Plant Mol Biol (2014) 85:627–638 DOI 10.1007/s11103-014-0207-8
The transcriptional response of apple alcohol acyltransferase (MdAAT2) to salicylic acid and ethylene is mediated through two apple MYB TFs in transgenic tobacco Peng-Cheng Li · Shao-Wei Yu · Jin Shen · Qing-Qing Li · Da-Peng Li · De-Quan Li · Cheng-Chao Zheng · Huai-Rui Shu
Received: 15 February 2014 / Accepted: 27 May 2014 / Published online: 4 June 2014 © Springer Science+Business Media Dordrecht 2014
Abstract Volatile esters are major factors affecting the aroma of apple fruits, and alcohol acyltransferases (AATs) are key enzymes involved in the last steps of ester biosynthesis. The expression of apple AAT (MdAAT2) is known to be induced by salicylic acid (SA) or ethylene in apple fruits, although the mechanism of its transcriptional regulation remains elusive. In this study, we reveal that two apple transcription factors (TFs), MdMYB1 and MdMYB6, are involved in MdAAT2 promoter response to SA and ethylene in transgenic tobacco. According to electrophoretic mobility shift assays, MdMYB1 or MdMYB6 can directly bind in vitro to MYB binding sites in the MdAAT2 promoter. In vivo, overexpression of the two MYB TFs can greatly enhance MdAAT2 promoter activity, as demonstrated by dual luciferase reporter assays in transgenic tobacco. In contrast to the promoter of MdMYB1 or MdMYB6, the MdAAT2 promoter cannot be induced by SA or ethephon (ETH) in transgenic tobacco, even in stigmas in which the MdAAT2 promoter can be highly induced under normal Electronic supplementary material The online version of this article (doi:10.1007/s11103-014-0207-8) contains supplementary material, which is available to authorized users. P.-C. Li · S.-W. Yu · Q.-Q. Li · D.-Q. Li · C.-C. Zheng State Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, Tai’an 271018, Shandong, People’s Republic of China J. Shen · D.-P. Li (*) College of Food Sciences, Shandong Agricultural University, Tai’an 271018, Shandong, People’s Republic of China e-mail:
[email protected] H.-R. Shu National Research Center for Apple Engineering and Technology, College of Horticulture Sciences, Shandong Agricultural University, Tai’an 271018, Shandong, People’s Republic of China
conditions. However, the induced MYB TFs can dramatically enhance MdAAT2 promoter activity under SA or ETH treatment. We conclude that MdMYB1 and MdMYB6 function in MdAAT2 responses to SA and ethylene in transgenic tobacco, suggesting that a similar regulation mechanism may exist in apple. Keywords Alcohol acyltransferase · Hormone response · Salicylic acid · Ethylene
Introduction Volatile compounds, including alcohols, aldehydes, ketones, sesquiterpenes and esters, represent important components of plant metabolites and are key factors affecting the aroma, flavor, quality and consumer acceptance of fruits. Esters, which are derived from amino acids and fatty acids, are important components of volatile blends (Aharoni et al. 2000; Beekwilder et al. 2004; Lewinsohn et al. 2001; Li et al. 2006b; Sanchez et al. 2012), and some ester compounds are genetically regulated and stable in apple in different environments (Costa et al. 2013; Dunemann et al. 2009). Alcohol acyltransferases (AATs), members of the BAHD superfamily (St-Pierre and Luca 2000), are involved in the last step of the ester biosynthesis pathway, which involves transacylation from an acyl-CoA to an alcohol (Aharoni et al. 2000). In recent years, many fruit AAT genes have been isolated and characterized from strawberry (Aharoni et al. 2000), banana (Beekwilder et al. 2004), melon (El-Sharkawy et al. 2005; Yahyaoui et al. 2002), grape (Wang and De Luca 2005), apple (Li et al. 2006a; Souleyre et al. 2005), apricot (Gonzalez-Aguero et al. 2009), papaya (Balbontin et al. 2010), peach (Zhang et al. 2010) and kiwifruit (Gunther et al. 2011). Using
13
628
QTL mapping technology, MdAAT1 was identified as an important regulator associated with key apple esters. Additionally, 17 putative AAT genes were found in the Golden Delicious apple genome, although their roles in ester production remain unknown (Dunemann et al. 2012). Ester synthesis is most commonly associated with fruit ripening, a process that is regulated by ethylene. In apple, the activity and gene expression of AAT is highly regulated by ethylene (Defilippi et al. 2005). In mountain papaya, high levels of VpAAT1 transcripts accumulate in fruit tissues during ripening or following induction by ethylene (Balbontin et al. 2010). Transcriptional levels of AAT contigs are undetectable in a 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase RNAi line of kiwifruit, which does not produce climacteric ethylene (Atkinson et al. 2011; Gunther et al. 2011). In addition, the production of volatile esters is largely reduced in ACC oxidase antisensetransgenic apple and melon fruits (Bauchot et al. 1998; Dandekari et al. 2004). Schaffer et al. (2007) also showed that the final enzymatic steps are important for transcriptional regulation and are predominantly controlled by ethylene during aroma production in apple. Furthermore, several studies have reported that volatile esters can also be induced by herbivores, mechanical damage and pathogens (D’Auria et al. 2007; Engelberth et al. 2004; Mithofer et al. 2005; Nimitkeatkai et al. 2011). Salicylic acid (SA) has been identified as a vital plant hormone that is involved in diverse defense responses against biotic and abiotic stresses. In a previous study, the regeneration of esters was induced by SA treatment in apple fruits after long-term cold storage, suggesting that SA might also be involved in the regulation of ester production in apple (Li et al. 2006b). Intriguingly, transcription of the gene encoding alcohol acyltransferase (MdAAT2) is significantly induced by exogenous ethephon (ETH) and SA in apple (Li et al. 2006a). These results suggest that ethylene and SA play major roles in regulating volatile ester biosynthesis. However, limited data regarding the mechanisms of transcriptional regulation are available. The ethylene and SA hormone signaling pathways are complicated regulatory networks in plants (Chang et al. 1993; Schaller and Bleecker 1995; Vlot et al. 2009). In these pathways, transcription factors (TFs) are the key molecules in the downstream response reactions involving in a series of physiological and biochemical reactions. The MYB family contains large and functionally diverse TFs that are key factors in the regulatory networks controlling development and metabolism in plant. Some MYB transcription factors in grape (Vitis vinifera), such as VvMYBA1, VvMYBA2, VvMYBPA1, VvMYB5a and VvMYB5b, are involved in a broad range of functions associated with anthocyanin biosynthesis during fruit development and ripening (Deluc et al. 2008). In strawberry (Fragaria ananassa) fruits,
13
Plant Mol Biol (2014) 85:627–638
FaMYB9/FaMYB11, FabHLH3 and FaTTG1 may act as functional homologs of AtTT2, AtTT8 and AtTTG1 and may form a ternary protein complex to induce the expression of genes necessary for proanthocyanidin biosynthesis in Arabidopsis (Schaart et al. 2013). ODORANT1, a member of the R2R3-type MYB family, is a key regulator of floral scent biosynthesis in Petunia flowers (Verdonk et al. 2005), and AtMYB103 plays an important role in tapetum development, callose dissolution and exine formation in Arabidopsis anthers (Zhang et al. 2007). Although 428 genes have been shown to be members of the MYB TF family in ‘Golden Delicious’ apple (Velasco et al. 2010), most of their functions have yet to be identified. The majority of previous studies investigating MYB TFs in apple have focused on their involvement in anthocyanin biosynthesis, e.g., MdMYB10 (Chagne et al. 2007; Espley et al. 2007, 2009), which also enhances plant tolerance to osmotic stress in transgenic Arabidopsis (Gao et al. 2011b). However, whether MYB TFs are regulated during ester production, which represents another major series of physiological and biochemical reactions during apple fruit ripening, has yet to be fully elucidated. We have previously performed a correlation analysis by semi-quantitative RT-PCR comparing the expression of two MYB transcription factors and MdAAT2. These data suggested that MdMYB1 and MdMYB6 could be important for the expression of MdAAT2 in the ‘Golden Delicious’ apple cultivar (Li et al. 2012a). To explore the potential mechanisms of transcriptional regulation, the relationship between MdMYB1 or MdMYB6 and the MdAAT2 promoter was studied using in vitro and in vivo assays. We suggest that MdMYB1 and MdMYB6 can function in MdAAT2 regulation, specifically in response to SA and ethylene, by binding to the MdAAT2 promoter region.
Materials and methods Plant materials, growth conditions and treatment ‘Golden Delicious’ apple (Malus domestica Borkh.) fruits were randomly collected from orchard trees near Tai’an, Shandong Province, and stored at −80 °C. Tobacco plants (Nicotiana tabacum cv NC 89 and Nicotiana benthamiana) were also used in this study. Transgenic and wild-type tobacco lines were grown under controlled environmental conditions with a photoperiod of 16/8 h (day/night), a temperature of 25 °C and photosynthetic active radiation of 400 μmol m−2 s−1. For hormone treatment, the selected organs of 7-dayold seedlings (grown on solid Murashige and Skoog (MS) medium containing 3 % sucrose) and 55-day-old mature plants (grown in soil) of Nicotiana tabacum cv NC89
Plant Mol Biol (2014) 85:627–638
tobacco were sprayed with water (control), 1 mM SA or 1 mM ETH and then covered for 6 h. Plasmid construction Plasmids for the MdAAT2 promoter GUS expression assays were constructed using the pBI121 vector backbone (Clontech, Palo Alto, CA, USA) by replacing the cauliflower mosaic virus 35S (CaMV 35S) promoter sequence. The plasmids for the dual luciferase transient tobacco assays were constructed using the pGreen 0800-LUC vector backbone. All primers are described in Supplementary Table S1, which is available online. Subcellular localization of the MdMYB1‑GFP and MdMYB6‑GFP fusion proteins The full-length MdMYB1 and MdMYB6 ORFs, without the termination codons, were inserted into the cloning sites of the reconstructed binary vector pBI121-GFP, generating a C-terminal fusion with the gene encoding green fluorescence protein (GFP) under control of the 35S promoter. The MdMYB1-GFP and MdMYB6-GFP plasmids and the control pBI121-GFP plasmid were separately introduced into Agrobacterium tumefaciens strains LBA4404 and GV3101 and then transformed into onion epidermis cells by agroinfiltration. The transformed tissues were cultured on MS agar at 23 °C for 16 h in darkness, and green (GFP) and blue (DAPI) fluorescence images were obtained using a fluorescence microscope (Olympus, Tokyo, Japan). MdMYB1 and MdMYB6 protein expression and purification To obtain the MdMYB1 and MdMYB6 proteins, the fulllength MdMYB1 and MdMYB6 ORFs were inserted into the cloning sites of the pET-30a-c(+) vector and then introduced into E. coli BL21 (DE3) cells. The expression of the recombinant proteins was induced using 0.5 mM IPTG, and the polypeptides were purified by nickel– nitrilotriacetic acid agarose (Ni–NTA) bead affinity chromatography according to the published protocol (Qiagen, Hilden, Germany). The recombinant proteins were washed with imidazole washing solution, concentrated and stored at −70 °C. MdAAT2 promoter sequence analysis A promoter bioinformatics analysis was performed using the plant cis-acting regulatory DNA elements databases PLACE (http://www.dna.affrc.go.jp/PLACE) and PlantCARE (http:// bioinformatics.psb.ugent.be/webtools/plantcare).
629
Electrophoretic mobility shift assays (EMSAs) All of the probes for the EMSAs were 5′ and 3′ labeled with biotin using a labeling kit from Beyotime (China). The EMSA analysis reagents and protocol were obtained from the Thermo light shift chemiluminescent EMSAs kit (USA). The purified proteins and probes were incubated in binding buffer for 20 min at room temperature (20 μL total); 5 μL of 5 × loading buffer was added prior to electrophoresis through a 6 % polyacrylamide gel in 0.5 × TBE. The samples were then electrophoretically transferred to a nylon membrane, and the transferred DNA was crosslinked to the membrane using a UV-light crosslinking instrument. The biotin-labeled DNA on the membrane was detected by chemiluminescence and exposure to X-ray film. Transactivation analysis The pGreen 0800-LUC vector was used to analyze promoter-TF interactions in vivo (Hellens et al. 2005). The promoter sequences were cloned and inserted into the cloning sites of the pGreen 0800-LUC vector. In this construct, the REN gene, under the control of the 35S promoter, provided an estimate of the extent of transient expression. The reporter construct, which was introduced into Agrobacterium (GV3101), was mixed with either one or two Agrobacterium strains (1:9) carrying promoter-MYB constructs and was co-infiltrated into N. benthamiana leaves. The plants were grown until six leaves were present and the youngest leaves were over 1 cm long. Activity was expressed as a ratio of LUC to REN, and the concentration of Agrobacterium in the infiltration buffer did not significantly affect the ratio. This protocol followed the methods described in the Promega (USA) dual luciferase reporter assay system. For hormone treatment, the transgenic leaves were sprayed with water (control), 1 mM SA or 1 mM ETH and then hermetic for 6 h. Tobacco transformation Different expression vector plasmids were introduced into Agrobacterium tumefaciens strain LBA4404 and then transformed into tobacco (N. tabacum cv. NC89) using the leaf-disc method. Transformed plants were selected on MS medium containing 150 mg/L kanamycin and 250 mg/L carbenicillin. After 3–4 week of regeneration, the shoots were transferred to root-inducing medium containing 100 mg/L kanamycin for 3 week and then transferred to a greenhouse, where the primary transformants (T0) were allowed to self-fertilize. The T1 and T2 seedlings were selected on MS medium containing 200 mg/L kanamycin.
13
630
Plant Mol Biol (2014) 85:627–638
(A)
N-terminus R2-domain
R3-domain
AtMYB2 AtMYB6 AtPAP2 AtPAP1 MdMYB1 MdMYB6 VvMYBA1 VvMYBA2
(B)
(C)
Hours of IPTG treatment Hours of IPTG treatment 4 2 0 6 Purified 0 Purified 4 2 6
10
MdMYB6
MdMYB1
5 M kDa
MdMYB1
30
Bright light
MdMYB6
40
DAPI
Free-GFP
GFP 80 60
Fig. 1 Homology, subcellular localization, and SDS-PAGE analyses of MdMYB1 and MdMYB6. a N-terminal amino acid sequence alignments of MdMYB1, MdMYB6 and other MYB TFs in Arabidopsis and grapevine. The R2 and R3 domains are underlined in gray (similar amino acids) and black (identical amino acids). b SDS-PAGE analysis of the expression of MdMYB1 and MdMYB6 proteins in E. coli. E. coli cells harboring the pET30a-MdMYB1 and pET30aMdMYB6 plasmids were incubated with 0.4 mM IPTG for 0–6 h at 28 °C. Each crude extract and recombinant purified protein were
analyzed by 15 % SDS-PAGE. The MdMYB1 and MdMYB6 proteins are indicated. M molecular mass protein standards. c Subcellular localization analysis of the MdMYB1 and MdMYB6 proteins. The fusion constructs of MdMYB1-GFP and MdMYB6-GFP and the GFP control plasmid were introduced into onion epidermal cells via Agrobacterium-mediated transformation. The transformed cells were cultured on MS medium at 28 °C for 48 h, and fluorescence signals of GFP (green) and DAPI (blue) were detected with a microscope; bar = 50 μm
GUS activity assays and histochemical staining
with 70 % ethanol, observed under a bright-field microscope and photographed.
Approximately 100–120 mg of the plant materials (seeds, stigmas, sepals, leaves, ovaries and petals from mature plants and leaves, stems and roots from seedlings) were ground in extraction buffer (EB; 50 mM sodium phosphate, pH 7.0, 0.1 % Triton X-100, 0.1 % sodium lauryl sarcosine, 10 mM 2-mercaptoethanol and 10 mM 1,2-diaminocyclohexane-N,N,N,N-tetraacetic acid). The extracts were centrifuged at 12,000×g for 10 min at 4 °C, after which the supernatants were collected. The concentration of the extract was determined using a NanoDrop instrument. Fluorometric GUS (GUS activity) assays were performed as previously described (Jefferson et al. 1987). Fluorescence was measured using a microplate spectrofluorometer. The histochemical localization of GUS was identified after the transgenic seedlings or different tissues were incubated overnight at 37 °C in a solution containing 1 mg/mL 5-bromo-4-chloro-3-indolyl-glucuronic acid, 5 mM potassium ferrocyanide, 0.03 % Triton X-100 and 0.1 M sodium phosphate buffer, pH 7.0. The tissues were then cleaned
13
Results Subcellular localization and purification of MdMYB1 and MdMYB6 proteins Previous studies have predicted that MdMYB1 and MdMYB6 might play roles in regulating MdAAT2 expression in apple fruit using gene expression pattern correlation analyses (Li et al. 2012a). To investigate the functions of MdMYB1 and MdMYB6, their cDNAs were amplified by reverse-transcription PCR from ripening ‘Golden Delicious’ apple fruit. The open reading frames of MdMYB1 and MdMYB6 contains 417 and 313 amino acids, respectively. Homology analysis indicated that the N-termini of MdMYB1 and MdMYB6 share significant sequence similarity with R2R3-type MYB TFs (Fig. 1a). A prokaryotic expression system was employed to obtain the MdMYB1 and MdMYB6 proteins, and the recombinant MdMYB1
Plant Mol Biol (2014) 85:627–638
(45 kDa) and MdMYB6 (38 kDa) proteins were efficiently expressed in E. coli BL21 (DE3) cells (Fig. 1b). The expression levels of MdMYB1 and MdMYB6 increased significantly with the induction time (Fig. 1b). Purification of the recombinant MdMYB1 and MdMYB6 proteins was achieved by Ni–NTA bead affinity chromatography, utilizing the His6-tag at the N-terminus (Fig. 1b). To determine the subcellular localization of these proteins, the MdMYB1 and MdMYB6 gene CDSs were fused in frame to the 5′ terminus of the GFP reporter gene under the control of 35S promoter. The recombinant constructs of the MdMYB1-GFP and MdMYB6-GFP fusion genes and GFP alone were introduced into onion (Allium cepa) epidermal cells. As shown in Fig. 1c, the MdMYB1-GFP and MdMYB6-GFP fusion proteins accumulated mainly in the nucleus (as indicated by DAPI fluorescence), whereas free GFP was present throughout the entire cell, suggesting that MdMYB1 and MdMYB6 are nuclear-localized proteins. MdMYB1 and MdMYB6 bind in vitro to MYB binding sites in the MdAAT2 promoter The sequence of the MdAAT2 promoter described in our previous study was cloned by TAIL-PCR from apple fruit, which was used for bioinformatic sequence analysis (Li et al. 2012a). To ensure greater accuracy, the promoter sequence was revised based on ‘Golden Delicious’ apple genome for the present paper (Velasco et al. 2010). Promoter sequence analysis using the PLACE (Higo et al. 1999) and PlantCARE (Lescot et al. 2002) databases revealed two potential MYB binding sites (MBSs) in the upstream regulatory sequence at positions −544 and −24 (Fig. 2a; Supplementary Fig. S1). Thus, to test whether MdMYB1 or MdMYB6 directly binds to the MdAAT2 promoter, electrophoretic mobility shift assays (EMSAs) were performed. Based on the sequences of the two MBSs, two 25-bp probes, 24MBS and 544MBS, were designed for these EMSAs (Fig. 2b). The results showed that the two oligonucleotide probes could be bound by the purified recombinant His6-tagged MdMYB1 and MdMYB6 proteins (Fig. 2c, d). In contrast, the control experiments did not show any signals of a His6-tagged MdAAT2 protein (His-P) binding to the two probes (Fig. 2c, d). Additionally, the probes were not bound by two other His6-tagged R2R3 MYB TFs from Arabidopsis, AtPAP1 and AtPAP2 (Supplementary Fig. S2). Furthermore, all binding signals were reduced when unlabeled competitor DNA for the 24MBS and 544MBS probes was added in 50- and 100-fold excess, suggesting that the binding reactions were specific (Fig. 2c, d). To further confirm the results, mutated probes were designed, and the EMSAs were repeated. The two original probes were all divided into three parts: a, b and c and d, e
631
and f (Fig. 2a). Two other confirmed MYB binding motifs, TAAGTAC (g) and CAACAGTGA (h) in Zea mays and A. thaliana, respectively, were employed. The eight sequences were randomly assembled into three mutated probes of 24MBS and 544MBS, namely CP1, CP2 and CP3 (Fig. 3a). As shown in Fig. 3b and c, only slight signals of CP1, CP2 or CP3 with the two MYB TFs were observed, whereas strong signals of the MYB TFs binding to the original probes (24MBS and 544MBS) were observed (Fig. 3b, c). Additionally, another three site-mutated probes, mut1, mut2 and mut3, were designed according to the core sequences of MBSs (sequences b and e), and binding assays were performed (Fig. 3d). The results showed minor signals with the mutated probes, although a band shift of mut1 with MdMYB6 was observed (Fig. 3e). These results strongly indicated that both MdMYB1 and MdMYB6 can bind to the MBSs in the MdAAT2 promoter in vitro and that the interactions between these MYB TFs and MBSs are specific. MdMYB1 and MdMYB6 enhance MdAAT2 promoter activity in transiently expressing tobacco To investigate whether MdMYB1 or MdMYB6 is involved in regulating MdAAT2 promoter activity in vivo, dual luciferase assays in transiently expressing tobacco leaves were performed (Hellens et al. 2005). The MdAAT2 promoter was fused to LUCIFERASE (LUC), and transactivation of the LUC gene was measured relative to 35S: RENILLA (REN) by luminescence measurement after transient expression in Nicotiana benthamiana (Fig. 4a). The results showed that the LUC/REN ratio was extremely low in the absence of MdMYB1 or MdMYB6 (Fig. 4b). However, when the MdAAT2p: LUC construct was co-infiltrated with 35S: MdMYB1, 35S: MdMYB6 or both, 10- to 15-fold increases in LUC activity were observed (Fig. 4b), suggesting that MdMYB1 or MdMYB6 can enhance MdAAT2 promoter activity in vivo. According to the EMSA data, the predicted MBSs might be important for MdAAT2 transactivation. To address this possibility, three promoter MBS deletion plasmids, 24del: LUC, 544-del: LUC and 544-24-del: LUC, were constructed (Fig. 4a), and dual luciferase transient tobacco assays were performed. The results showed that the level of LUC activity was similar to that of MdAAT2p: LUC when the deletion constructs were infiltrated into tobacco leaves alone. However, when 24-del or 544-del was co-infiltrated with 35S: MdMYB1, 35S: MdMYB6 or both, 3- to 4-fold increases in LUC activity were observed. No significant change in promoter transactivation was observed when 544-24-del: LUC was co-infiltrated with the overexpressed MYB TFs (Fig. 4b). These results suggested that the two MYB binding motifs play equally important roles in the
13
632
Plant Mol Biol (2014) 85:627–638
544MBS
(A)
24MBS +1 TATA-box
100 bp
(B)
24MBS
CATTAAGTACTGACCGTATCAACTT b
a 544MBS
ACAGTGACAACTGTCATTGGGGCAG f
e
d
(C)
c
24MBS
+
+
+
+
-
-
-
+
544MBS
+
-
-
-
+
+
+
+
MdMYB1
-
+
-
-
+
+
+
+
+
-
-
-
-
His-P
-
-
Competitor
-
-
+ -
-
MdMYB1 + DNA
◂ Fig. 2 EMSAs of MdMYB1 and MdMYB6 binding to MdAAT2
promoter MBSs. a Positions of the two MBSs in the MdAAT2 promoter region, as predicted by PLACE and PlantCARE database analysis. b Sequences of the 24MBS and 544MBS probes. All probes were labeled with biotin at their 3′ and 5′ ends. The letters a, b, c, d, e and f represent the different parts of the 24MBS and 544MBS sequences. c EMSAs of biotin-labeled probes with MdMYB1. Lane 1 24MBS and 544 MBS probes, no protein; lane 2 24MBS probe incubated with MdMYB1; lane 3 24MBS probe with MdMYB1 and 50-fold excess of unlabeled 24MBS competitor; lane 4 24MBS probe with MdMYB1 and 100-fold excess of unlabeled 24MBS competitor; lane 5 544MBS probe with MdMYB1; lane 6 544MBS probe with MdMYB1 and 50-fold excess of unlabeled 544MBS competitor; lane 7 544MBS probe with MdMYB1 and 100-fold excess of unlabeled 544MBS competitor; lane 8 544MBS and 24MBS incubated with the His-P protein (His6-tagged MdAAT2 protein). d EMSAs of biotin-labeled probes with MdMYB6. Lane 1 24MBS and 544MBS probes, no protein; lane 2 24MBS probe incubated with MdMYB6; lane 3 24MBS probe with MdMYB6 and 50-fold excess of unlabeled 24MBS competitor; lane 4 24MBS probe with MdMYB6 and 100fold excess of unlabeled 24MBS competitor; lane 5 544MBS probe with MdMYB6; lane 6 544MBS probe with MdMYB6 and 50-fold excess of unlabeled 544MBS competitor; lane 7 544MBS probe with MdMYB6 and 100-fold excess of unlabeled 544MBS competitor; lane 8, 544MBS and 24MBS incubated with the His-P protein
Free probe 1
(D)
24MBS
2
3
4
5
6
7
8
-
-
+
+
+
+
+
-
544MBS +
-
-
-
+
+
+
+
MdMYB6
-
+
+
+
+
+
+
-
His-P
-
-
-
-
-
-
-
+
Competitor
-
-
1
2
-
-
MdMYB6 + DNA
Free probe 3
4
5
6
7
8
regulation of MdAAT2 promoter activity by MdMYB1 or MdMYB6. To further confirm the above conclusions, three other promoter-LUC plasmids, 24-add: LUC, 544-add: LUC and 544-24-add: LUC, were constructed; in these constructs, the number of binding motifs in the promoters was tripled (Fig. 4a). The results of dual luciferase transient tobacco assays also showed that the level of LUC activity was similar to that of MdAAT2p: LUC when the triple-MBS constructs were infiltrated into tobacco leaves alone. Surprisingly, much more significant increases were found (≥17-fold) when the triple-MBS constructs were coinfiltrated with either or both of the MYB TFs compared to pMdAAT2: LUC (Fig. 4b). Taken together, we suggest that MdMYB1 and MdMYB6 overexpression can significantly enhance MdAAT2 promoter activity by binding to the MBSs.
13
The MdAAT2 promoter exhibited little response to SA or ETH in transgenic tobacco We aimed to explore the mechanisms of MdAAT2 transcriptional responses to SA or ETH. An expression pattern analysis of the MdAAT2 promoter in transgenic tobacco showed that GUS activity controlled by the MdAAT2 promoter was detected in tobacco stigmas, as it was in apple (Fig. 5a; Supplementary Fig. S3). However, GUS activity or blue staining was barely detected in seedlings or the other organs of mature plants (leaves, sepals, ovaries or petals); high GUS activity was observed in the 35S: GUS transgenic plants (Fig. 5a, b; Supplementary Fig. S3). In addition, slight blue staining was observed in the glandular trichomes of sepals and leaves (Supplementary Fig. S3). GUS activity was detected in these organs after treatment with SA or ETH for 6 h. The results showed no difference in GUS activity in the hormone-treated organs compared with the control, which suggested that, unlike in apple fruits, the regulators of MdAAT2 responses to hormone signaling are absent in transgenic tobacco (Fig. 5c–f). MdMYB1 and MdMYB6 function in MdAAT2 promoter response to SA and ETH Previous results have showed that MdMYB1 can be induced by ETH and that MdMYB6 can be induced by SA and ETH in apple fruits (Li et al. 2012a). To address whether MdMYB1 or MdMYB6 can be induced by hormones in tobacco, dual luciferase assays using the MdMYB1 (1,400 bp) and MdMYB6 (1,300 bp) promoters were
Plant Mol Biol (2014) 85:627–638
(A)
633
CP1: TAAGTACCAACTGTATCAACTT g e c CP2: CATTAAGTACTGACCGCAACAGTGA b h a CP3: TCATTGGGGCTGACCGTATCAACTT f b c
(B)
24MBS
544MBS
CP1
CP2
CP3
+
+
+
+
2
3
4
5
MdMYB1 +
Free probe 1
(C)
24MBS
544MBS
CP1
CP2
CP3
+
+
+
+
+
MdMYB6
Discussion
Free probe 1
(D)
2
3
4
5
mut1: CATTAAGTACCAGTATTATCAACT mut2: CATTAAGTACACGTTGTATCAACT mut3: CATTAAGTACGTTGTATATCAACT a
Mutated sites
c
(E)
24MBS mut1 mut2 mut3 mut1 mut2 mut3 544MBS + + + + MdMYB1 MdMYB6
performed. The results showed that the promoter activity of MdMYB1 or MdMYB6 was much higher than that of MdAAT2 in tobacco leaves (Fig. 6a). Furthermore, the activities of both promoters were remarkably induced by ETH, and MdMYB6 promoter activity was also greatly induced by SA. The results indicated that the promoters of MdMYB1 and MdMYB6 respond to hormone signaling in tobacco leaves (Fig. 6a). To explore whether MdMYB1 or MdMYB6 play roles in MdAAT2 hormone responses, dual luciferase assays in tobacco leaves were repeated. When the MdAAT2p: LUC construct was co-infiltrated with MdMYB1p: MdMYB1, MdMYB6p: MdMYB6 or both, the LUC/REN ratio was higher than that of MdAAT2p: LUC alone. Moreover, when transgenic tobacco leaves were treated with ETH or SA, the transactivation of the MdAAT2 promoter was significantly enhanced by the hormone-induced MdMYB1 and MdMYB6 proteins (Fig. 6b). Taken together, these results strongly suggest that MdMYB1 and MdMYB6 function in MdAAT2 ETH or SA response.
-
-
-
1
2
3
-
+
+
+
+
6
7
8
Free probe 4
5
Fig. 3 EMSAs of MdMYB1 and MdMYB6 binding to mutated MdAAT2 promoter MBSs. a Sequences of the CP1, CP2 and CP3 probes. CP1, CP2 and CP3 are rearranged mutant probes based on the 24MBS and 544MBS sequences. The letters a, b, c, d, e and f represent the different parts of the 24MBS and 544MBS sequences; g and h are MYB binding motifs from Zea mays and Arabidopsis, respectively. b EMSAs of biotin-labeled probes with MdMYB1. Lanes 1–5, MdMYB1 with the 24MBS, 544MBS, CP1, CP2 and CP3 probes, respectively. c EMSAs of biotin-labeled probes with MdMYB6. Lanes 1–5, MdMYB6 with the 24MBS, 544MBS, CP1, CP2 and CP3 probes, respectively. d Sequences of mut1, mut2 and mut3 probes. Mut1, mut2 and mut3 are site-mutated probes according to the core sequences of the MBSs (sequences b and e). e EMSAs of biotin-labeled mutated probes with MdMYB1 and MdMYB6. Lanes 1–4 MdMYB1 with the 24MBS, mut1, mut2 and mut3 probes, respectively; lanes 5–8 MdMYB6 with the mut1, mut2, mut3 and 544MBS probes, respectively
Volatile esters are key aromatic components in ripening fruits and determine fruit quality, influencing final consumer acceptance (Beekwilder et al. 2004; Lewinsohn et al. 2001), and AAT-catalyzed reactions are the last steps in ester formation. Previous studies have demonstrated that MdAAT2 could be induced by SA or ethylene in ripening apple fruits (Li et al. 2006a, b). However, little is known about the response mechanisms to hormone signaling. In the present study, we concluded that two apple MYB TFs function in the MdAAT2 SA and ETH signaling pathways based on our promoter region-binding results in transgenic tobacco. Plant growth and development are regulated by the coordinated expression of tens of thousands of genes through the actions of transcription factors that activate or repress gene transcription in response to various environmental stimuli (Riechmann et al. 2000). The MYB family is one of the largest transcription factor family in most land plants, such as in Arabidopsis (Riechmann et al. 2000), Populus (Wilkins et al. 2009) and apple (Cao et al. 2013; Velasco et al. 2010). MYB TFs are typically classified into three groups according to the arrangement of their DNA-binding domain: R1R2R3, R2R3 and MYB-related (Dubos et al. 2010). In the past decade, R2R3-type genes have been extensively studied, and members have been identified to be involved in diverse plant physiological and biochemical processes, such as hormone signaling (Gocal et al. 2001; Newman et al. 2004), cell cycle control (Ito et al. 2001), secondary metabolism (Nesi et al. 2001) and
13
634
Plant Mol Biol (2014) 85:627–638
(A)
24MBS
544MBS
MdAAT2 promoter 24-del 544-del 35S promoter
REN
LUC
CaMV term
CaMV term
544-24-del 24-add 544-add 544-24-add
(B)
a a
MdAAT2p:LUC MdAAT2p:LUC+35S:AtPAP1 MdAAT2p:LUC+35S:MdMYB1 MdAAT2p:LUC+35S:MdMYB6 MdAAT2p:LUC+35S:MdMYB1+35S:MdMYB6 24-del:LUC 24-del:LUC+35S:MdMYB1 24-del:LUC+35S:MdMYB6 24-del:LUC+35S:MdMYB1+35S:MdMYB6 544-del:LUC 544-del:LUC+35S:MdMYB1 544-del:LUC+35S:MdMYB6 544-del:LUC+35S:MdMYB1+35S:MdMYB6 544-24-del:LUC 544-24-del:LUC+35S:MdMYB1 544-24-del:LUC+35S:MdMYB6 544-24-del:LUC+35S:MdMYB1+35S:MdMYB6 24-add:LUC+35S:MdMYB1 24-add:LUC+35S:MdMYB6 24-add:LUC+35S:MdMYB1+35S:MdMYB6 544-add:LUC+35S:MdMYB1 544-add:LUC+35S:MdMYB6 544-add:LUC+35S:MdMYB1+35S:MdMYB6 544-24-add:LUC 544-24-add:LUC+35S:MdMYB1 544-24-add:LUC+35S:MdMYB6 544-24-add:LUC+35S:MdMYB1+35S:MdMYB6
c a b a b a
d
a d
0
0.2
0.4
0.6
0.8
1.0
LUC: REN ratio
Fig. 4 Interactions of the two MYB TFs with promoters in dual luciferase transient tobacco assays. a Schematic of the LUC plasmids under different promoter control. The MdAAT2 promoter is the native promoter from apple. 24-del represents a deleted MYB binding motif at position −24 of the native promoter. 544-del represents a deleted MYB binding motif at position −544 of the native promoter. 544-24-del represents a deletion of MYB binding motifs at positions −544 and −24 of the native promoter. 24-add represents two additional MYB binding motifs at position −24 of the native promoter. 544-add represents two additional MYB binding motifs at position
−544. 544-24-add represents two additional MYB binding motifs at positions −544 and −24. b Ratios of LUC to REN from tobacco leaves infiltrated with different promoter plasmids co-infiltrated with 35S:MdMYB1, 35S:MdMYB6 or both. The luminescence of LUC and REN was measured at 3 days after infiltration with mixed Agrobacterium, and the data in all panels are presented as the mean (±SE) of four replicate reactions. A one-way ANOVA (Duncan’s multiple range test) was performed, and statistically significant differences are indicated by different lowercase letters (P
