et al. 1999). Because the STE12 gene was originally isolated from a serotype D strain, and genes derived from serotype A and D are sufficiently sequence divergent (z5%) to prevent efficient homologous recombination, we isolated the STE12 gene from the serotype A strain H99. To this end, the serotype D STE12 gene was used to probe a Southern blot of serotype A genomic DNA. A 10-kb HindIII fragment spanning part of the serotype A STE12 gene was isolated by screening a size-selected genomic library by colony hybridization. Sequence analysis revealed that this clone was missing the 39 region of the STE12 locus, and a second overlapping 7-kb KpnI fragment containing the 39 end of the STE12 locus was identified by genomic Southern and cloned. A restriction map for the resulting z15-kb region spanning the serotype A STE12 locus is depicted in Figure 1A. This region was further analyzed by genomic Southerns, dot blot hybridizations, and sequencing to reveal the STE12 gene and mating-type-specific and nonspecific regions. The serotype A STE12 gene is located in the central portion of the 15-kb region (Figure 1A). Sequence analysis of the genomic locus, cDNA, and 39RACE products revealed that the serotype A STE12 gene and product share extensive homology with the serotype D STE12 gene from C. neoformans and the STE12 genes and proteins of other yeast and fungi. The predicted STE12 protein product consists of 841 amino acids and contains an N-terminal homeobox DNA-binding domain with marked identity to those of the STE12 homologs from S. cerevisiae, C. albicans, and Kluvyeromyces lactis (Figure 2). In addition, the C-terminal domain of the STE12a protein shares identity with a variety of different
C. neoformans STE12a Homolog
1605
Figure 1.—Identification and disruption of the serotype A STE12 gene. (A) A restriction map of the the locus containing the STE12 gene and the targeting disruption construct is depicted. The 7700-bp region containing the STE12 gene was sequenced, and the GenBank accession number is AF121343. Restriction mapping was done in regions not sequenced. Sites for a few restriction enzymes are listed. K, KpnI; B, BamHI; H, HindIII; E, EcoRI; R, EcoRV, X, XbaI; S, SacI. The arrow above the locus indicates the direction of the STE12 gene. Below the locus, the line labeled “probe” indicates the EcoRI-BamHI fragment that was used in the Southern and Northern hybridizations to confirm the gene disruption and reintroduction shown in B and C. For the ste12::ADE2 disruption allele, a 2.9-kb restriction fragment containing the C. neoformans serotype D ADE2 genomic locus was ligated into the XbaI site of the SacI-BamHI fragment containing the STE12 gene. (B) Southern blot of genomic DNA from the STE12 wild-type strain, the ste12 mutant strain, and the ste12 1 STE12 reconstituted strain (lanes 1–3). Genomic DNA was cleaved with BamHI and electrophoresed in a 0.8% agarose gel. The probe used in this Southern blot is depicted in A. The wild-type STE12 gene corresponds to a 4-kb BamHI fragment (lane 1), the ste12::ADE2 disruption allele corresponds to a 7-kb BamHI fragment (lane 2), and the ste12 1 STE12 reconstituted strain contains both the wild-type 4-kb and the 7-kb ste12::ADE2 fragments (lane 3). (C) Total RNA was isolated from the wild-type STE12 strain (lane 1), the ste12 mutant strain (lane 2), and the ste12 1 STE12 reconstituted strain (lane 3) grown in low-nitrogen medium (SLAD; shown here) or YPD medium (data not shown). RNA was electrophoresed and analyzed by Northern hybridization with the STE12 gene as probe. Before RNA transfer, the gel was stained with ethidium bromide to determine the relative level of ribosomal RNA in each sample as a loading control.
zinc finger proteins. The serotype A STE12 locus is MATa specific: probes from this region hybridize to genomic DNA isolated from the serotype A MATa strain H99 and from the serotype D MATa strain JEC21, but not from the serotype D MATa strain JEC20 (data not shown). The STE12 locus is flanked on the right by an z1-kb BamHI fragment that is unique in the serotype A strain H99 and additional sequences that are not mating type specific (Figure 1A; data not shown). On the left, the STE12 locus is flanked by additional sequences that hybridize poorly to genomic DNA from MATa or MATa serotype D strains; thus, additional sequences and the left border of this portion of the MATa locus likely remain to be identified (Figure 1A; data not shown). Disruption and reintroduction of the STE12 gene: The STE12 gene was disrupted by homologous recombination. The ADE2 selectable marker was cloned into an XbaI site in the STE12 open reading frame (Figure 1A). The resulting ste12::ADE2 disruption allele was introduced by biolistic transformation into the Dade2 strain M049 derived from the pathogenic serotype A strain
H99. Ade1 transformants were selected on synthetic medium lacking adenine and containing 1 m sorbitol. Approximately 400 transformants were obtained and analyzed initially for a presumptive sterile phenotype on V8 medium in crosses to the MATa mating type tester strain JEC20. No isolates with a pronounced sterile phenotype were obtained. Next, genomic DNA was isolated from 24 random transformants and analyzed for the presence of the ste12::ADE2 allele by PCR analysis with STE12-specific primers flanking the site of the ADE2 gene insertion and by Southern analysis. Out of 24 isolates, 1 lacked the wild-type STE12 locus and contained only the ste12::ADE2 disruption allele (Figure 1B). We subsequently identified 6 additional ste12::ADE2 isolates from 64 transformants, for an overall frequency of 8% homologous recombination (7 out of 88 Ade1 transformants). Southern blot hybrization confirmed that the wild-type STE12 locus had been replaced by the ste12::ADE2 disruption allele by homologous recombination (Figure 1B). The wild-type STE12 gene was reintroduced into the ste12::ADE2 mutant strain by transformation. The wild-
1606 C. Yue et al. Figure 2.—The C. neoformans STE12 protein contains a homeodomain DNA-binding region with marked identity to yeast STE12 homologs. The N-terminal region of the C. neoformans (C.n.) serotype A STE12 protein encompassing the homeodomain is aligned with the corresponding sequences of the S. cerevisiae (S.c.) STE12 protein, the C. albicans (C.a.) STE12 homolog CPH1, and the K. lactis (K.l.) STE12 protein. Identical amino acids are indicated in bold, similar amino acids are shaded, and nonidentical amino acids are in white. Note that a second distinct region of identity between the yeast STE12 proteins (DFPLDY) present at the C-terminal end of the aligned region is not conserved in the C. neoformans STE12 homolog.
C. neoformans STE12a Homolog
1607
Figure 3.—The ste12 mutation confers modest defects in mating in C. neoformans. The isogenic STE12 wild-type, ste12 mutant, and ste12 1 STE12 reconstituted MATa strains were cocultured in cell patches with the MATa strain JEC20 on V8 mating medium or nitrogenlimiting mating media (SLAD) for 7 days at 258. The edges of the mating mixtures were photographed (325).
type STE12 gene on a 6.3-kb EcoRV-BamHI fragment was cloned adjacent to the hygromycin-B-resistance gene. The ste12::ADE2 strain was biolistically transformed with the STE12 gene and hygromycin-B-resistant isolates selected. PCR and Southern analysis confirmed that the wild-type STE12 gene had been introduced ectopically into the ste12 mutant strain (Figure 1B), and we designated the resulting reconstituted strain ste12 1 STE12. To examine expression of the STE12 gene, Northern analysis was performed on total RNA isolated from the isogenic STE12 wild-type parental, the ste12 mutant, and the ste12 1 STE12 reconstituted strains (Figure 1C). In contrast to the STE12 wild-type strain, in which a 2.5kb message was readily detectable, no message was detected in the ste12 mutant strain. This observation supports the conclusion that STE12 has been functionally deleted in the ste12::ADE2 mutant strain. After reintroduction of the wild-type STE12 gene by transformation, STE12 expression was restored in the ste12 1 STE12 strain. By Northern blot analysis, the STE12 gene was found to be expressed at similar levels in cells grown in either YPD or SLAD low-nitrogen liquid medium (data not shown). ste12 mutant strains exhibit modest mating defects: We next analyzed the possible role of the STE12a homolog in mating in C. neoformans. In this organism, coculture of MATa and MATa strains on several different nutrient-limited media (V8 mating medium, SLAD, filament agar) results in cell fusion, filamentation, nuclear migration, basidia formation, nuclear fusion, meiosis, and sporulation. Thus, filamentation and sporulation can serve as a morphological assay of mating in C. neoformans.
When either wild-type or ste12 mutant MATa cells were mixed with a MATa mating type tester strain (JEC20) on V8 mating medium, abundant filaments and basidiospores were produced within 7 days of incubation at 248 (Figure 3). By comparison of mating mixtures at early time points after coculture, it was apparent that ste12 mutant strains have a modest mating defect compared to the isogenic STE12 parental strain (data not shown). This mating defect was manifested by the production of fewer filaments and basidia at early time points after coculture. However, within a few days of incubation, the overall extent of mating was similar (Figure 3). This mating defect was complemented by reintroduction of the wild-type STE12 gene; in fact, mating was enhanced in the ste12 1 STE12 reconstituted strain compared to the STE12 wild-type parental strain (Figure 3). In a quantitative mating assay that monitors the production of prototrophic recombinant strains following coincubation of auxotrophic parental strains of opposite mating type (see materials and methods), the ste12 mutation reduced the level of mating by z10-fold compared to the isogenic STE12 wild-type and the ste12 1 STE12 reconstituted strains. These findings indicate that STE12 plays a modest but not absolute role in mating. Mating also occurs on defined, nutrient-limiting medium with reduced levels of ammonium sulfate, either SLAD medium (50 mm ammonium sulfate) or filament agar (no added nitrogen source). The ste12 mutant strain exhibited a more pronounced mating defect on these synthetic mating media than on V8 agar, but it still eventually produced filaments and basidiospores (Figure 3). We note that the mating defect conferred
1608
C. Yue et al. Figure 4.—STE12a is required for haploid fruiting in C. neoformans. The isogenic STE12 wild-type (H99), the ste12 mutant, and the ste12 1 STE12 reconstituted strains were transformed with the gene encoding the dominant active Ras1-Q67L mutant protein. Transformants were grown on dry, nitrogen-limiting filament agar medium to induce haploid filamentation for 14 days at 248, and the edges of cell patches were photographed (3125).
by the ste12 mutation was more subtle than the pronounced mating defects conferred by mutations in several other components of the mating pathway that we have analyzed, including GPA1, GPB1, STE20, SCH9, CPK1, and CNA1 (Alspaugh et al. 1997; P. Wang and J. Heitman, unpublished results; R. C. Davidson and J. Heitman, unpublished results; M. C. Cruz and J. Heitman, unpublished results). STE12 is required for haploid fruiting: Nitrogen starvation and desiccation induces some C. neoformans MATa strains to undergo haploid filamentation and sporulation (Wickes et al. 1996). Under these same conditions, MATa strains do not differentiate and, thus, genes within or linked to the MATa locus are required for haploid filamentation. We therefore tested whether the STE12a gene is required for haploid fruiting. The MATa serotype A strain H99 has not been observed to undergo haploid filamentation when incubated on filament agar at room temperature for up to several months (our unpublished observations). In comparison, the MATa serotype A strain 450 (also known as NIH38 or DUMC 133.96, provided by Eric Jacobsen) undergoes robust monokaryotic fruiting. This atypical strain forms abundant filaments with unfused clamp connections on V8, SLAD, or filament agar within 48 hr, and these filaments produce abundant basidia and basidiospores. The MATa serotype D strain JEC21 undergoes haploid fruiting with filamentation and basidiospore production in 1–4 wk on filament agar. Hence, the serotype A MATa strain H99 appears to be lacking elements required for haploid filamentation, whereas haploid fruiting is derepressed in the serotype A MATa strain 450. Similar strain differences have been noted in the ability of certain laboratory strains of S. cerevisiae to undergo pseudohyphal differentiation (Gimeno et al. 1992). Recently, we have found that expression of a dominant active allele of the C. neoformans homolog of the small G protein Ras1 stimulates haploid filamentation in strain H99 and in the Ade1 reconstituted versions of the ade2 mutant strain M049 (J. A. Alspaugh, L. M.
Cavallo, J. R. Perfect and J. Heitman, unpublished results). Thus, isolates of strain H99 expressing the dominant activated Ras1-Q67L mutant allele undergo haploid fruiting to produce filaments and basidiospores in 3–14 days on filament agar (Figure 4). Strikingly, when the Ras1-Q67L mutant allele was introduced into several independent isogenic ste12 mutant strains, no haploid filamentation was ever observed in multiple independent transformants incubated for up to 1 mo (Figure 4). Haploid filamentation in response to the dominant active Ras1-Q67L mutant allele was restored in the ste12 1 STE12 reconstituted strain (Figure 4), indicating that the defect in monokaryotic fruiting is attributable to the ste12 mutation. Genetic epistasis experiments provide evidence that STE12 functions in a MAP kinase cascade and regulates haploid fruiting, but not mating. We have recently found that mutant strains lacking the G-protein b subunit GPB1 are sterile and are defective in monokaryotic fruiting in response to nitrogen starvation (P. Wang, J. R. Perfect and J. Heitman, unpublished results). Here, we performed epistasis analysis to test if STE12 functions downstream of GPB1 in a signaling cascade regulating mating and morphogenesis. When a GAL7STE12a fusion gene was introduced into the gpb1::ADE2 mutant strain expressing the Ras1-Q67L mutant protein, haploid fruiting was restored when STE12 expression was induced on galactose filament agar, but no haploid fruiting was observed when STE12 expression was repressed on glucose filament agar (Figure 5). Thus, overexpression of STE12a suppresses the haploid fruiting defect of mutant cells lacking GPB1. In contrast, the GAL7-STE12a fusion gene failed to restore mating of gpb1 mutant cells coincubated with the MATa mating partner JEC20 (data not shown). Taken together, these observations provide additional evidence that STE12 is a component of a MAP kinase cascade and is specialized to regulate haploid fruiting, but is either not required for mating or is redundant with other factors that regulate mating. Effects of the ste12 mutation on virulence factor pro-
C. neoformans STE12a Homolog
1609
Figure 5.—STE12a restores haploid fruiting in gpb1 mutant cells. The G-protein b subunit GPB1 is required for mating and Ras1-Q67L-induced haploid filamentation in C. neoformans (P. Wang, J. R. Perfect and J. Heitman, unpublished results). For haploid filamentation, the gpb1 RAS1Q67L strain and the gpb1 RAS1Q67L strain transformed with plasmid pCGS-1 expressing the GAL7-STE12 fusion gene were grown on glucose filament agar and galactose filament agar. Plates were photographed (325) after 3 days of incubation at 248.
duction: We next tested whether the ste12 mutation has any effect on known virulence factors of C. neoformans. The virulence traits tested included prototrophy, growth at elevated temperature, and the production of melanin, urease, phospholipase B, and polysaccharide capsule. The isogenic STE12, ste12 mutant, and ste12 1 STE12 reconstituted strains all grow on minimal medium (YNB) and, thus, have no novel auxotrophic phenotypes (data not shown). All three strains were equally viable at 37 or 398 (data not shown) and produced melanin to similar extents on either minimal DOPA agar or niger birdseed agar (Figure 6C). A quantitative spectrophotometric assay of whole-cell phenoloxidase activity confirmed that all three strains produce equivalent amounts of melanin (Figure 6D). The ste12 mutant strain also produced two potential virulence factors, urease and phospholipase B, at similar levels to the STE12 wild-type and the ste12 1 STE12 strains (data not shown; see materials and methods). We did observe that ste12 mutant cells consistently produced less capsule compared to the isogenic STE12 wild-type and the ste12 1 STE12 reconstituted strains, as revealed by India ink stains of CSF fluid from infected rabbits (Figure 6A). This effect was quantified by photomicroscopy and by measuring the packed cell volume
(cryptocrit) of cells grown under iron-limiting conditions in vitro. The average yeast capsule size was reduced by z50% under capsule-inducing conditions in several independent ste12 mutant strains compared to the STE12 wild-type and the ste12 1 STE12 reconstituted strains (Figure 6A). By the cryptocrit assay, which measures packed cell volume and, therefore, detects both cell and capsule sizes, the capsule size of the ste12 mutant strain was also found to be reduced compared to the STE12 wild-type and the ste12 1 STE12 reconstituted strains (Figure 6B). This observation suggests that STE12 contributes to regulate capsule production. STE12 is dispensable for virulence in animal models: Because the MATa-mating-type locus is linked to virulence of C. neoformans, and the ste12 mutation caused a modest defect in capsule induction in vivo and in vitro, we tested the contribution of the STE12a gene to virulence in two animal models of cryptococcal infection. First, we employed the rabbit meningitis model (Perfect et al. 1980) that had been previously used to study the virulence of several different mutant strains (Lodge et al. 1994; Alspaugh et al. 1997; Odom et al. 1997). Rabbits were immunosuppressed with corticosteroids and inoculated intrathecally with the STE12 wild-type strain, the ste12 mutant strain, and the ste12 1 STE12 reconstituted strain. Cerebrospinal fluid was recovered
1610
C. Yue et al.
Figure 6.—The role of STE12a in capsule and melanin production. (A) Cerebrospinal fluid was isolated at 10 days after infection from rabbits inoculated with the STE12 wild-type, the ste12 mutant, or the ste12 1 STE12 reconstituted strain and was analyzed by India ink counterstain to examine the size of the polysaccharide capsule surrounding the yeast cells. Representative cells were photographed (3200). (B) Capsule size was quantified by measuring the packed cell volume of cell suspensions (normalized to 108 cells/ml) for each of the three strains grown under capsule-inducing, low-iron conditions in liquid medium for 72 hr. Each data point represents the mean of triplicate samples, and error bars indicate standard error of the mean. (C) Melanin production by the STE12 wild-type, ste12 mutant, and ste12 1 STE12 reconstituted strains was assessed by plating cell suspensions onto Niger seed agar medium and incubating at 308 for 5 days; the cell patches were photographed (35). (D) To quantify melanin production by the isogenic STE12 wild-type, ste12 mutant, and ste12 1 STE12 strains, whole-cell laccase enzyme activity was determined by incubating glucose-starved cells with 1 mm epinephrine at 258 for 25 min. The optical density of the resulting cell supernatants was measured at 475 nm. Each data point represents the mean of triplicate samples, and error bars indicate standard error of the mean.
on days 4, 7, 11, and 14 following infection, and the number of surviving yeast colonies were determined by quantitative plating. Importantly, quantitative yeast counts are correlated with morbidity in this animal model system (Perfect et al. 1980). We found no difference in quantitative yeast counts obtained from animals infected with the STE12 wild-type, the ste12 mutant, or the ste12 1 STE12 reconstituted strains over the course of a 2-wk infection (Figure 7A). Yeasts recovered from animals infected with the ste12 mutant strain exhibited the modest mating defect of the ste12 mutant strain and, thus, the ste12 mutation had not reverted or been suppressed during the course of the infection. These observations suggested that the STE12a homolog is not required for virulence of this C. neoformans serotype A strain in the vertebrate central nervous system under these conditions. Next, we assessed the contribution of the STE12a homolog to virulence in the murine systemic infection model. Groups of 10–15 mice each were infected with 107 cells of the STE12 wild-type, the ste12 mutant, and the ste12 1 STE12 reconstituted strains by tail vein injection. Moribund mice were sacrificed in this model of systemic cryptococcal infection; in general, the majority of infected mice exhibited hydrocephalus as a consequence
of cryptococcal central nervous system (CNS) infection. As shown in Figure 7B, we again observed no difference between the virulence of the wild-type STE12, the ste12 mutant, and the ste12 1 STE12 reconstituted strains, as measured by cumulative survival. To address whether a virulence defect might be apparent with a smaller initial inoculum, groups of 10 animals each were infected with the wild-type, ste12 mutant, and ste12 1 STE12 reconstituted strains at inoculum sizes of 106, 105, or 104 cells per infected animal (Figure 8). In these studies, the time course of lethal infections was somewhat prolonged, as expected, but the virulence of the three strains was comparable at equivalent inoculum sizes, with no apparent virulence defect of the ste12 mutant strain (Figure 8). Finally, to exclude that a suppressor mutation might be present in the ste12 mutant strain that had been tested thus far, a second independent ste12 mutant strain was assessed for virulence. In this case, the virulence of the isogenic wild-type and the two independent ste12 mutant strains was comparable at an inoculum size of 106 cells per infected animal (Figure 8B). Taken together, these findings indicate that in a pathogenic serotype A strain of C. neoformans, the STE12a homolog is not required for pathogenicity in two different animal
C. neoformans STE12a Homolog
Figure 7.—STE12a is dispensable for virulence of C. neoformans in animal models. (A) Rabbits were immunosuppressed with corticosteroids and inoculated intrathecally with 108 cells of the isogenic STE12 wild-type, the ste12 mutant, and ste12 1 STE12 reconstituted strains. CSF was removed on days 4, 7, 11, and 14 after inoculation, and the number of surviving organisms was determined by serial dilution and plating on YPD medium. Each data point represents the mean of all cultures for each strain, and the strandard error of the mean is indicated. (B) A total of 107 cells each of the wild-type STE12, the ste12 mutant, and the ste12 1 STE12 reconstituted strains were injected into the tail vein of mice. A total of 15 mice were infected with the wild-type strain, and groups of 10 mice were each infected with the mutant and reconstituted strains. The percentages of mice surviving from each group were plotted over the course of this 50-day experiment.
model systems involving both systemic and CNS infection, two vertebrate species, and a range of infectious doses. DISCUSSION
We are interested in elucidating the signal transduction pathways that regulate mating, filamentation, and virulence in the pathogenic basidiomycete C. neoformans. Here, we describe our findings with respect to
1611
one gene encoded by the MATa locus, which encodes a homolog of the STE12 transcription factor identified previously by Wickes et al. (1997). In the studies reported here, the gene encoding the STE12a homolog was isolated from the pathogenic serotype A strain H99 and disrupted by transformation and homologous recombination. As previously reported for the serotype D STE12a gene (Wickes et al. 1997), the serotype A STE12 protein contains a homeodomain that shares marked sequence identity with the STE12 homologs from S. cerevisiae, C. albicans, and K. lactis (Figure 2). In contrast, other regions of STE12, including C-terminal regions that interact with the Dig1 and Dig2 repressors, or with the Mcm1 or Tec1 coactivator proteins in S. cerevisiae, do not appear to be conserved in the C. neoformans STE12a homolog (Kirkman-Correia et al. 1993; Pi et al. 1997). Either the STE12a protein functions with a different set of partner proteins in C. neoformans, or these protein-protein interaction surfaces are more divergent than the corresponding STE12 homeodomain protein-DNA interaction surface. Homologs of the Ste12 regulators in S. cerevisiae, including Dig1, Dig2, Mcm1, and Tec1, have not yet been identified in C. neoformans, and further studies will be required to define STE12-interacting proteins in this pathogenic fungus. Interestingly, the C. neoformans ste12 mutant strains exhibited only modest defects in mating on standard V8 mating medium, manifested as a reduction in filament production at early time points and an z10-fold reduction in the production of prototrophic progeny in a quantitative mating assay. On a synthetic medium that supports mating to a lesser extent (SLAD), the ste12 mating defect was more pronounced, but was not as severe as the mating defects observed with a variety of other mutations, including those in the Ga protein GPA1 (Alspaugh et al. 1997) or the Gb protein GPB1 (P. Wang, J. R. Perfect and J. Heitman, unpublished results). We note that these matings involve a divergent MATa serotype A and a MATa serotype D partner because no MATa serotype A strains have yet been identified. Thus, even under very stringent mating conditions (serotype D partner, poorer mating medium), the ste12 mutant strains are able to mate. These considerations likely explain why we observe a subtle mating defect conferred by the ste12 mutation in serotype A, whereas no mating defect was apparent when a serotype D ste12 mutant was crossed to a congenic wild-type serotype D strain on V8 mating medium (Y. Chang, B. L. Wickes and K. J. Kwon-Chung, personal communication). Our observations suggest that the STE12a homolog plays only a modest role in mating (Figure 9), or that its functions are redundant with other signaling components or pathways. Our findings are also analogous to previous studies of S. cerevisiae ste12 and C. albicans cph1 mutants, which revealed only partial defects in filamentous growth and virulence, indicating that other pro-
1612
C. Yue et al.
Figure 8.—The ste12 mutant is as virulent as the wild type at different inoculum sizes. The wild-type STE12, the ste12 mutant, and the ste12 1 STE12 reconstituted strains were injected into the tail vein of mice at four different inocula: 107 cells (A), 106 cells (B), 105 cells (C), and 104 cells (D). A total of 10 mice were infected with each strain. A second independent ste12 mutant strain was included in the experiment at an inoculum of 106 cells per infected animal (B, inverted open triangles). The percentages of mice surviving from each group were plotted over the course of this 65-day experiment. The wild-type strain is depicted with solid circles, the ste12 mutant strain with open circles, and the ste12 1 STE12 reconstituted strain with closed, inverted triangles.
teins may partially overlap with these STE12 functions (Liu et al. 1993, 1994; Lo et al. 1997). The C. neoformans ste12 mutant strain exhibits a severe defect in monokaryotic fruiting. In response to nitrogen starvation, some MATa strains of C. neoformans filament and sporulate in a process called haploid or monokaryotic fruiting (Wickes et al. 1996). We have found that expression of a dominant-active form of the Ras1 protein, Q67L, triggers haploid filamentation in strain H99 in response to nitrogen limitation ( J. A. Alspaugh, L. M. Cavallo and J. Heitman, unpublished results). We have used this finding to demonstrate that the ste12 mutation blocks haploid fruiting in strain H99 (Figure 4). Complementary studies by Kwon-Chung and colleagues have revealed that the STE12a gene is similarly required for haploid fruiting in serotype D strains of C. neoformans (Y. Chang, B. L. Wickes and K. J. KwonChung, personal communication). These complemen-
tary findings reveal that STE12 is required for haploid fruiting. In contrast, the STE12 protein is absolutely required for mating in S. cerevisiae (Hartwell 1980), but only partially required for filamentous growth in either S. cerevisiae or C. albicans because of overlapping, redundant signaling pathways (Liu et al. 1993, 1994; Lo et al. 1997). This situation appears to be reversed in C. neoformans, in that the STE12a homolog is largely dispensable for mating, but required for filamentation. Furthermore, these observations suggest that monokaryotic fruiting is either a simpler linear signaling pathway, or that more than one signaling pathway is absolutely required for differentiation. Our genetic epistasis experiments provide further support for the hypothesis that STE12 is specialized to regulate filamentation, but not mating. Overexpression of STE12 restored haploid fruiting in mutant strains lacking the Gb protein GPB1, but did not restore mating
C. neoformans STE12a Homolog
Figure 9.—Role of STE12a in signaling pathways regulating C. neoformans mating, filamentation, and virulence. Signaling pathways that regulate C. neoformans responses to environmental signals are depicted. STE12 is required to regulate responses to nitrogen starvation and desiccation that trigger haploid filamentation and sporulation. Here, both the RAS1 protein and the MAP kinase cascade are depicted as signaling upstream of STE12. Haploid fruiting is also regulated by elements of the pheromone-activated MAP kinase cascade, including the G-protein b subunit GPB1. Mating is regulated by both pheromone and nutrients via pathways involving the Gb protein GPB1 and the Ga protein GPA1. STE12 plays only a modest role in regulating mating, which is indicated by a dashed line. Finally, the Ga protein GPA1 and cAMP regulate melanin and capsule production and virulence. By comparison, the ste12 mutation has only modest effects on capsule synthesis and is not required for virulence in two different animal models.
(Figure 5). Taken together, these findings suggest that STE12 regulates expression of genes necessary for haploid fruiting, but is either not required or is redundant with other factors that regulate mating-specific gene transcription. Finally, we found no virulence defect of the C. neoformans ste12 mutant strains in two animal models. The first model involves intrathecal inoculation of immunosuppressed rabbits, with recovery of CSF and quantitative yeast counts of CSF over a 2-wk course of infection. There was no difference in survival in the central nervous system between the wild-type STE12, the ste12 mutant, and the ste12 1 STE12 reconstituted strains. We also tested the ste12 mutant strain in a murine systemic infection model. In this case, with four different inoculum sizes over a range of four orders of magnitude and two different independent ste12 mutant strains, there was again no difference in the virulence of the ste12 mutant strains compared to either the STE12 wild-type or the ste12 1 STE12 reconstituted strains. These findings in the host are in accordance with our observations that the ste12 mutant strain has little or no defect with respect to most of the known or potential virulence factors of C. neoformans. The only exception was a modest reduction in the capsule size of ste12 mutant cells induced in vitro for capsule production or recovered from the CSF of infected rabbits. However,
1613
this subtle defect in capsule production did not impact on virulence in animal models. Similarly, differences in capsule size in nonisogenic strains was previously shown to not have an impact on virulence (Dykstra et al. 1977). We cannot exclude that in certain strains or serotypes in which capsule or other factors might be limiting for virulence, the ste12 mutation could have an impact on virulence, but even under these conditions, STE12 is unlikely to be a major determinant for virulence of C. neoformans. In C. albicans, mutations in the STE12 homolog Cph1 have only modest effects on virulence, whereas mutants lacking both Cph1 and the Phd1 homolog Efg1 are avirulent (Lo et al. 1997). Similar redundant signaling pathways may operate in C. neoformans. It has been suggested that filamentation and monokaryotic fruiting might be required for virulence. On the other hand, the pathogenic serotype A isolate H99 does not undergo haploid fruiting under a variety of different culture conditions and yet is fully virulent in rabbits inoculated intrathecally, or in mice inoculated intravenously or intratracheally (G. Huffnagle, personal communication). Thus, haploid fruiting may not be required for virulence. In addition, C. neoformans in the host is found virtually exclusively as budding yeast, and filamentous forms are rare (Alspaugh et al. 1999). In conclusion, our studies reveal that a conserved homolog of the STE12 transcription factor that regulates mating, filamentation, and virulence in S. cerevisiae and C. albicans plays a prominent role in regulating monokaryotic fruiting in response to nitrogen starvation in C. neoformans (Figure 9). Our epistasis analysis begins to delineate elements of a MAP kinase cascade that regulates STE12. Target genes regulated by STE12 remain to be identified. The finding that the STE12 homolog is specific to MATa cells and encoded by a novel region of the MATa locus was initially puzzling because it was not clear how MATa cells would mate without STE12. Our finding that the STE12a homolog is specialized to regulate the MATa-specific filamentation response and does not play a primary role in mating suggests that other transcription factors that regulate mating of both MATa and MATa cells remain to be discovered. For example, mating in C. neoformans may be regulated by a homolog of the Tec1 transcription factor (Gavrias et al. 1996; Madhani and Fink 1997), which regulates filamentous growth in conjunction with STE12 in S. cerevisiae, or the high mobility group (HMG) class transcription factors Ste11 and Prf1, which regulate mating in Schizosaccharomyces pombe and U. maydis (Sugimoto et al. 1991; Hartmann et al. 1996). Clearly, much remains to be learned from the signaling pathways that regulate differentiation, mating, and virulence of this important human pathogen, which cannot be directly inferred from studies of other yeast and fungal model systems. We thank M. Cristina Cruz and Maria Elena Cardenas for advice and
1614
C. Yue et al.
discussions, Cristl Arndt for technical assistance, June Kwon Chung for discussion of results before publication, Brian Wickes for the GAL7STE12 plasmid pCGS-1, and Rey Sia and Maria Elena Cardenas for comments on the manuscript. These studies were supported in part by R01 grants AI39115, AI41937, AI28388, and AI42159 ( J.P. and J.H.), P01 grant AI44975 to the Duke University Mycology Research Unit (G.C., J.P., and J.H.), and KO8 grant AI01556 ( J.A.A.), all from the National Institutes of Allergy and Infectious Diseases. Gary Cox is a Burroughs Wellcome New Investigator in Molecular Pathogenic Mycology. Joseph Heitman is an associate investigator of the Howard Hughes Medical Institute and a Burroughs Wellcome Scholar in Molecular Pathogenic Mycology.
LITERATURE CITED Alspaugh, J. A., J. R. Perfect and J. Heitman, 1997 Cryptococcus neoformans mating and virulence are regulated by the G-protein a subunit GPA1 and cAMP. Genes Dev. 11: 3206–3217. Alspaugh, J. A., J. R. Perfect and J. Heitman, 1998 Signal transduction pathways regulating differentiation and pathogenicity of Cryptococcus neoformans. Fungal Genet. Biol. 25: 1–14. Alspaugh, J. A., R. C. Davidson and J. Heitman, 1999 Morphogenesis of Cryptococcus neoformans, in Dimorphism in Human Pathogenic and Apathogenic Yeasts, edited by J. F. Ernst and A. Schmidt. Karger, Basel, Switzerland (in press). Banuett, F., 1998 Signalling in the yeasts: an informational cascade with links to the filamentous fungi. Microbiol. Mol. Biol. Rev. 62: 249–274. Casadevall, A., and J. R. Perfect, 1998 Cryptococcus neoformans. American Society for Microbiology, Washington, DC. Chen, S. C. A., M. Muller, J. Z. Zhou, L. C. Wright and T. C. Sorrell, 1997 Phospholipase activity in Cryptococcus neoformans: a new virulence factor? J. Infect. Dis. 175: 414–420. Cox, G. M., D. L. Toffaletti and J. R. Perfect, 1996 Dominant selection system for use in Cryptococcus neoformans. J. Med. Vet. Mycol. 34: 385–391. Del Poeta, M., D. L. Toffaletti, T. H. Rude, C. C. Dykstra, J. Heitman et al., 1999 Topoisomerase I is essential in Cryptococcus neoformans: role in pathobiology and as an antifungal target. Genetics 152: 167–178. Du¨rrenberger, F., K. Wong and J. W. Kronstad, 1998 Identification of a cAMP-dependent protein kinase catalytic subunit required for virulence and morphogenesis in Ustilago maydis. Proc. Natl. Acad. Sci. USA 95: 5684–5689. Dykstra, M. A., L. Friedman and J. W. Murphy, 1977 Capsule size of Cryptococcus neoformans: control and relationship to virulence. Infect. Immun. 16: 129–135. Gavrias, V., A. Andrianopoulos, C. J. Gimeno and W. W. Timberlake, 1996 Saccharomyces cerevisiae TEC1 is required for pseudohyphal growth. Mol. Microbiol. 19: 1255–1263. Gimeno, C. J., P. O. Ljungdahl, C. A. Styles and G. R. Fink, 1992 Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68: 1077–1090. Gold, S., G. Duncan, K. Barrett and J. Kronstad, 1994 cAMP regulates morphogenesis in the fungal pathogen Ustilago maydis. Genes Dev. 8: 2805–2816. Granger, D. L., J. R. Perfect and D. T. Durack, 1985 Virulence of Cryptococcus neoformans: regulation of capsule synthesis by carbon dioxide. J. Clin. Invest. 76: 508–516. Hartmann, H. A., R. Kahmann and M. Bolker, 1996 The pheromone response factor coordinates filamentous growth and pathogenicity in Ustilago maydis. EMBO J. 15: 1632–1641. Hartwell, L. H., 1980 Mutants of Saccharomyces cerevisiae unresponsive to cell division control by polypeptide mating hormone. J. Cell Biol. 85: 811–822. Kirkman-Correia, C., I. L. Stroke and S. Fields, 1993 Functional domains of the yeast STE12 protein, a pheromone-responsive transcriptional activator. Mol. Cell. Biol. 13: 3765–3772. Kronstad, J., A. D. Maria, D. Funnell, R. D. Laidlaw, N. Lee et al., 1998 Signaling via cAMP in fungi: interconnections with mitogen-activated protein kinase pathways. Arch. Microbiol. 170: 395–404. Kru¨ger, J., G. Loubradou, E. Regenfelder, A. Hartmann and R.
Kahmann, 1998 Crosstalk between cAMP and pheromone signaling pathways in Ustilago maydis. Mol. Gen. Genet. 260: 193–198. Kwon-Chung, K. J., 1975 A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197–1200. Kwon-Chung, K. J., 1976 Morphogenesis of Filobasidiella neoformans, the sexual state of Cryptococcus neoformans. Mycologia 68: 942–946. Kwon-Chung, K. J., and J. E. Bennett, 1978 Distribution of a and a mating types of Cryptococcus neoformans among natural and clinical isolates. Am. J. Epidemiol. 108: 337–340. Kwon-Chung, K. J., J. C. Edman and B. L. Wickes, 1992a Genetic association of mating types and virulence in Cryptococcus neoformans. Infect. Immun. 60: 602–605. Kwon-Chung, K. J., A. Varma, J. C. Edman and J. E. Bennett, 1992b Selection of ura5 and ura3 mutants from the two varieties of Cryptococcus neoformans on 5-fluoroorotic acid medium. J. Med. Vet. Mycol. 30: 61–69. Liu, H., C. A. Styles and G. R. Fink, 1993 Elements of the yeast pheromone response pathway required for filamentous growth of diploids. Science 262: 1741–1744. Liu, H., J. Ko¨hler and G. R. Fink, 1994 Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266: 1723–1726. Lo, H.-J., J. R. Kohler, B. DiDomenico, D. Loebenberg, A. Cacciapuoti et al., 1997 Nonfilamentous C. albicans mutants are avirulent. Cell 90: 939–949. Lodge, J. K., E. Jackson-Machelski, D. L. Toffaletti, J. R. Perfect and J. I. Gordon, 1994 Targeted gene replacement demonstrates that myristoyl-CoA:protein N-myristoyltransferase is essential for viability of Cryptococcus neoformans. Proc. Natl. Acad. Sci. USA 91: 12008–12012. Lorenz, M. C., and J. Heitman, 1997 Yeast pseudohyphal growth is regulated by GPA2, a G protein a homolog. EMBO J. 16: 7008–7018. Madhani, H. D., and G. R. Fink, 1997 Combinatorial control required for the specificity of yeast MAPK signaling. Science 275: 1314–1317. Moore, T. D. E., and J. C. Edman, 1993 The a-mating type locus of Cryptococcus neoformans contains a peptide pheromone gene. Mol. Cell. Biol. 13: 1962–1970. Neilson, J. B., R. A. Fromtling and G. S. Bulmer, 1977 Cryptococcus neoformans: size range of infectious particles from aerosolized soil. Infect. Immum. 17: 634–638. Odom, A., S. Muir, E. Lim, D. L. Toffaletti, J. Perfect et al., 1997 Calcineurin is required for virulence of Cryptococcus neoformans. EMBO J. 16: 2576–2589. Pan, X., and J. Heitman, 1999 Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae. Mol. Cell. Biol. 19: 4874–4887. Perfect, J. R., S. D. R. Lang and D. T. Durack, 1980 Chronic cryptococcal meningitis: a new experimental model in rabbits. Am. J. Pathol. 101: 177–194. Perfect, J. R., D. L. Toffaletti and T. H. Rude, 1993 The gene encoding phosphoribosylaminoimidazole carboxylase (ADE2) is essential for growth of Cryptococcus neoformans in cerebrospinal fluid. Infect. Immun. 61: 4446–4451. Pi, H., C.-T. Chien and S. Fields, 1997 Transcriptional activation upon pheromone stimulation mediated by a small domain of Saccharomyces cerevisiae Ste12p. Mol. Cell. Biol. 17: 6410–6418. Pitkin, J. W., D. G. Panaccione and J. D. Walton, 1996 A putative cyclic peptide efflux pump encoded by the TOXA gene of the plant-pathogenic fungus Cochliobolus carbonum. Microbiology 142: 1557–1565. Robertson, L. S., and G. R. Fink, 1998 The three yeast A kinases have specific signaling functions in pseudohyphal growth. Proc. Natl. Acad. Sci. USA 95: 13783–13787. Sambrook, J., E. F. Fritsch and T. Maniatis, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sherman, F., 1991 Getting started with yeast, pp. 3–21 in Methods in Enzymology, edited by C. Guthrie and G. R. Fink. Academic Press, San Diego, CA. Sugimoto, A., Y. Iino, T. Maeda, Y. Watanabe and M. Yamamoto, 1991 Schizosaccharomyces pombe ste111 encodes a transcription factor with an HMG motif that is a critical regulator of sexual development. Genes Dev. 5: 1990–1999. Toffaletti, D. L., T. H. Rude, S. A. Johnston, D. T. Durack and
C. neoformans STE12a Homolog J. R. Perfect, 1993 Gene transfer in Cryptococcus neoformans by use of biolistic delivery of DNA. J. Bacteriol. 175: 1405–1411. Vartivarian, S. E., E. J. Anaissie, R. E. Cowart, H. A. Sprigg, M. J. Tingler et al., 1993 Regulation of cryptococcal capsular polysaccharide by iron. J. Infect. Dis. 167: 186–190. Wickes, B. L., M. E. Mayorga, U. Edman and J. C. Edman, 1996 Dimorphism and haploid fruiting in Cryptococcus neoformans: association with the a-mating type. Proc. Natl. Acad. Sci. USA 93: 7327–7331. Wickes, B. L., U. Edman and J. C. Edman, 1997 The Cryptococcus neoformans STE12a gene: a putative Saccharomyces cerevisiae STE12
1615
homologue that is mating type specific. Mol. Microbiol. 26: 951– 960. Williamson, P. R., 1994 Biochemical and molecular characterization of the diphenol oxidase of Cryptococcus neoformans: identification as a laccase. J. Bacteriol. 176: 656–664. Yuan, Y. L., and S. Fields, 1991 Properties of the DNA-binding domain of the Saccharomyces cerevisiae STE12 protein. Mol. Cell. Biol. 11: 5910–5918. Communicating editor: A. P. Mitchell
