The study of apoptotic bifunctional effects in relationship between host ...

Parasitol Res (2012) 110:1979–1984 DOI 10.1007/s00436-011-2726-4

ORIGINAL PAPER

The study of apoptotic bifunctional effects in relationship between host and parasite in cystic echinococcosis: a new approach to suppression and survival of hydatid cyst Adel Spotin & Monireh Mokhtari Amir Majdi & Mojtaba Sankian & Abdolreza Varasteh

Received: 10 October 2011 / Accepted: 18 November 2011 / Published online: 14 December 2011 # Springer-Verlag 2011

Abstract Cystic echinococcosis (hydatidosis) is a zoonotic helminthic disease of human and other intermediated hosts wherein infection is caused by the larval stages of tapeworm Echinococcus granulosus. Growth of the larval stage is formed throughout the internal organs, the liver and lung, causing their destruction. Important pathways are unknown about suppression and survival of cysts in human body. In this study, apoptotic bifunctional effects are evaluated in relationship between host and parasite in cystic echinococcosis. Human lymphocytes were treated with hydatid fluid (HF). After 6 h of exposure, caspase-3 activity was measured by fluorometric assay in the HF-treated lymphocytes and control cells. Also, the expression of Bax (as proThe manuscript was presented at the 17. ULUSAL PARAZİTOLOJİ KONGRES in Kars University, Turkey, for poster presentation on 4–7 July 2011. A. Spotin (*) Department of Parasitology and Mycology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran e-mail: [email protected] M. M. A. Majdi Department of Parasitology and Mycology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran e-mail: [email protected] M. Sankian : A. Varasteh Immunobiochemistry Laboratory, Immunology Research Center, Bu-Ali research Institute, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran M. Sankian e-mail: [email protected] A. Varasteh e-mail: [email protected]

apoptotic protein) and Bcl-2 (an anti-apoptotic protein) mRNA was assessed by semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR) after 12 h of exposure. For surveying of apoptosis-inducing ligands TNF-related apoptosis-inducing ligand and Fas-L, germinal layer and accompaniment peripheral tissues as healthy control were separated by scalpel from each cyst in sterile condition, then were assess by semiquantitative RT-PCR method in mRNA expression. Both the ratio of Bax/Bcl-2 mRNA expression and caspase-3 activity were higher in the fertile fluid-treated lymphocytes relative to infertile fluidtreated lymphocytes and control group versus the expression level of apoptosis-inducing ligands having a relatively high level in germinal layer of infertile cyst in comparison to fertile cyst and healthy tissue. Apoptosis of germinal layer of fertile cysts is possibly one of the suppression mechanisms in hydatidosis patients, in contrast to lymphocytes apoptosis by modulator of hydatid fluid, one of the hydatid cyst survival mechanisms.

Introduction Cystic echinococcosis is a zoonotic infection with high prevalence in parts of Africa, South America, Eurasia, Australia, Middle East, and especially in Iran (Sadjjadi 2006). Cystic echinococcosis caused by Echinococcus spp. is considered hyperendemic (northern part) and endemic (southern part) in Iran (Rokni 2009). Human hydatidosis from Iran is approximately 1% of the admission to surgical wards and the rate of human infection is 0.6–1.2/100,000 (Tavakoli et al. 2008). Dogs play a key role in the transition of the hydatidosis. Risk factors include contact with dog, geophagy, eating vegetables, and contact with sheep. Additionally, potential source of infection is carrot juice that nearly in

1980

every place is sold in combination with ice cream (Rokni 2008). The hydatid cyst layers from inner to outer are composed an inner cellular germinal layer that is supported by a chitin-like non-cellular laminated layer that is surrounded by a host-produced fibrous layer (Bortoletti and Ferretti 1978; Martinez et al. 2005). Oncospheres hatching from eggs migrate to the liver and several organs of the intermediate hosts such as man and developed into hydatid cysts in a few weeks. The hydatid cyst secretes immunomodulatory molecules (AgB, Ag5, HSP70, and cyclophilin) to the host's immune system (Margutti et al. 1999; Ortona et al. 2001). By identifying these molecules, we can understand the mechanisms that Echinococcus granulosus uses for increasing the survival and persistency of hydatid cyst in the host body. Hydatid cyst can have as long as 53 years in humans (Spruance 1974). These molecules modulate both the innate response such as apoptosis, inflammasome pathways, Toll-like receptors, and adaptive immune response and appear to target cellular and humoral responses. E. granulosus could use two mechanisms to destroy the host immune response. The first mechanism is inactive escape, by developing into a hydatid cyst, which prevents the damaging effects of an immune response, and secondary mechanism is immunomodulation, through which the parasite actively interacts with the host immune system to decrease the effect of a host response. For example, elastase inhibitor in the cyst fluid and possibly apoptosis of host immune cells are some of the survival mechanisms (Shepherd et al. 1991). Disastrous event caused by parasitic infections often occur as a result of tissue damage that results from a form of host cell death known as apoptosis (Negoescu et al. 1996). However, instead of being pathogenic, parasite-induced apoptosis may make survival easy. As a result, it is of highest importance to decode and understand the process and the role of apoptosis induced or monitored by parasites in humans (Conchedda et al. 2004). In spite of this, several studies provide definitive awareness of parasite-induced host cell apoptosis (Paredes et al. 2006; Cabrera et al. 2008). Apoptosis is a type of programmed cell death that can be characterized biochemically and morphologically. These changes include blebbing, cell shrinkage, nuclear fragmentation, chromatin condensation, and chromosomal DNA fragmentation (Wyllie 1997). Central enzyme of apoptosis cascade is a proteolytic system involving a family of proteases called caspase. Apoptosis is a progressively preserved pathway that in its basic principle appears to be operative in all metazoans (Kroemer et al. 1997). Apoptosis is characterized by mitochondrial (intracellular) pathway and death receptor (extracellular) pathway. In mitochondrial pathway, several factors play role in apoptosis. The first is Bcl-2 family, a set of cytoplasmic proteins members that regulate apoptosis in this family, the most considerable components are Bcl-2 and Bax proteins. While Bcl-2

Parasitol Res (2012) 110:1979–1984

proteins inhibit apoptosis, Bax counteracts (Kroemer 1997) this, in contrast to in death receptor pathway Fas (APO1/ CD95) and its ligand (FasL, CD95 ligand) are type I and type II transmembrane proteins and members of the tumor necrosis factor/nerve growth factor receptor and tumor necrosis factor families of proteins, respectively, also TNF-related apoptosis-inducing ligand (TRAIL) is a protein functioning as a ligand that induces the process of cell death called apoptosis. TRAIL has also been designated CD253 (Ashkenazi and Dixit 1998). Furthermore, some studies evaluated the effect of E. granulosus hydatid fluid on the lymphocytes in 3-day cultures of the T cell line and suggested that the cytotoxicity of hydatid fluid could have resulted from cell cycle arrest (Macintyre et al. 2000). Programmed cell death may be a cellular mechanism underlying hydatid cyst infertility (Paredes et al. 2006). On the other hand, molecules involved in DNA repair in the germinal layer of fertile hydatid cysts and in protoscoleces, such as EgRAD9, may allow preserving the fertility of hydatid cysts present (Cabrera et al. 2008). Gamma irradiation against Taenia solium larval stage provided document of the event of apoptosis and helped to clarify mechanisms that would be involved when gamma irradiation holds back the normal development of the T. solium larval stage into adult worm (Flores-Perez et al. 2003). The aim of this study was to assess the in vitro apoptotic features of hydatid fluid on human lymphocytes treated with hydatid fluid by evaluating the expression levels of Bcl-2, Bax mRNA as well as the caspase-3 activity as central enzyme in the apoptosis cascade and surveying of apoptosis-inducing ligands, TRAIL and Fas-L germinal and accompaniment peripheral tissues as healthy control.

Materials and methods Hydatid cysts and protoscoleces This study was done in Medical Mycoparasitology laboratory and Bu Ali Research Institute of Mashhad University of Medical Science, Iran, 2008. Four human hydatid cysts (two fertile cysts and two infertile cysts) were excised from the lower lobe of the lungs and spleen. Fertile cysts were characterized by the presence of free protoscoleces in the hydatid fluid and the growing protoscoleces attached to the germinal layer. The infertile cysts do not have these protoscoleces. The viability of protoscoleces was demonstrated by vital staining such as eosin. After diagnosis by clinical examination and imaging techniques, hydatid cysts were surgically removed in an unruptured aseptic condition and hydatid fluid were aspirated by syringe and stored at −70°C for further analysis. Then for studies on Fas-L and TRAIL (as induced apoptotic molecules), the germinal and adjacent

Parasitol Res (2012) 110:1979–1984

1981

normal tissue were dissected by scalpels and stored at −70°C in sterile vials. Cell culture and hydatid fluid-treated lymphocyte Lymphocytes were separated from 20 ml blood sample of a healthy control by Ficoll–Hypaque gradient centrifugation method (Kalmar et al. 1988). Monocytes were removed by adhesion to plastic flasks in a RPMI-1640 medium in pH 7.4 at 37°C, humidified atmosphere of 5% CO2 for 2 h. Lymphocytes were removed and counted in a hemacytometer after staining with trypan blue dye. Lymphocytes (1–2×106 cells/well) were cultured on a 24-well plate, containing 1 ml of 15% heat-inactived fetal bovine serum and RPMI-1640 medium in pH 7.4 at 37°C, in a humidified atmosphere of 5% CO2 for 24 h. The viability of the cells was checked again as before. After verification of the cell viability, different volumes of hydatid fluid including 25 μl, 50 μl, 100 μl, 150 μl, and 200 μl were added to each well containing 1.8 ml media, respectively. Finally, 200 μl of hydatid fluid (fertile and infertile) as inducer lymphocyte (optimum volume) were added to each well containing 1.8-ml media. Additional wells without hydatid fluid (HF) were used as cell controls to compare with HF-treated lymphocytes. Optimum volumes were determined with observation of HFtreated lymphocytes by inverted microscope after 12 h. Inverted microscope revealed that 200 μl of hydatid fluid was the optimum volume for lymphocyte shrinkage and apoptotic body formation. The exposure time to hydatid fluid for evaluation of caspase-3 activity and the mRNA expression levels of Bax and Bcl-2 genes was previously shown (Jafari et al. 2009). Detection of caspase-3 activity After 6 h of exposure to hydatid fluid, lymphocytes were separated by centrifugation at 10,000g for 1 min. Caspase-3 activity was determined by the Caspase-3/CPP32 Fluorometric Assay Kit (K105) (Biovision Inc., Mountain View,

Table 1 Primers used for RT-PCR of Bcl-2, Bax, TRAIL, Fas-L, and GAPDH

CA, USA) as manufacturer's manual. Activity was measured by a Fluorometer (Jasco, FP-6200, Japan), as enzyme activity converts a blue emission (λ0404 nm) to a yellowgreen color (λ0505 nm). Intensity was defined per milligram of total protein contents of the solubilized cells (according to total protein assessment, measured by spectrophotometer (λ0280 nm)). Isolation of total RNA and synthesis of cDNA After homogenization of germinal layer, adjacent normal tissue and lymphocytes-treated hydatid fluid RNA were isolated using TriPure Isolation Reagent (Roche, Germany) according to the manufacturer instructions. Total RNA was reverse transcribed (RT) into cDNA with MBI RevertAid (Fermentase, Life Sciences, Lithuanian) according to the manufacturer's instructions, and cDNA samples were stored at −20°C. RT-PCR A semi quantitative reverse transcriptase polymerase chain reaction (RT-PCR) was performed to determine the levels of Bcl-2, Bax, Fas-L, and TRAIL mRNA expressions. Total RNA was RT into cDNA using MBI Revert Aid (Fermentase, LifeSciences, Lithuania). The RT-PCR was carried out in a 20-μl reaction volume containing 0.5 μL of cDNA, 1.5 mM of Mgcl2, 125 μM of dNTP, 0.1 U/μl, and 0.5 pmol of specific primers. All the primers used in RT-PCR were designed by Gen Runner & Primer Premier Software (Table 1). Glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA was used as housekeeping genes (internal control) to normalized the amount of mRNA in each sample. The samples were denaturized for 5 min at 95°C and amplified using 35 cycles of 95°C for 30 s, 60°C for 80 s, and72°C for 45 s for Bcl-2, Bax, Fas-L, and TRAIL genes followed by a final elongation at 72°C for 3 min on a Corbett Research thermocycler (Sydney, Australia). The optimal numbers of cycles were selected for amplification

Genes

Primers

Product size

Bcl-2

F: 5′CATGTGTGTGGAGAGCGTCAAC3′ R: 5′CAGATAGGCACCCAGGGTGAT3′ F: 5′TTTGCTTCAGGGTTTCATCCA3′ R: 5′CTCCATGTTACTGTCCAGTTCGT3′ F: 5′GCTGATCGTGATCTTCACAGTG3′ R: 5′TGGAGTTTGGAGAAGACAATGTG3′ F: 5′TCTTCCCTGTCCAACCTCTGTG3′ R: 5′ATCTGGCTGGTAAGACTCTCGGA3′ F: 5′GGCCAAGATCATCCATGACAACT3′ R: 5′ACCAGGACATGAGCTGACAAAGT3′

241 bp

Bax TRAIL Fas-L GAPDH

151 bp 376 bp 276 bp 500 bp

1982

Parasitol Res (2012) 110:1979–1984

of all genes experimentally, to be sure that the reactions were in the exponential range of amplification. Five microliters of the amplification product was analyzed by electrophoreses on a 2% ethidium-stained agarose gel and documented by a gel documentation system (Syngene, UK). Quantifications of the PCR band intensities were accomplished by Kodak 1D (USA) image analysis software (Eastman Kodak Co). The band intensities were normalized by the value obtained from the GAPDH mRNA. Statistical analysis Data were analyzed by Wilcoxon signed rank test using GraphPad-Prism-5 software.

Results

Caspase-3 Activity(Intensity/mg)

The results of Caspase-3/CPP32 fluorometric assay in Fig. 1 show that caspase-3 activity was significantly higher in the fertile HF-treated lymphocytes compared to both infertile HF-treated lymphocytes and cell control. Assessment of Bax and Bcl-2 expressions in fertile HF-treated lymphocytes compared with both infertile HF-treated and control lymphocytes was considered as significant with P value of 0.0625. As shown in Fig. 2, expression of the Bax mRNA was significantly increased (P00.0511) in fertile HF-treated lymphocytes compared with both infertile HF-treated and control lymphocytes while the expression of the Bcl-2 mRNA in fertile HF-treated lymphocytes was significantly decreased relative to both infertile HF-treated and control lymphocytes (P00.0719). Moreover, the Bax/Bcl-2 ratio

200 150 100 50

ol on

oc

el

d

C

m Ly

lc

ph

oc ph m Ly

te

d

ea

te

FTr

ea Tr

H

F-

ile

H

In

fe

rt

e rt il Fe

tr

yt

yt e

e

0

Fig. 1 Evaluation of Caspase-3 activity in cell extracts. Caspase-3 activity in fertile HF-treated lymphocytes, infertile HF-treated lymphocytes, and cell control (from left to right). Bar graph indicates the mean±SEM. Increase in caspase-3 activity was determined by comparing fluorescence of 7-amino-4-trifluoromethyl coumarin in control with HF-treated lymphocytes

Fig. 2 Expression of Bax and Bcl-2 genes at mRNA level. Semiquantitative RT-PCR analysis of Bax and Bcl-2 expressions in fertile HFtreated lymphocytes, infertile HF-treated lymphocytes, and cell control (from left to right). Gluceraldehydes-3-phosphate dehydrogenase (GAPDH) gene was used as a housekeeping gene. The density of the labeled bands for amplified products of Bax gene (151 bp) and Bcl-2 gene (241 bp) as well as GAPDH gene (500 bp) is shown in each group

was increased in fertile HF-treated lymphocytes compared to both infertile HF-treated and control lymphocytes (Fig. 3). As shown in Figs. 4 and 5, expression of the TRAIL and Fas-L mRNA was significantly increased (P0 0.0521) in infertile cyst compared with both fertile cyst and healthy tissue.

Discussion Until this moment, a few studies had been described in apoptosis of E. granulosus in relationship between hydatid cyst and host (Paredes et al. 2006; Cabrera et al. 2008; Hanhua et al. 2011). Programmed cell death in a Cestoda such as E. granulosus should be anticipated. Actually, it has been proposed that apoptosis apparently happen in normal flatworms also during tissue regeneration, and playing as a key role in regulating cell number, in terminating inessential cells or tissues, and in rebuilding the old tissues of body parts (Hwang et al. 2004). We suggest that apoptosis plays a different role in E. granulosus, fundamentally, by adjusting the production of immunogenic antigens such as AgB, Ag5 (Mamuti et al. 2006) that lead to the suppression of lymphocytes and the other hand by apoptosis of germinal layer by host-related immunomodulators. Interestingly, our results show that the germinal layer of infertile cysts displays apoptotic molecules (TRAIL, Fas-L) as measured by RTPCR that are one order of size higher than those observed in the germinal layer of fertile cysts and healthy tissue. Other study have demonstrated that analysis of DNA fragmentation and caspase-3 activity in germinal layer were higher levels of apoptosis in infertile cysts as compared to fertile cysts and suggested that apoptosis as a possible mechanism of infertility in hydatid cysts (Paredes et al. 2006). Studies in Cysticercus cellulosae larvae have shown that 0.3 kGy of radiation induce both TUNEL positive reaction and the model of DNA laddering, so suggesting that these results

til e In fe r

Fig. 3 Ratio of Bax/Bcl-2 Expression at mRNA level. Bax/Bcl-2 expression ratio in fertile HF-treated lymphocytes compared to infertile HF-treated lymphocytes and cell control. Bar graph indicates the mean±SEM

exhibit that irradiation restrain normal growth from the larval to the adult stage, by inducing apoptosis (Flores-Perez et al. 2003). The study about drug-induced apoptosis of E. granulosus protoscoleces had shown that Dexamethasone and H2O2 can induce the cell apoptosis of protoscoleces. These founding hinted the existence of a CED-3-like apoptosis gene in protoscolces and supply more surveying the induction of apoptosis as nonsurgical treatment technique in treating hydatid cyst (Hanhua et al. 2011). On the other hand, we showed that both the ratio of Bax/Bcl-2 mRNA expressions and caspase-3 activity were higher in the fertile hydatid fluid-treated lymphocytes relative to infertile hydatid fluid and control group. This could have been resulted from the presence of protoscoleces in the cysts, which may release inducer of apoptosis. Another study demonstrated that protoscoleces had no cytotoxic effect on the macrophages, although in that study, it was suggested that some toxic substances are probably secreted by protoscoleces, which induce reduction in the viability of the macrophages

Fig. 4 Expression of Fas-L and TRAIL genes at mRNA level. Semiquantitative RT-PCR analysis of Fas-L and TRAIL expressions in fertile cyst, infertile cyst, and healthy tissue as control (from left to right). Gluceraldehydes-3-phosphate dehydrogenase (GAPDH) gene was used as a housekeeping gene. The density of the labeled bands for amplified products of Fas-L gene (276 bp) and TRAIL gene (376 bp) as well as GAPDH gene (500 bp) is shown in each group

10

5

tr ol

C ys rt ie Fe

C on

t

tl

0 C ys

lc el C

H

FTr e

FTr e

at ed

at ed

Ly m

Ly m

ph oc y

ph oc y

on tr ol

te

0

15

In fe ril e

5

Expression of TAIL and Fas-L

10

H til e Fe r

1983

15

te

Ratio of Bax/Bcl-2Expression

Parasitol Res (2012) 110:1979–1984

Fig. 5 Expression of Fas-L and TRAIL genes at mRNA level. Expression of Fas-L and TRAIL in infertile cyst compared to fertile cyst and control (healthy tissue) (from left to right).Bar graph indicates the mean±SEM

in vitro (Janssen et al. 1993). In consistent with our results, hydatid fluid could induce T cell mitosis with enhanced membrane expression of CD25 and CD38 on human peripheral blood lymphoblasts and decreased that of CD28 and reduce costimulation with subsequent T cell anergy or apoptosis (Macintyre et al. 2000). Studies demonstrated that C. cellulosae larvae induce apoptosis in CD4+ lymphocytes by excretion/secretion products including caspases (Tato et al. 2004). Cells of the innate immune (macrophages, apoptosis, inflammasome molecules, and Toll-like receptors) which resided in the fibrous layer are unable to pass into the germinal layer because of the natural barrier enforced by the laminar layer. In another study, apoptosis is played as an important mechanism of CD4+ T cell death in experimental alveolar echinococcosis as apoptosis level of CD4+ and CD8+ T cells was significantly higher after the infection (Li et al. 2003). Some studies show that the presence of the innate immune cells at the fibrous layer, chiefly macrophages, could be connected to the release of reactive oxygen species and reactive nitrogen species (Werling et al. 2006), which could provoke infertility and death of the hydatid cysts (Shepherd et al. 1991; Rigano et al.1995; Vuitton 2003). Subset analysis of lymphocytes in skindraining lymph nodes showed that the schistosomula induce apoptosis of CD4+ and CD8+ T cells, but not B cells. Soluble antigen extracted from Schistosoma mansoni eggs can modulate the host's immune response by inducing apoptosis in T cells schistosomiasis patients, therefore determining clinical disease (Carneiro-Santos et al. 2000). In conclusion, this study described apoptotic bifunctional mechanisms in relationship between hydatid cyst and host's immune response. The results of this study representing human lymphocytes apoptosis by hydatid fluid immunomodulators (with increasing of Bax/Bcl-2 ratio and caspase-3 in fertile cyst in compared to both of the infertile cyst and cell control) and apoptosis of germinal layer (with increasing of TRAIL, Fas-L in infertile cyst in compared to both of the

1984

fertile cyst and healthy tissue) by host response are considered as one of the suppression and survival mechanisms of hydatid cyst, respectively. Acknowledgments This study was conducted and financially supported by Mashhad University of Medical Sciences. This article is derived from the master's thesis of the first author (Thesis no. A-247). We thank Dr. Esmaeeli for the statistical consults. In addition, we thank all the staff of Ghaem Hospital Mycoparasitology lab and Bu-Ali Research Center Immunobiochemistry Lab for their cooperation. Conflicts of interest The authors declare that there is no conflict of interests.

References Ashkenazi A, Dixit VM (1998) Death receptors: signaling and modulation. Science 281:1305–1308 Bortoletti G, Ferretti G (1978) Ultrastructural aspects of fertile and sterile cysts of Echinococcus granulosus developed in hosts of different species. Int J Parasitol 8:421–431 Cabrera G, Cabrejos ME, Morassutti AL, Cabezon C, Orellana J, Hellman U, Zaha A, Galanti N (2008) DNA damage, RAD9 and fertility/infertility of Echinococcus granulosus hydatid cysts. J Cell Physiol 216:498–506 Carneiro-Santos P, Martins-Filho O, ves-Oliveira LF, Silveira AM, Coura-Filho P, Viana IR, Wilson RA, Correa-Oliveira R (2000) Apoptosis: a mechanism of immunoregulation during human Schistosomiasis mansoni. Parasite Immunol 22:267–277 Conchedda M, Gabriele E, Bortoletti G (2004) Immunobiology of cystic echinococcosis. Parassitologia 46:375–380 Flores-Perez I, Fragoso GG, Sciutto E, de Aluja AS (2003) Apoptosis induced by gamma irradiation of Taenia solium metacestodes. Parasitol Res 90:203–208 Hanhua Hu, Kang J, Chen R, Mamuti W, Guizhen Wu, Yuan W (2011) Drug-induced apoptosis of Echinococcus granulosus protoscoleces. Parasitol Res 11:2276–2279 Hwang JS, Kobayashi C, Agata K, Ikeo K, Gojobori T (2004) Detection of apoptosis during planarian regeneration by the expression of apoptosis-related genes and TUNEL assay. Gene 333:15–25 Jafari AI, Sankian M, Ahmadpour Sh, Varasteh A, Haghir H (2009) Evaluation of Bcl-2 family gene expression and caspase-3 activity in hippocampus STZ induced diabetic rats. Cell Mol Neurobiol 29:133–140 Janssen D, De Rycke PH, Osuna A (1993) Dose-dependent effects of hydatid fluid toxins from Echinococcus granulosus on mouse peritoneal macrophages. Folia Parasitol 40:109–113 Kalmar JR, ArnoldR R, Warbington ML, Gardner MK (1988) Superior leukocyte separation with a discontinuous one-step FicollHypaque gradient for the isolation of human neutrophils. J Immunol Methods 110:275–281 Kroemer G (1997) The proto-oncogene Bcl-2 and its role in regulating apoptosis. Nat Med 3:614–620 Kroemer G, Zamzami N, Susin SA (1997) Mitochondrial control of apoptosis. Immunol Today 18:44–51 Li FR, Shi YE, Shi DZ, Vuitton DA, Craig PS (2003) Study on CD4+ cells deletion mechanism in experimental alveolar echinococcosis.

Parasitol Res (2012) 110:1979–1984 Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 21:197–202 Macintyre AR, Dixon JB, Bleakley JS, Green JR (2000) Echinococcus granulosus: assays for hydatid immunoregulatory factors using established lymphoid cell lines. Parasite Immunol 22:475–485 Mamuti W, Sako Y, Nakao M, Xiao N, Nakaya K, Ishikawa Y, Yamasaki H, Lightowlers MW, Ito A (2006) Recent advances in characterization of Echinococcus antigen B. Parasitol Int 55:57– 62 Margutti P, Ortona E, Vaccari S, Barca S, Rigano R, Teggi A, Muhschlegel F, Frosch M, Siracusano A (1999) Cloning and expression of a cDNA encoding an elongation factor 1b/d protein from Echinococcus granulosus with immunogenic activity. Parasite Immunol 21:485–492 Martinez C, Paredes R, Stock RP, Saralegui A, Andreu M, Cabezon C, Ehrlich R, Galanti N (2005) Cellular organization and appearance of differentiated structures in developing stages of the parasitic platyhelminth Echinococcus granulosus. J Cell Biochem 94:327– 335 Negoescu A, Lorimier P, Labat-Moleur F, Drouet C, Robert C, Guillermet C, Brambilla C, Brambilla E (1996) In situ apoptotic cell labeling by the TUNEL method: improvement and evaluation on cell preparations. J Histochem Cytochem 44:959–968 Ortona E, Margutti P, Vaccari S, Rigano R, Profumo E, Buttari B, Chersi A, Teggi A, Siracusano A (2001) Elongation factor 1 beta/delta of Echinococcus granulosus and allergic manifestations in human cystic echinococcosis. Clin Exp Immunol 125:110–116 Paredes R, Jiménez V, Cabrera G, Iragüen D, Galanti N (2006) Apoptosis as a possible mechanism of infertility in Echinococcus granulosus hydatid cysts. J Cell Biochem 100:1200–1209 Rigano R, Profumo E, Ioppolo S, Notargiacomo S, Ortona E, Teggi A, Siracusano A (1995) Immunological markers indicating the effectiveness of pharmacological treatment in human hydatid disease. Clin Exp Immunol 102:281–285 Rokni MB (2008) The present status of human helminthic diseases in Iran. Ann Trop Med Parasitol 102:283–295 Rokni MB (2009) Echinococcosis/hydatidosis in Iran. Iranian J Parasitol 4:1–16 Sadjjadi SM (2006) Present situation of echinococcosis in the Middle East and Arabic North Africa. Parasitol Int 55:197–202 Shepherd JC, Aitken A, McManus DP (1991) A protein secreted in vivo by Echinococcus granulosus inhibits elastase activity and neutrophil chemotaxis. Mol Biochem Parasitol 44:81–90 Spruance SL (1974) Latent period of 53 years in a case of hydatid cyst disease. Arch Intern Med 134:741–742 Tato P, Fernandez AM, Solano S, Borgonio V, Garrido E, Sepulveda J, Molinari JL (2004) A cysteine protease from Taenia solium metacestodes induce apoptosis in human CD4+ T-cells. Parasitol Res 92:197–204 Tavakoli HR, Bahonar AR, Jonidi NA (2008) Epidemiology of hydatidosis in Iran during 2002–2006. Iranian J Infectious Diseases Tropical Med 13:67–71 Vuitton DA (2003) The ambiguous role of immunity in echinococcosis: protection of the host or of the parasite? Acta Trop 85:119– 132 Werling D, Piercy J, Coffey TJ (2006) Expression of TOLL-like receptors (TLR) by bovine antigen-presenting cells-potential role in pathogen discrimination? Vet Immunol Immunopathol 112:2–11 Wyllie AH (1997) Apoptosis: an overview. British Med Bulletin 53:451–465