Third Component of Trout Complement - John D. Lambris

0022-1767/93/15111-6123$02.00/0 The Journal of Immunology Copyright 0 1993 by The American Association of Immunologists

Vol 151, 6123-6134, No. 1 1 , December 1, 1993 Printed in U.S.A.

Third Component of Trout Complement cDNA Cloning and Conservation of Functional Sites'

John D. Lambris,** Zhege Lao,* Jian Pang,* and Jochem Alsenzt *Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104; and 'Hoffman-La Roche Ltd. Co., Basel, Switzerland ABSTRACT. Of the 30 distinct complement proteins recognized to date, C3 is probably the most versatile and multifunctional molecule known, interacting with at least 20 different proteins. It plays a critical role in bothpathways of complement activation and participatesin phagocytic and immunoregulatoryprocesses. Structural and functional analysis of C3 from different species, in addition to phylogenetic information, provides insights into the structural elements mediating the various functions. This study describes the cDNA cloning of one of isoforms two of the third complement component, C3-1, of rainbow trout (Salmo gairdneri) and the analysis of its functional sites.By screening a trout liver hgtl1 library with anti-troutC3 chain-specific antibodies and polymerase chain reaction we have determined the cDNA sequence of trout C3-1. The obtained sequence is in complete agreement with the protein sequence of several tryptic peptides, corresponding to different regions of troutC3-1. C3-1 consists of 1640 amino acids with a calculatedmolecular mass of 181,497 Da. The sequence contains two potential N-glycocylation sites, one on each chain of C3. The deduced protein sequence showed 44.1 , 43.3, 44.2, 44.9, 43.1 , 43.8, 45.9, 29.9, and 33.1 % amino acid identities to human, mouse rat, guinea pig, rabbit, cobra, frog, hagfish, and lamprey C3, whereas the identities to human C4, C5, and aZMare 30.4, 28, and 22.9%, respectively. The trout C3 amino acid sequence shows clusters of high and low similarity toC3 from other species. In the regions of high similarity belong the C3 domains that contain the thiolester site and the properdin binding sites, whereas the regions that correspond to regions of human C3 where CR1 and CR2 bind show low amino acid sequence similarity. The deduced amino acidsequence shows that the C3 convertase cleavage site (Arg-Ser) is conserved in troutC3,whereas the factor I cleavage sites are Arg-Ala and Arg-Thr instead of Arg-Ser, which is found in the C3 of other species. Protein sequencing of the trout C3 fragments fixed on zymosan during complement activation confirmed the cleavage oftrout C3 bytrout C3 convertase and factor I at Arg-Ser and Arg-Thr, respectively. Journal of Immunology, 1993, 151: 6123.

T

he study of C3 molecule from different species give insight into its structural elements involved in its different functions, the structural features constrained by selection, and the evolutionary history of C3 and complement in general. C3-like activity has been reported in various species, including invertebrates, yet thus far C3 has been purified only from chordatesand has been found to be present in representatives of each of the seven Received for publication April 1993.

28, 1993. Accepted for publication July

14,

of The costs of publication of this artlcle were defrayed in part by the payment page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

' This work

was supported by National Science Foundation Grant DCB9018751, National Institutes of Health Grant AI 30040, a grant from the Research Foundation of the University ofPennsylvania, and Cancer Center Core support Grant CA 16520-1 6.

living classes of vertebrates (1, 2). The complete primary structures have been deduced for C3 of human (3), guinea pig (4), mouse (5, 6), rat (7), hagfish (8), lamprey (9), and cobra (10) and partial primary structures have been determined for C3 of rabbit (11) and Xenopus (12). Although C3 has been purified from different species, the best characterized is that of human (1, 13). Human C3 is the most abundant complement protein present in serum (1.2 mg/ml) comprised of two polypeptide chains( a and p, M, 110,000 and 75,000) linked by one disulfide bond and noncovalent forces. It contains two N-linked carbohydrate moieties at residues 63 and 917, with 5-6 and 8-9 mannose

* Address correspondence and reprint requests to Dr. John D. Lambris, Department of Pathology and Laboratory Medicine, University of Pennsylvania, 410JohnsonPavillion,36thandHamiltonWalk,Philadelphia, PA 19104.

61 23

61 24

TROUT C 3

residues, respectively (14,15).Cleavage of C3 between Antibodies totrout C3 residues726 and 727 (kg-Ser) by either the classical Polyclonal antibodies against trout C3 were generated in (C4b,2a) or the alternative (C3b,Bb) pathway C3 converrabbits by injecting either zymosan-C3b/iC3b and/or putases leads to the generation of C3b and C3a (M, 9,000). rified C3. The former was prepared by incubating 5 mg of The C3bmolecule transiently acquiresthe ability to be zymosan with1ml oftrout serum for30 min at 25°C. After fixed covalently through an ester or amide bond to the hyboiling for 5 min in 1% SDS/PBS, the zymosan particles droxyl or amino groups present on cell surfaces, complex were extensively washed with the same buffer, followed by carbohydrates, or immune complexes (16, 17). In contrast washing with PBS and used for immunization. Thesegento native C3, C3b expresses multiple binding sites for other eratedantibodies reacted weakly with other serum procomplement components, including C5, properdin (P), factein(s) and were used only in the initial experiments to tors H, B, and I, C4 binding protein (C4bp), CR1 (C3b purify trout C3. Monospecific antibodiesfor trout C3 were receptor), and the membrane cofactorprotein (1,13). Bindprepared by immunizing with intact C3 and its individual ing of these proteins to C3b leads eitherto amplification of chains. The CY- and @-chainsof trout C3 were purified by the C3 convertase (by B and P in the presence of factor D) electrophoresis of purified C3 under reducing conditions. and initiation of the membrane attack complex (C5), or to The individual bands after visualization with 1M KC1 were the inactivation of C3b (factor I) (18). Whether amplificut and the minced gel pieces injected in to rabbits. The cation or inactivation occurs depends on the nature of the antibodies were affinity purified on a C3 column. surface that C3b is fixed. The C3 fragments, both soluble and/or surface bound, Purification of trout C 3 and preparation of generated during complement activationhave the potential tryptic fragments to bind specifically to several cell surface receptorsknown Trout C3 was purified as previously described (26). Briefly, as CR1, CR2, CR3, CR4, CR5, and C3a receptor. Consetrout plasma wastreated with 2 mM diisopropylfluorophosquently, these C3 receptor interactions lead to various phate and brought to 4% polyethylene glycol 4000. After biologic responses (13, 19-23). constant stirring for30 min at 4"C, plasma was centrifuged Trout have a complement system that is similar to that (10,000 X g for 20 min), the supernatant brought to 16% of mammals (24). C3 purified from trout plasma has strucpolyethelene glycol and stirred for 1 h at 4°C. After centure and properties similar to those of mammalian C3 (25, trifugation (10,000 X g for 20 min), the pellet was redis26). It consists of two disulfide-linked polypeptide chains, solved in 5 ml of 20 mM Tris-HC1, pH 7.5, containing 2 containinga thiolester site, and is glycosylated in the mM diisopropylfluorophosphate and applied to a MonoQ @-chain(26). A variant of trout C3, termed C3-2, shows no HR 10/10 anion exchange column equilibrated in 20 mM hemolytic activity and its tryptic peptide map contains sigTris-HC1, pH 7.5. C3 was eluted with a linear NaC1nificant number of peptides (20%) that are different from gradient (0 to 500 mM) and identified by ELISA and SDSthose in the C3-1 (27). In this report we present the comPAGE. The fractions containing C3 were subjected to caplete primary structure of trout C3-1 and comparethis tion exchange on FPLC Mono S HR 5/5 column. The Mono structure with that of C3 from other species and other hoS column was equilibrated in 20 mM sodium acetate, pH mologous proteins. In this studywe have also characterized 5.2, and C3 was eluted with alinear NaCl gradient (0 to 500 the factor I and C3 convertase cleavage sites in trout C3-1 mM). Fractions containing C3 were pooled and dialyzed and correlate the conservation of these sites to those found against PBS. in the C3 from other species. Finally, we have correlated Tryptic fragments of trout C3 were prepared by incuthe conservation of the C3 structure to its ability to interact bating trout C3 with trypsin (5% wt/wt) for30 min at 37°C. with CR1, CR2, H, B, and P. The individual fragments were separated by SDS-PAGE under reducingconditions then electroblotted and their Materials and Methods NH2-terminal sequence determined as described below. Rainbow trout (SaZmo gairdneri) were obtained from LanAmino acid sequence determination of the C3 denberg trout farm, Philadelphia and Rheinbrucke, Basel. convertase and factor I generated C 3 fragments Blood was collected using a syringe from the caudal artery. Zymosan A is a polysaccharide component of yeast cell Trout livers were excised and either frozen in liquid niwalls that activates the alternative pathway of complement trogen or used immediately to prepare the cDNA libraries. (28). This leads to C3b fixation to its surface; part of this All chemicals for automated sequencing were from Applied C3b is degraded to iC3b by factors I and H. Zymosan was Biosystems. Restriction enzymes were from either Boehincubated with human and trout serum (5 mg/ml serum) for ringer Mannheim (Indianapolis, IN)or Promega (Madison, 30 min at 37°C or 25"C, respectively. The zymosan parWI). All radionucleotides were from NEN (Boston). All ticles were boiled in 2% SDS and extensively washed with other chemicals and reagents used were reagent or higher 2% SDS. The C3fragments @-chain and the equivalent to grade.

Journal of Immunology

human 43 kDa COOH-terminal a-chain fragment) were eluted from the zymosan by boiling it for 5 min in the electrophoresisreducingsamplebuffer. The supernatant was removedandthezymosanparticlesafterextensive washing were incubated in 0.1 M NaHCO,, 0.1 M hydrazine, pH 11,for 60 min at 37°C toelute the a-chain and/or its 68 kDa NH2-terminal fragment (29). The supernatants from both incubations wasran in 10% SDS-PAGE and the individual bands were sequenced by a modified method (30) of Matsudaira (31). Protein bands electroblotted onto polyvinylidene difluoride membranes were visualized by staining with Coomassie brilliant blue, then were cut off the membrane and stored under vacuum at 4°C until sequenced. NH2-terminal sequencing was then performed on an Applied Biosystem 473A gas phase Protein Sequencer. Protein sequencing was performed at the Protein Chemistry laboratory of the University of Pennsylvania. PAC E

Electrophoresis of the purified protein fragments was performed in the presence of SDS as described by Laemmli (32). The sampleswere reduced with 2% mercaptoethanol. Protein bands were detected by staining with 0.1% Coomassie blue R-250 (Bio-Rad, Richmond, CA) in isopropano1:methanol:acetic acid:H20 (2.8:2.0:1.0:4.2 by vol). The m.w. were estimated using reference proteins. Isolation of RNA and construction of cDNA libraries

61 25

EcoRI and MluI. The inserts of the longest clone (clone12) were subclonedto theMluI sites of vector pIB131 (IBI, New Haven, CT) for direct sequencing; the EcoRI enzyme did not cleave this clone. Cloning of trout C3 by PCR3

To clone the 5’ of trout C3 cDNAthe technique of PCR was used. Oligonucleotides were synthesized on a MilliGen/ Biosearch DNA synthesizer (Cyclone) and purified using the Oligo-pak columns (MilliGedBiosearch).The PCR was performed as described by Saiki et al. (35) using a commercially available kit (Cetus). Two antisense oligonucleotides (oligo32b: 5’AACCTCGAAGCTGGGCAGAACATAC; oligo32c: S’ATACCTGGCAGTGATGTCAACAG) (Fig. 3) were synthesized according to the obtained 5’-end sequence of clone 12. PCR was conducted in a thermocycler using the oligo-dT or random-primed trout library DNA as the template, M13 universal primer (forward or reverse) as one primer, and oligo32c as the other primer. The product of first PCR was subjected to a nested PCR using the oligo32b and M13 universal primers. PCR parameters were as following: 30 cycles 95°C for 1 min, 45°C for 2 min, and 72°C for 2 min. The amplified products wereprecipitated and subclonedinto plasmid pCRl00O vectorusing the TA cloningsystem (Invitrogen, San Diego). C3 cDNAcontaining clones wereidentified by hybridization using the 2.7-kb BamHI fragment of clone 12 as probe. The recombinant clones were subjected to direct sequencing using the M13 universal primers.

Rainbow trout liver total RNA was isolated by the guaniDNA sequencing dineisothiocyanate method followedbycentrifugation Nucleotide sequences were determined using method the of through aCsClcushion(33). Polyadenylated RNAwas Sanger et al. (36) by using the Amersham sequenase kit purified using the PolyA Tract mRNA isolation kit (Proaccording to manufacturer’s directions. mega) according to manufacturer’s instructions. Random or oligo-dT-primed cDNA libraries were constructed using Computer methods an Amersham cDNA synthesis kit according to manufacturer’s instructions. Afterprotection of any internal EcoRI The protein sequences for human, rabbit, rat, and mouse sites byEcoRI methylase and additions of synthetic EcoRI were taken from Swiss Protein Sequence data bases. The linkers, thecDNA wasEcoRIdigested and size fractionated protein sequences for guineapig, lamprey, cobra, and hagon Sepharose CL4B column. cDNA larger than 500 bp fish C3 were translated from their cDNA sequences taken were ligated into EcoRI-digested, dephosphorylatedXgtll from GenBank sequence data bases. The Xenopus C3 searms and packaged in vitro using the Amersham cloning quence represents 80% ofXenopus gili C3 and will be pubsystem. lished elsewhere. The alignments were generatedusing the Wisconsinsoftware and programPileup based on the method of Doolitle and Feng (23). All otheranalysis were Screening of the cDNA library performed using the PcGene software (Inteligenetics). The libraries will be screened without prior amplification. Screening of the cDNA libraries with the affinity purified Results antitrout C3 antibodies was performed as previously deIsolation of trout C3 cDNA clones and nucleotide scribed (34). The filters were successively incubated with sequencing the anti-C3 antibody (5 pgiml), a biotinylated goat antiTo obtain trout C3 cDNA clones the trout h g t l l cDNA rabbit Ig, and a complex of avidin and biotinylated horselibrary was screened with an affinity purified antitrout C3 radish peroxidase according to manufacturer’s instructions (VectorLaboratories,Burlingame,CA).Singlecolonies wereisolated and digestedwith the restriction enzymes Abbreviations used in this paper: PCR, polymerase chain reaction.

61 26

TROUT C 3

a chain

AVTISDVITSMASKYHGLAK

p chain

AALQVLSAPNLLRVGSNENIFVE

Trvotic peotidB 30 kDa (equivalent of C3d)

NQVPNSDADTLISVT QLAYRKEDGS

40 kDa C-terminal a chain

ASGNGEATLSVVTLYYALPE

a'chain

SEEDDDDxAYM

C3 convertase aenerated fraaments a'c hai n

SEEDDDDDAY

Factor I aenerated fraaments

68 kDa (N-terminal a' chain) SEEDDDDDAYM 43 kDa (C-terminal a'chain) TDKVNSIDKXLTVKASG

FIGURE 1. Amino acid sequence of trout C3-1 fragments. The chains of trout C3- and its fragments generated by trypsin, C3 convertase, or factor I were separated by SDS-PAGE thenelectroblotted to PVDF membranes and subjected to Edman degradation.

a-chain specific antibody and obtained one positive clone (clone 12). The screening was performed as previously described for the Xenopus C3 cloning (12). The filters were successively incubated with the anti-C3 antibody, a biotinylated goat anti-Rb Ig, and a complex of avidin and biotinylated horseradish peroxidase. This clone was expanded then phage DNA isolated and the size of the cDNA insert was determinedto be 4.7 kb. The 5' 360 bases of this clone was sequenced directly on the hgtll. The partial deduced amino acid sequence whenit was compared withthat of Hu C3 revealed 44% similarity to C3 segment spanning residues 208-338. Its similarity to corresponding regions of mouse C3, human C4, mouse C5, and human azM was found to be 45, 28, 24, and 15%, respectively. The high similarity of the clone 12 sequence to that of C3 from other species and its reactivity with the monospecific antitrout C3 antibody showedthat in fact the isolated clone is atrout C3 clone. To sequence the clone 12 cDNA, h g t l l insert was digested with MluI and subcloned into plBI31 vector. The

insert of the obtained plasmid, plBI-TrC3-12, was further digested by ApaI, BarnH1, XhoI, and PstI (Fig. 2 ) and the generated fragments were subcloned into pIBI31. The sequence of the subcloned fragments was obtained using M13 universal and internal primers. The deduced protein sequence matches the protein sequence (Fig. 3, underlined) obtained by sequencing C3 tryptic fragments (Fig. 1) or fragments eluted from zymosan (see below) and this provides direct evidence that the isolated clone is indeed aC3 clone. The complete coding sequence of clone 12 spans 4352 bp. To obtain the 5' sequence of trout C3, oligo-dT and random-primed liver trout cDNA was subjectedto PCR using two oligonucleotide probes (oligo 32b and 32c, see Fig. 3) corresponding to 5' sequence of clone 12. The amplified products of 600 bp were cloned into pCRlOOO and three different clones were sequenced. The nucleotide sequence of 600 bp fragment match the sequenceof clone 12 by 200 nucleotides and extends to the 5' by 400 nucleotides. The deducedamino acid sequence in its NH2-terminal matchesresidues 21-23 (FVE) of the P-chain NH2terminal amino acid sequence (Fig. 3). Several attempts to obtain the cDNA sequence of the first 20 amino acids of P-chain and that of the signal peptide were unsuccessful. The compiled amino acid sequence of trout C3 contains 1640 amino acids. The calculated molecular mass of trout C3 was 181.497Da consistingof a 111,061Da a-chain and a 70,436 Da P-chain. The mass calculated by SDS-PAGE was 112and 70 kDa. In view of the factthat Con A binded only to P-chain of trout C3 (26)it appears that from the two potential N-glycosylation sites in trout C3 only the P-chain site is glycosylated. The amino acid sequence identity to human, rabbit, mouse, rat, Xenopus, hagfish, and lamprey C3 is shown in Table I. The amino sequence identity to human C4, C5, and a2M in comparison to C3 is significantly lower (Table I). Trout C3 contains a four Arg processing signal that is located in the same position as in the C3 from all other species except lamprey and hagfish C3, whichisArg-Lys-Pro-Arg and Arg-Arg-Lys-Arg, respectively. C3 convertase and factor I cleavage sites in trout C3

To characterize the factor I and C3 convertase cleavage sites in trout C3, we generated C3 fragments by activating

500bp

FIGURE 2. Restriction map and sequencing strategy. The black box at the top shows the open reading frame. Solid arrows show sequencing using restriction sites and dotted arrows sequencing by oligonucleotides.

H

5' trout C3 DNA

Psr I I

Pst I

I

3'

I

- ."". --- ..... - --

1_1 L

I

+

".."

.....

+

. . . . . e

" c

L

pCR-TrC3

Xho I BamH I

I

c .

L

Apa I

I

I

~lBlTrC3-1 2

BamH I

...".

c-

"

.""c

......

.

......

.....c

I

61 27


trout serum with zymosan (zymosan-C3b/iC3b) (Fig. 5) thenanalyzingthem by SDS-PAGE andobtainedtheir NH2-terminal amino acid. Electrophoretic analysis of the C3 fragments fixed on zymosan after activation of trout serum showed a similar degradation pattern to that observed for human C3 (Fig. 5). Although similar fragments were found in the presence or absence of EGTA (inhibits classical complement pathway), no fragments weredetected when the activationof the different sera was performed in the presence of EDTA (inhibits both complement pathways).These data suggest that trout have proteins with similar functions to thoseof human factors B, D, I, and H. The NH2-terminal amino acid sequence of the 68 kDa fragment (Fig. 1) showed that this fragment is the analogue of human C3 fragments generated by C3 convertase (Fig. 4). In addition, these datashow that the cleavage site forthe C3 convertase (human C3 residues 726-727) is conserved within theC3 from the species tested (Fig. 4). The NH2-terminal sequence of the 43 kDa fragment (Fig. 1) showed that this fragment is the analogue of human C3 fragments generated by factors I and H (Fig. 4). Because it relates to the factor I-mediated cleavages, of interest are the finding that the sequence Arg-Thr is found instead of Arg-Ser at the factor I cleavage sites of trout C3.

Discussion

z . 0

0 0

7

m

The bony fish possess a well developed complement system, and protein analoguesof mammalian complementproteins have been isolated from trout plasma. Trout C3 is comprised of two chains(a,p) and contains a thiolester site in the a-chain (25, 26). It exists in two isoforms (C3-1, C3-2) that differ in their antigenicity, tryptic peptide map, and hemolyticaly activity (27). Although both C3 contain a thioester, C3-2 has been found to be hemolytically inactive (27). To resolve the genetic origin of the two C3 proteins and define the structural elements that makeC3-2 hemolyticinactive, we initiated studies to characterize these two forms of C3. In this study we have obtained the cDNA sequenceof trout C3 and analyzed the conservation of functional sites in trout C3 and correlated them to the conservation of structural elements. Evidences indicating that the obtained DNA sequenceis that of trout C3 are: 1) the clone 12 was isolated using monospecific anti-trout C3 antibody, 2) the deduced protein sequence matches completely with the partial protein sequence of seven different fragments of trout C3, and 3) the sequence shows high similarity to the sequence of C3 from other species. The obtained sequence represents the sequence of C3-1 for two reason: 1) it matches all the available protein sequence for C3-1 and 2) as expected differs from that for C3-2 in two residues. However, due to the limited sequence for C3-2 it is not clear whether these two changes are due to polymorphism and thus this requires

61 28

TROUT C 3 20

120 40

180 60 260 90

300 100 360 120

420 140

'

480 160 540

180 600 200 660 220

32b

120 240 180 260

040 290 900

300 960 320

1020

CCTCCGCMT~UCCTC~CT-CMTCCTCCA~TA~-CCCCAT

V

R

X

L

Q

L

L

V

K

A

I

L

E

N

Y

S

I

kxr#xxx

D

P

I

8

2520 4 O

C A T T C T C C C T C T C O I C C T C ~ C C C T D A D C T C T ~ T C C C C U E 2~5Q0 0 I V R V L L Y S N G L V C S S A S K K G 8 6 0

32c

61 29

Journal

Human C3

Hu C3aR CRl, Hu H, and Hu CR2 Binding Site CR2 Binding Sites Binding Site Residues 722-726 Residues 727-768 Residues 1199-1210 0%

Trout C3 Human C3 Rabbit C3b Rat C 3 Mouse C3 Cui. Pig C3 Xenopus C3b Cobra C3 Lamprey C3 Hagfish C3 Human C4 Human C5 Human azM

44/59 100/100 80187 78/86 77185 78/86 46/60 51/66 32/48 31/47 28/43 28/45 21/35

Amino Acid Sequence Identity/Similarity

60180 100/100

45/60 100/100

NA

NA

100/100 1 0011 00 1oo/r 00

76/86 71/83 71/83

42/50 100/100 75/83 831'3 2 75183 50/58

NA

NA

NA

80180 40140 40140 60160 40160 0120

50174 2 9143 41/62 40155 29/44 23/48

25/42 25/42 36146 1 7/42 38/48 33133

H' Binding Site Residues 1422-1432

Binding to Hu C3 Ligands

CR2 CR1

"

H

+

B

"

8219 1 + + + + 100/100 91/100 821100 + + N D + + +ND 7311 00 100/100 ND + 5 82191 + + " + 821100 ND ND ND ND 73/82 ND ND ND ND ND 45/64 ND + " " 36/64 " " 18145 64/82

+

+ +

+

+

+

P

+ + +

+

ND

_ " "

_ " "

"The percentage of identities and similarities are rounded to the nearest integer. For the reactivities of different C3 with human C3 ligands and mapping of human C3 binding sites, see refs. 1, 13. Partial amino acid sequence; ND, not done; NA, not available sequence for these sites.

surroundingthe thiolester bondin C3, C4, and a2further analysis. macroglobulin is relatively hydrophobic and it has been Comparison of the C3 amino acid sequences among speproposed that it serves to shield thethiolester from the aquecies and correlation of this information with the ability of ous environment and nucleophilic attack (16, 17, 41, 42). these C3 to bind the different ligands and receptors is inIn vitro mutagenesis experimentshave suggested that prostrumental in identifying structural features of C3 that are lines at position 1007 and 1020 are necessary for stable important for its functionality, The different C3 molecules thiolester formation(39).isconserved in trout C3 and and homologous proteins such as C4, C5, and a2PloZ0is replaced by leucine. Whether this mutation is commacroglobulin serve as natural analogues and yield information on which C3 residues arecritical for ligand binding. pensated by proline in position 1021 or the replacementsin other positions is not clear. Although mutation of P1007by Investigations by Chothia and Lesk (37) have shown that G destabilizes the thiolester, it appears from the trout C3 75% divergence in amino acid sequence of homologous and the replacement of P1020by H in rabbit C3 that some proteins leads to less than 2 A rms divergence in backbone substitutions are allowed. Other replacements in the surstructure. This suggest that the tertiary structure of C3 from rounding region of the thiolester site are S1008by V, and different species will be approximately the same (38). The Gly1017 by Y. Further work will be required to define the comparative analysis of C3 interactions was used successdifferences and the role the different residues play in the fully in analyzing the structural elements involved in the formation of the thiolester. formation of thiolester bond (39) and in proving that the Comparison of the amino acid sequences within the other RGD sequence is not involved in CR3 binding (40). The C3 functional sites shows different degrees of similarity latter is further supported by the presence of NSE sequence (Table I). The similarity in P, C3aR binding sites, and thiin trout C3 instead of the RGD sequence in human C3 (Figs. 2 and 4). olester site is higher than the overall similarity between the different C3 (Table 11). It is anticipated that conserved All C3 so far tested containa thiolester bond in the a-chain. Comparison of the amino acid sequences of C3 amino acid sequences are arranged in clusters that may be from different species (Fig. 4) revealed that the segment associated with the functionally conserved sites. Because containing the thiolester bond is highly similar; the thiligands must evolve to match each other, the necessity for olester site, GCGEQ,is 100% conserved in all species. This dual evolution is expected to make changes at these sites conservation of the thiolester bond and its surrounding hyto proceed slower. When the trout C3 was compared with drophobicaminoacidsemphasizethefunctionalimporthe sequences of C3from other species, such clusters tance of this region in maintaining throughout evolution the of sequence conservation were indeed identified for the thiolester and properdin binding site. molecules capacity to fix itself onto surfaces. The region

FIGURE 3. Nucleotide and amino acid sequence of trout C3-I. The translated amino acids are in single-letter code. The Pa junction site and N-linked glycosylation sites are indicated by * and x, respectively. Underlined protein sequences indicate sequences thathave been confirmed by Edman degradation of C3 a- and P-chains and zymosan elutedand tryptic C3 fragments. Underlined nucleotide sequences indicate the position of oligonucleotides.

Ii BINDING

l uuLPBTOD” FsEmvKGDP

DLLQVAEUUL PRpP.LIvSAL

I

AQ-LL WXVSDOAAKV *DPBs~s

. . . . . . . . . II . . . . . . . . . I . . . . . . . ..L

LBnLmATIQ ADSRLPIDDR”.

. . . . . . . ..A

-mYm tulxIBBPYL.Q

. . . . . . . . .I . . . . . . . ..I . . . . . . . ..L

I

l-l BINDING CR2 -_.-

SITE BS --

FIGURE 4. Comparison of the deduced trout C3 amino acid sequence with mammalian, reptilian, osteichthian, amphibian, and cyclostome C3 sequences and sequences of other homologous proteins. Gaps, introduced for maximal sequence alignment, are denoted by periods. Boxed sequences indicate areas that correspond to the human C3 functional sites (1, 13).

61 32

TROUT C3

Tr

A FIGURE 5. SDS-PAGE electrophoresis of trout and human fragments elutedfrom zymosan. The zymosan C3 fragments were prepared as described in Materials and Methods. A : Fragments eluted after reduction of zymosan-iC3bwith 2-ME. B : fragments eluted after treatmentof zymosan-iC3b with hydrazine (was preeluted as in A).

9

9

Hu

Tr

B

.-

+

-97

"43" Kd

-43

46 43

-31

-31

-21 -15

-21 -15

f3 Chain

+

As it relates to the CR1, CR2, H, and B functional sites, the comparative analysis of the interaction of these ligands with thedifferent C3 has beeninstrumental in dissecting the functional sites in human C3. Allthese ligands share structural (43,44) and functional similarities (13,45,46) and all four proteins bind to a region in human C3 spanning residues 727-768 (47-49); two of them, H and CR2, bind to an additional site located within residues 1187-1249 of C3 (50). The findings that human CRl and CR2 but not H bind to Xenopus iC3 and that H but not CR1 and CR2 interacts with trout iC3 suggest that, although these three molecules recognize the same domains in human C3,their exact binding sites are different. In addition, the inability of human factor B to bind to either trout or Xenopus C3 suggests that its binding site on human C3b is different from that for H and CR1. Thus, the ability of H and CR1 to compete with B for binding to C3b may be due to an allosteric or steric effect and not to a competition for the same binding site(s). The segment of trout C3 spanning residues 1199-1214 shows low amino acid similarity with the corresponding segment of human C3 that binds CR2. This is in agreement with the inability of trout C3 to bind to human CR2 and suggests thatall or some of the following C3 residues, ~ 1 1 9 9Dl200 Kl203 ~ 1 2 0 4N1207, and Vl208, , are involved in CR2 binding. The analysis of the Con A binding to C3 from different species revealed that in contrast to human and rabbit C3, which contain Con A-binding carbohydrates in both the aand P-chains, trout C3, like frog and axolotl C3, lacks this moiety in the a-chain (26). This suggests that the a-chain potential glycosylation site isnot glycosylated. The absence of carbohydrates in the a-chain of trout C3 is of particular interest because the a-chain carbohydrate moiety onhuman C3 isinvolved in the binding to conglutinin (51, 52). Thus, it will be of interest to determine whether trout have a protein analogous to bovine or human conglutinin and whethersuch a protein exists to test its binding specificity. The conservation of Arg726Ser727in the a-chain of the 9

Hu

46

68 Kd

+

-97

different C3 suggests that the C3 convertases from these species have similar specificities as in human complement. The inactivation of C3b by factor I proceeds in three steps (53-58) and requires one of the several cofactor molecules (membrane cofactor protein, CRl, CR2, H, C4bp). The cleavage of the a-chain of C3b first between residues 1281-1282 (Arg-Ser) andbetween residues 1298-1299 (Arg-Ser) of C3 liberates the C3f fragment (M,2000) and yields iC3b (53-56). A third factor I cleavage site, with CR1, CR2, or factor H serving as cofactors (53-55,57), has been reportedto occur at residues 932-933 (Arg-Glu) of the a-chain of C3, generating the C3c and C3dg fragments (56). Nilsson-Ekdahl etal. (58) suggested that factor I generates three different C3dg-like fragments. Their NH2terminal starts at residues 933 (cleavage between Arg-Glu), 939 (cleavage betweenLys-Glu), and 919, 924, or 930 (cleavage between Lys-Thr, Arg-Thr, or Arg-Leu). The cleavages by factor I in the region between residues 918940 and the specificity of factor I have been a debatable issue and so far no conclusive experiments havebeen performed to clarify these issues. As it relates to the factor I-mediated cleavages, of interest are the findings (based on cDNA sequencing) that 1) ArgAla and Arg-Thr are found instead of Arg-Ser at the first and second factor I cleavage sites of trout C3 (Fig. 4) and 2) His-Gly is found instead of Arg-Glu at the third factor I cleavage site of trout C3 (residue 932-933). Currently, it is unknown whether trout factor I cleaves trout C3 at ArgAla and bonds His-Gly. By sequencing the zymosan eluted trout C3 fragments we foundthattrout factor I indeed cleaves C3b at the Arg-Thr bond.These data taken together with degradation of C4 (59,60) support our hypothesis that factor I in the presence of the suitable cofactor can cleave R-S/T bonds and that some of the observed cleavages may be mediated by enzyme@) other than I. The latter is supported by the presence of sequences His-Thr, His-Leu,and Gln-Gly at the proposed factor I cleavage site in rabbit, mouse, and rat C3 (Fig. 4). Site-directed mutagenesis experiments and sequencing of factor I generated fragments


of C3 from different species will help elucidate the factor I specificity and its dependence on the different cofactors. Another segment of trout C3 showing high amino acid similarity with the corresponding segment of human C3 is that between residues 1424-1432; this segment in human C3 mediates P binding (61). However the Ser1432in human C3 is Lysin trout C3. We found that trout C3 does not bind to human P and a peptide spanning residues 1424-1433 of trout C3 does not inhibit the binding of human C3 to human P. These data emphasize the importance of S1432in C3b-P interaction.

Acknowledgments We thank Dr. C. Tsoukas for critical readingof our manuscript and Yang Wang and Sabine Opermmann for excellent technical assistance.

References 1. Lambris, J. D. 1993. Chemistry, biology and phylogeny of C3. Complement Profiles 1:16. 2. Dodds, A. W., and Day, A. J. 1993. The phylogeny and evolution of the complement system. Immunol. Med. 20:39. 3. De Bruijn, M. H. L., and G. H. Fey. 1985. Human complement component C3: cDNA coding sequence and derived primary structure. Proc. Natl. Acad. Sci. USA 82:708. 4. Auerbach, H. S., R. Burger, A. Dodds, andH.R. Colten. 1990. Molecular basis of complement C3 deficiency in guinea pigs. J . Clin. Invest. 86:96. 5. Wetsel, R. A., A. Lundwall, F. Davidson, T. Gibson, B. F. Tack, and G. H. Fey. 1984. Structure of murine complement component C3. 11. Nucleotide sequence of cloned complementary DNA coding for the alpha chain. J. Biol. Chem. 259:13857. 6. Lundwall, A., R. A. Wetsel, H. Domdey, B. F. Tack, and G. H. Fey. 1984. Structure of murine complement component C3 1: nucleotide sequence of cloned complementary and genomic DNA coding for the P chain. J. Biol. Chem. 259:13851. 7. Misumi, Y., M. Sohda, and Y. Ikehara. 1990. Nucleotide and deduced amino acid sequence of rat complement C3. Nucleic Acids Res. 18:2178. 8. Ishiguro, H., K. Kobayashi, M. Suzuki, K. Titani, S. Tomonaga, and Y. Kurosawa. 1992. Isolation of a hagfish gene that encodesa complement component. EMBO J . 11:829. 9. Nonaka, M., and M. Takahashi. 1992. Complete complementary DNA sequence of the 3rd component of complement of Lamprey: implication for the evolution of thioester containing proteins. J. Immunol. 148:3290. 10. Fritzinger, D. C., E. C. Petrella, M. B. Connelly, R. Bredehorst, and C. W. Vogel. 1992. Primary structure of cobra complement component C3. J . lmmunol. 149:3554. 11. Kusano, M., N. H. Choi, M. Tomita, K. Yamamoto, S. Migita, T. Sekiya, and S. Nishimura. 1986. Nucleotide sequence of cDNA and derived amino acid sequence of rabbit complement component C3 alpha-chain. lmmunol. Invest. 15:365. 12. Grossberger, D., A. Marcuz, L. Du Pasquier, and J. D. Lambris. 1989. Conservation of structural and functional domains in complement component C3 of Xenopus and mammals. Proc. Natl. Acad. Sci. USA 86:1323.

61 3 3 13. Lambris, J. D. 1988. Themultifunctional role of C3, the third component of complement. Immunol. Today 9:387. 14. Hase, S., N. Kikuchi, T. Ikenaka, and K. Inoue. 1985. Structures of sugar chains of the third component of human complement. J. Biochem. 98:863. 15. Hirani, S., J. D. Lambris, and H. J. Muller-Eberhard. 1986. Structural analysis of the asparagine-linked oligosaccharides of human complement component C3. Biochem. J . 233:613. 16. Tack, B. F. 1983. The P-Cys-y-Glu thiolester bond in human C3, C4, and a2-macroglobulin. Springer Semin. Immunopathol. 6:259. 17. Levine, R. P., and A. W. Dodds. 1990. The thiolester bond of C3. Curr. Top. Microbiol. Immunol. 153:73. 18. Volanakis, J. E. 1990. Participation of C3 and its ligands in complement activation. Curr. Top. Microbiol. Immunol. 153:l. 19. Becherer, J. D., J. Alsenz, and J. D. Lambris. 1990. Molecular aspects of C3 interactions and the structuralifunctional analysis of C3 from different species. Curr. Top. Microbiol. Immunol. 153:45. 20. Fearon, D. T. and J. M. Ahearn. 1990. Complement receptor type 1 (C3/C4b receptor; CD35) and complement receptor type 2 (CSdiEpstein-Barr virus receptor; CD21). Curr. Top. Microbiol. Immunol. 153:83. 21. Hugli, T. E. 1990. The anaphylatoxin C3a. Curr. Top. Microbiol. Immunol. 153:181. 22. Rosen, H., and S. K. A. Law. 1990. Theleukocyte cell surface receptor(s) for the iC3b product of complement. Curr. Top. Microbiol. Immunol. 153:99. 23. Doolittle, R. F., and D. F. Feng. 1990. Nearest neighbor procedure for relating progressively aligned amino acid sequences. Methods Enzymol. 183:659. 24. Nonaka, M., S. Natsuume-Sakai, andM. Takahashi. 1981. The complement system in rainbow trout (Salmo gairdneri). J. Immunol. 126:1495. 25. Nonaka, M., M. Iwaki, C. Nakai, M. Nozaki, T. Kaidoh, S. Natsuume-Sakai, and M. Takahashi. 1984. Purification of a major serum protein of rainbow trout (Salmo gairdneri) homologous to the third component of mammalian complement. J. Biol. Chem. 259:6327. 26. Alsenz, J., D. Avila, H. Huemer, I. Esparza, D. Becherer, T. Kinoshita, Y. Wang, S. Oppermann, and J. D. Lambris. 1992. Phylogeny of the third component of complement, C3: analysis of the conservation of human CR1, CR2, H and B binding sites, ConA binding sites and thiolester bond in the C3 from different species. Dev. Comp. Immunol. 16:63. 27. Nonaka, M.,M. hie, K. Tanabe, T. Kaidoh, S. NatsuumeSakai, andM. Takahashi. 1985. Identification and characterization of a variant of the third component of complement (C3) in rainbow trout (Salmogairdneri)serum. J. Biol. Chem. 260:809. 28. Brade, V., G. D. Lee, A. Nicholson, H. Shin, and M. M. Mayer. 1973. The reaction of zymosan with the properdin system in normal and C4-deficient guinea pig serum. J. Immunol. 111:1389. 29. Law, S. K., and R. P. Levine. 1977. lnteraction between the third complement protein and cell surface macromolecules. Proc. Natl. Acad. Sci. USA 74:2701. 30. Becherer, J. D., and J. D. Lambris. 1988. Identification of the C3b-receptor binding domain in the third component of complement. J. Biol. Chem. 263:14586.

61 34 31. Matsudaira, P. 1987. Sequence from picomole quantities of proteinselectroblotted onto polyvinylidene diflouride membranes. J. Biol. Chem. 262:10035. 32. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277:680. 33. Chirgwin, J., A. E. Przybla, R. J. MacDonald, and W. J. Rutter. 1979. Biochemistry 18.5194. 34. Huynh, T. V., R. A. Young, and R. W. Davis. 1988. Constructing and screening cDNA libraries in IgtlO and Igtll. In DNA Cloning: A Practical Approach. 3rd ed. D.M. Glover, ed. IRL Press, Oxford, UK, p. 49. 35. Saiki, R. K., D. H. Gelfand, S. J. Stoffel, R. Higuchi, G. T. Horn, and H. A. Erlich. 1988. Science 239:487. 36. Sanger, F. S., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463. 37. Chothia, C., and A. M. Lesk. 1986. The relation between the divergence of sequence and structure in proteins. EMBO J. 52323. 38. Pompton, D., and A. Nicolas. 1989. Protein engineering by cDNA recombination in yeasts: shuffling of mammalian cytochrome P-450 functions. Gene 83:15. 39. Isaac, L., and D. E. Isenman. 1992. Structural requirements for thioester bond formation in human complement component C3: reassessment of the role of thioester bond integrity on the conformation of C3. J. Biol. Chem. 267:10062. 40. Taniguchi-Sidle, A., and D. E. Isenman. 1992. Mutagenesis of the Arg-Gly-Asp triplet in human complement component-C3 does not abolish binding of iC3b to the leukocyte integrin complement receptor Type-I11(CR3, CDllbi CD18). J. Biol. Chem. 267:635. 41. Zhao, B., G . Musci, Y. Susawara, and L. J. Berliner. 1988. Spin label and fluorescence studies of the thiolester bonds in alpha-2-macroglobulin. Biochemistry 27:5304. 42. Fontaine, M., J. P. Aubert,F. Joisel, and J. P. Lebreton. 1982. Structure-function relations in the third component of human complement (C3)-I, hydrophobic sites. Mol. Immunol. 19:27. 43. Reid, K. B. M., D. R. Bentley, R. D. Campbell, L. P. Chung, R. B. Sim, T. Kristensen, and B. F. Tack. 1986. Complement system proteins which interact with C3b or C4b. Immunol. Today 7:230. 44. Holers, V. M., J. L. Cole, D. M. Lublin, T. Seya, and J. P. Atkinson. 1985. Human C3b- and C4b-regulatory proteins: a new multi-gene family. Immunol. Today 6:188. 45. Farries, T. C., T. Seya, R. A. Harrison, and J. P. Atkinson. 1990. Competition for binding sites on C3b by CR1, CR2, MCP factor B and factor H. Complement Inflammation 7:30. 46. Pangburn, M. K. 1986. Differences between the binding sites of the complement regulatory proteins DAF, CR1,and factor H on C3 convertases. J. Immunol. 136:2216.

TROUT C3

47. Becherer, J. D., J. Alsenz, I. Esparza, C. E. Hack, and J. D. Lambris. 1992. A segment spanning residues 727-768 of the complement C3 sequence contains a neoantigenic site and accommodates binding of CR1, factor H and factor B. Biochemistry 31 :I 787. 48. Fishelson, Z. 1991. Complement-C3: a molecular mosaic of binding sites. Mol. Immunol. 28:545. 49. Esparza, I., J. D. Becherer, J. Alsenz, A. Delahera, Z. Lao, C. D. Tsoukas,and J. D. Lambris. 1991. Evidence for multiple sites of interaction in C3 for complement receptor type-2 (C3diEBV receptor, CD21). Eur. J. Immunol. 21:2829. 50. Lambris, J. D., D. Avila, J. D. Becherer, and H. J. MullerEberhard. 1988. A discontinuous factor H binding site in the third component of complement as delineated by synthetic peptides. J. Biol. Chem. 263:12147. 51. Hirani, S., J. D. Lambris, and H. J. Muller-Eberhard. 1985. Localization of the conglutinin binding site on the third component of human complement. J. Immunol. 134:1105. 52. Thiel, S., G. Baatrup, P. Friis-Christiansen, S.-E. Svehag, and J. C. Jensenius. 1987. Characterization of a lecitin in human plasma analogous to bovine conglutinin. Scand. J. Immunol. 26:461. 53. Ross, G. D., J. D. Lambris, J. A. Cain, and S. L. Newman. 1982. Generation of three different fragments of bound C3 with purified factor I or serum. I. Requirements for factor H vs CR1 cofactor activity. J. Immunol. 129:2051. 54. Medof, M. E., K. Iida, C. Mold, and V. Nussenzweig. 1982. Unique role of the complement receptor CR1 in the degradation of C3b associated with immune complexes. J. Exp. Med. 156:1739. 55. Medicus, R. G., J. Melamed, and M. A. Arnaout. 1983. Role of human factor I and C3b receptor in the cleavage of surfacebound C3b. Eur. J. Immunol. 13:465. 56. Davis, A. E. 111, and R. A. Harrison. 1982. Structural Characterization of factor I mediated cleavage of the third component of complement. Biochemistry 21:5745. 57. Mitomo, K., T. Fujita, and K. Iida. 1987. Functional and antigenic properties of complement receptor type 2, CR2. J. Exp. Med. 165:1424. 58. Ekdahl, K. N., U. R. Nilsson, and B. Nilsson. 1990. Inhibition of factor I by diisopropylfluorophosphate:evidence of factor I conformational changes in factor I induced by C3b and additional studies on the specificity of factor I. J. Immunol. 144:4269. 59. Press, E. M., and J. Gagnon. 1981. Human complement component C4. Biochem. J. 199:351. 60. Campbell, R. D., J. Gagnon, and R. R. Porter. 1981. Amino acid sequence around the thiol and reactive acyl groups of human complement component C4. Biochem. J . 199:359. 61. Daoudaki, M. E., J. D. Becherer, and J. D. Lambris. 1988. A 34-amino acid peptide of the third component of complement mediates properdin binding. J . Immunol. 140:1577.