due to the specific properties of particles as food supplements (Chen et al. 2013). ..... Olmedo, D, Tasat, D, Guglielmotti, M, Cabrini, R. 2003. ..... GoTaq® qPCR Master Mix 2× containing BRYT Green® dye (Promega), 0.2 μM of forward.
Aus dem Lehrstuhl für Fischkrankheiten und Fischereibiologie der Tierärztliche Fakultät der Ludwig-Maximillians-Universität München Fachmentorat: Prof. Dr. Dušan Palić, Prof. Dr. Heidrun Potschka Prof. Dr. Elizabeth Whitley
Toxicity of titanium dioxide nanoparticles
Habilitationsschrift zur Erlangung der Lehrbefähigung an der Tierärztliche Fakultät der Ludwig-Maximillians-Universität München
Forschungsbereich: Nanotoxikologie
vorgelegt von
Boris Jovanović, PhD München, 2016
Copyright © Boris Jovanović, 2016. All rights reserved
ii
This thesis is dedicated to my wife Prof. Dr. Evrim Baran as an acknowledgement of hers invaluable and unconditional support, tolerance, and love. The Fourth Grace By Boris Jovanović, December 2014 Inspired by the poetry of John Keats
Hast thou dwelt when chivalry was a pathway to symmetry? If thou bided thou could see a knight that's approaching thee. Enough with virtues, I brief will be, for the knight on a steed is me. And there I am, a courteous Sir Knight roaming the lands by day and by night. Ascribed with one and only one task to avail each lady with whatever she ask. Enough with virtues, a castle ahead, lets pen the verse on lady instead. Alas, no time, verse persisted chaste as lady drew near in apparent haste. Noble Sir Knight, art thou avail me? Thou look gallant, I trust in thee. Enough with virtues, my fair maiden. Who art thou? What is thy laden? Lady Baran is my rightful name, thou hast my Tyrian hat to reclaim. A vicious beast, beareth the blame, winged scarlet dragon in midday came and stole mine hat in absence of shame. Enough with virtues, the beast deserves none for it must pay for what it hath done. O squire, bring to me my Myrmidon greaves, garb gauntlets of tempest over my sleeves. Fetch me my breastplate and judgment blade, forget not great helm, fit for crusade. Enough with virtues of cover and arms, lets slay the beast before long harms. O Noble Sir Knight receive my blessing, may thou encounter nothing distressing. To keep thou safe, pink hankie - relic of love, I'll fasten at once on thy metal glove. Enough with virtues of love and heart, a quest awaits, fare thee well - time to depart. My glove, my heart, and all of my soul adjoined with thine hankie, burns like a coal. Heat of thine hankie open'd my sight, at present I see thee under full light. My fair maiden, I'd been deceived. Thou art not just lady as I believed. Ate, Loki, and Hypnos methinks conspired together in a sly hoodwinks. Clouded mine eyes with mist of illusion
5
10
15
20
25
30
35
40
45
iii
so when I meet thee to feel delusion. Deception is over, now I can see. Euprosyne, Algea, or Thalia thou must be. No wait, three Graces are no more out of the sudden there are four. Who was the fourth conjured Grace? For which thou stood right in her place. Twas neither Euprosyne, Thalia, nor Algea certainly twas not false Pasithea. No wait anew; deep-rooted love feeling in me speaks out loudly. Fourth Grace is thee!!! Enough with virtues, thy Grace, I'm fain. To fetch thine hat, malefic dragon I have to slain. A goodly length in times past. My steed and I, made it at last. A smell of brimstone in the air herald existence of dragon lair. Inside the hollow, a rumbling sound bespoke the advent of trembling ground. A pair of red, almond shaped, eyes grew heavy, as the smoke began to rise. *Dragon, dragon, crimson, bright come on out for a fight. Without hammer, without chain I will shatter thy stupid brain. Enough with virtues, lets not pretend thy fearful symmetry I'll bring an end. Fire and smoke, thundering roar; poured out of den in a galore. Winged scarlet dragon in all of its might opened the jaws, ready to smite. Enough with virtues, I am a targe here comes a dragon in a full charge. Out on the field a scene to behold, a fearsome mêlée slowly unfold. Dragon and knight locked in a battle, Tyrian-purple hat claim trying to settle. Enough with virtues, enough with pain; a fearful symmetry hath been slain. Victor emerged, drenched in blood. With hat in hand mounted a stud. Down on the meadow, engulfed in ooze lay now a serpent bound to lose. Once a grand dragon, a wyrm, a drake hath been reduced to a dead snake. Enough with virtues, enough with hassle Lets move fast forward, towards a castle. Back at the castle, down at the gates Lady Baran already awaits. My Grace, dragon is no more, I brought thine hat, just as I swore. Please, thou dost not kneel, arise noble Sir Knight and name thy prize. My Grace, no reward cann be as grand as an honor to kiss thine hand.
50
55
60
65
70 (This is an allusion to the William Blake's poem - Tiger)
75
80
85
90
95
100
iv
"To see a world in a grain of sand And a heaven in a wild flower, Hold infinity in the palm of your hand, And eternity in an hour." William Blake (1757 - 1827)
v
TABLE OF CONTENTS ABSTRACT ......................................................................................................................... viii ZUSAMMENFASSUNG ...................................................................................................... ix CHAPTER 1. Thesis organizattion.......................................................................................... 1 CHAPTER 2. Critical review of public health regulations of titanium dioxide, a human food additive .................................................................................................................................... 3 2.1. Abstract ......................................................................................................................... 3 2.2. Introduction................................................................................................................... 4 2.2.1. Occurrence and Industrial Characteristics of TiO2 .................................................... 5 2.2.2. Global Production Estimate of TiO2 for the Period 1916-2012 ................................. 7 2.2.3. Policy Review of TiO2 as a Food Ingredient and Associated Risks According to Governmental Agencies....................................................................................................... 8 2.3. Methodology ............................................................................................................... 11 2.4. Results......................................................................................................................... 13 2.5. Discussion ................................................................................................................... 24 2.6. References................................................................................................................... 29 2.7. Tables and figures ....................................................................................................... 35 CHAPTER 3. Effects of titanium dioxide (TiO2) nanoparticles on Caribbean reef-building coral (Montastraea faveolata) ............................................................................................... 39 3.1. Abstract ....................................................................................................................... 39 3.2. Introduction................................................................................................................. 40 3.3. Materials and methods ................................................................................................ 41 3.4. Results......................................................................................................................... 47 3.5. Discussion ................................................................................................................... 50 3.6. References................................................................................................................... 54 3.7. Tables and figures ....................................................................................................... 57 CHAPTER 4. Efficacy of the hatching event in assessing the embryo toxicity of the nanosized TiO2 particles in zebrafish: A comparison between two different classes of hatchingderived variables .................................................................................................................... 63 4.1. Abstract ....................................................................................................................... 63 4.2. Introduction................................................................................................................. 63 4.3. Materials and methods ................................................................................................ 65 4.4. Results......................................................................................................................... 69 4.5. Discussion ................................................................................................................... 71 4.6. References................................................................................................................... 73 4.7. Tables and figures ....................................................................................................... 77 4.8. Supporting information ............................................................................................... 83 CHAPTER 5. Effects of human food grade titanium dioxide nanoparticles dietary exposure on Drosophila melanogaster survival, fecundity, pupation, and expression of antioxidative genes ...................................................................................................................................... 84
vi
5.1. Abstract ....................................................................................................................... 84 5.2. Introduction................................................................................................................. 85 5.3. Materials and methods ................................................................................................ 86 5.4. Results......................................................................................................................... 92 5.5. Discussion ................................................................................................................... 94 5.6. References................................................................................................................... 99 5.7. Tables and figures ..................................................................................................... 103 CHAPTER 6. Histopathology of fathead minnow exposed to hydroxylated fullerenes ..... 107 6.1. Abstract ..................................................................................................................... 107 6.2. Introduction............................................................................................................... 108 6.3. Materials and methods .............................................................................................. 110 6.4. Results....................................................................................................................... 112 6.5. Discussion ................................................................................................................. 115 6.6. References................................................................................................................. 119 6.7. Tables and figures ..................................................................................................... 124 CHAPTER 7. Titanium dioxide nanoparticles increased mortality of fish exposed to bacterial pathogens .............................................................................................................. 166 7.1. Abstract ..................................................................................................................... 166 7.2. Introduction............................................................................................................... 131 7.3. Materials and methods .............................................................................................. 134 7.4. Results....................................................................................................................... 139 7.5. Discussion ................................................................................................................. 142 7.6. References................................................................................................................. 146 7.7. Tables and figures ..................................................................................................... 150 7.8. Supporting information ............................................................................................. 163 CHAPTER 8. Review of titanium dioxide nanoparticle phototoxicity: Developing a phototoxicity ratio to correct the endpoint values of toxicity tests ...................................... 166 8.1. Abstract ..................................................................................................................... 166 8.2. Introduction............................................................................................................... 167 8.3. Materials and methods .............................................................................................. 168 8.4. Results....................................................................................................................... 171 8.5. Discussion ................................................................................................................. 173 8.6. References................................................................................................................. 177 8.7. Tables and figures ..................................................................................................... 181 CHAPTER 9. In situ effects of titanium dioxide nanoparticles on community structure of freshwater benthic macroinvertebrates ................................................................................ 188 9.1. Abstract ..................................................................................................................... 188 9.2. Introduction............................................................................................................... 189 9.3. Materials and methods .............................................................................................. 190 9.4. Results....................................................................................................................... 194 9.5. Discussion ................................................................................................................. 195
vii
9.6. References................................................................................................................. 199 9.7. Tables and figures ..................................................................................................... 201 CHAPTER 10. Food web effects of titanium dioxide nanoparticles in an outdoor freshwater mesocosm experiment ......................................................................................................... 204 10.1. Abstract ................................................................................................................... 204 10.2. Introduction............................................................................................................. 205 10.3. Materials and methods ............................................................................................ 208 10.4. Results..................................................................................................................... 216 10.5. Discussion and conclusions .................................................................................... 220 10.6. References............................................................................................................... 225 10.7. Tables and figures ................................................................................................... 229 10.8. Supporting information ........................................................................................... 237 CHAPTER 11. GENERAL CONCLUSIONS .................................................................... 240 8.1. Conclusions............................................................................................................... 240 8.2. Recommendations for future research ...................................................................... 241
viii
ABSTRACT
Titanium dioxide nanoparticles (TiO2) have the potential to cause adverse effects on the health of aquatic animals and humans, but the understanding of the underlying mechanisms is limited. Major task of this thesis was to connect gaps in the current knowledge of TiO2 toxicology and mode of action with a comprehensive research including molecular, cellular, organismal, and ecosystem responses toward environmentally relevant concentrations TiO2 in a variety of tests organisms or in situ aquatic ecosystems. The research was divided into following steps: 1) Assess current governmental legislations regarding the usage and safety of TiO2 as an human food additive and evaluate the need for toxicological reassessment; 2) Perform series of specifically targeted toxicology experiments on standard model species of interest (freshwater, marine, and terrestrial organisms); 3) Reevaluate the standard exposure methodology in terms of light conditions; 4) Perform a higher tier toxicity tests such as community structure analysis and in situ outdoor mesocosms tests in order to determine the impact level of TiO2 on the whole aquatic ecosystem. The main results of this thesis are: 1) There is a disagreement with the 1969 decision to approve the use of TiO2 as an inactive ingredient in human food without an established acceptable daily intake, stating that neither significant absorption nor tissue storage following ingestion of TiO2 was possible; 2) TiO2 exposure is causing premature hatching in freshwater fish, is delaying pupation and hatching in fruit flies, and is causing a stress to marine corals, however these effects occur at concentrations higher than environmentally relevant concentrations; 3) Exposure to environmental estimated concentration of nano-TiO2 significantly increased fish mortality during Aeromonas hydrophila and Edwardsiella ictaluri challenge by modulating fish immune responses and interfering with resistance to bacterial pathogens, thus having the potential to affect fish survival in a disease outbreak; 4) The first semi-quantitative histopathology scoring system of fish exposed to nanoparticles was presented and tested; 5) It was concluded that TiO2 is phototoxic and that especially order Cladocera appeared to be very sensitive and prone to TiO2 phototoxicity; 6) Environmentally relevant concentration of TiO2 can affect up to 39 % of the
ix
macroinvertebrate community structure; and finally 7) Environmentally relevant concentrations of TiO2 nanoparticles may negatively affect certain parameters and taxa of the freshwater lentic aquatic ecosystem, however, these negative effects are not big enough to affect the overall function of the ecosystem, as there were no cascade effects leading to a major change in its trophic state or primary production.
ZUSAMMENFASSUNG
Titandioxid-Nanopartikel (TiO2) haben das Potential, sich nachteilig auf die Gesundheit von im Wasser lebenden Organismen und Menschen auszuwirken, jedoch ist das Verständnis der zugrunde liegenden Mechanismen begrenzt. Hauptaufgabe der vorliegenden Arbeit war es, Lücken im derzeitigen Kenntnisstand der TiO2 Toxikologie und der TiO2 Wirkungsweise zu schließen. Dies geschah mit umfassender Forschung an einer Vielzahl von Testorganismen oder in situ aquatischer Ökosysteme, um molekulare, zelluläre und organismischen Fragen zu beantworten und Reaktionen des Ökosystems auf umweltrelevante Konzentrationen von TiO2 zu untersuchen. Die Forschung wurde in die folgenden Schritte unterteilt: 1) Beurteilung der aktuellen staatlichen Gesetzgebungen in Bezug auf den Nutzung und die Sicherheit von TiO2 als menschlichem Lebensmittelzusatzstoff und die Bewertung der Notwendigkeit für eine toxikologische Neubewertung; 2) Durchführung einer Reihe von gezielten toxikologischen Versuchen an Standardmodellen der Spezies, welche von Interesse sind (im Süßwasser lebende, in marine Umgebung lebende und terrestrische Organismen); 3) eine Re-Evaluation der standardisierten Untersuchungsmethodik in Bezug auf die Lichtverhältnisse; 4) das Durchführen eine höhere Stufe von Toxizitätstests wie die gemeinsame Strukturanalyse und Tests am in situ Mesokosmos, um die Ausmaße der Auswirkungen von TiO2 auf das gesamte aquatische Ökosystems zu bestimmen. Die wichtigsten Ergebnisse dieser Arbeit sind: 1) Es gibt eine Meinungsverschiedenheit mit der Entscheidung von 1969, was die Verwendung von TiO2 als Hilfsstoff in der menschlichen Nahrung angeht, ohne eine
x
zulässige Tagesdosis zu bestimmen, welche besagt, dass weder signifikante Absorption, noch Gewebespeicherung nach der Einnahme von TiO2 möglich ist; 2) TiO2 Exposition verursacht das vorzeitige Schlüpfen von Süßwasserfische, die verzögerte Verpuppung und Schlupf bei Fruchtfliegen und verursacht eine Belastung für marine Korallen, jedoch treten diese Effekte bei Konzentrationen von mehr als umweltrelevanten Konzentrationen auf; 3) Die Exposition von geschätzt in der Umwelt vorkommende Konzentration des nano-TiO2 verursacht eine deutlich erhöhte Fischsterblichkeit bei Infektionen mit Aeromonas hydrophila und Edwardsiella ictaluri durch eine veränderte Immunreaktion der Fische und eine Wechselwirkung mit den bakteriellen Pathogene, wodurch das Potential der Fische, bei einem Krankheitsausbruch zu überleben, beeinflussen wird; 4) Das erste halbquantitative histopathologische Bewertungssystem von Fischen, welche Nanopartikeln ausgesetzt wurden, wurde vorgestellt und getestet. 5) Es wurde festgestellt, dass TiO2 phototoxisch ist und dass vor allem die Ordnung der Cladocera sehr empfindlich und anfällig für TiO2 Phototoxizität zu sein scheint; 6) umweltrelevante Konzentration von TiO2 können bis zu 39% der Makroinvertebraten einer Gemeinschaftsstruktur beeinflussen; und schließlich 7) umweltrelevante Konzentrationen von TiO2-Nanopartikel können sich negativ auf bestimmte Parameter und Taxa von stillstehenden, aquatische Süßwasserökosystem auswirken, jedoch sind diese negativen Auswirkungen nicht groß genug, um die Gesamtfunktion des Ökosystems zu beeinflussen, da es keine Kaskadeneffekte gab, die zu eine große Veränderung in ihrem trophischen Zustand oder der Primärproduktion führen.
1
CHAPTER 1. Thesis organization
The habilitation thesis is organized in the alternative format and includes nine manuscripts which are published, or are in press. Eight publications investigated toxicity of titanium dioxide while one publication investigated toxicity of hydroxylated fullerenes nanoparticles. The hydroxylated fullerenes, a well studied nanomaterial with known mode of action, were used as a model for developing semi-quantitative histopathology score to be later used with titanium dioxide in a follow up publication. Each of the manuscripts is represented as a separate thesis chapter in the form prepared for publication. The manuscripts are not presented in their chronological order of publications dates, but are instead presented in an order which gives a more meaningful structure to the habilitation thesis.
Publications presented in the habilitation thesis 1. Jovanović, B. (2015). Critical review of public health regulations of titanium dioxide, a human food additive. Integrated Environmental Assessment and Management 11 (1), 10-20. 2. Jovanović, B. & Guzmán, H. (2014). Effects of titanium dioxide (TiO2) nanoparticles on Caribbean reef-building coral (Montastraea faveolata). Environmental Toxicology and Chemistry 33 (6), 1346-1353. 3. Samaee, S-M., Rabbani, S., Jovanović, B., Mohajeri-Tehrani, M.R. & Haghpanah,V. (2015) Efficacy of the hatching event in assessing the embryo toxicity of the nanosized TiO2 particles in zebrafish: A comparison between two different classes of hatching-derived variables. Ecotoxicology and Environmental Safety 116, 121-128. 4. Jovanović, B., Cvetković, V.J. & Mitrović, T.Lj. (2016) Effects of human food grade titanium dioxide nanoparticles dietary exposure on Drosophila melanogaster survival, fecundity, pupation, and expression of antioxidative genes. Chemosphere 144, 43-49.
2
5. Jovanović, B., Whitley, E. & Palić, D. (2014) Histopathology of fathead minnow exposed to hydroxylated fullerenes. Nanotoxicology 8, 755-763. 6. Jovanović, B., Whitley, E. Kimura, K., Crumpton, A. & Palić, D. (2015) Titanium dioxide nanoparticles enhance mortality of fish exposed to bacterial pathogens. Environmental Pollution 203, 153-164. 7. Jovanović, B. (2015). Review of titanium dioxide nanoparticle phototoxicity: Developing a phototoxicity ratio to correct the endpoint values of toxicity tests. Environmental Toxicology and Chemistry 34 (5), 1070-1077. 8. Jovanović, B., Milosević, Dj., Stojković-Piperac, M., Savić, A. (accepted for publication) In situ effects of titanium dioxide nanoparticles on community structure of freshwater benthic macroinvertebrates. Environmental Pollution. 9. Jovanović, B., Bezirci, G., Çağan, A.S., Coppens, J., Levi, E.E., Oluz, Z., Tuncel, E., Duran, H., Beklioğlu, M. (In press) Food web effects of titanium dioxide nanoparticles in an outdoor freshwater mesocosm experiment. Nanotoxicology.
3
CHAPTER 2. Critical review of public health regulations of titanium dioxide, a human food additive
Boris Jovanović. Paper published in Integrated Environmental Assessment and Management 11 (1), 10-20. Boris Jovanović is single author and coresponding author on the paper.
2.1 ABSTRACT From 1916-2011, an estimated total of 165,050,000 metric tonnes of titanium dioxide pigment were produced worldwide. Current safety regulations on the usage of the TiO2 pigment as an inactive ingredient additive in human food are based on legislation from 1969 and are arguably outdated. This paper compiles new research results to provide fresh data for potential risk re-assessment. However, even after 45 years, few scientific research reports have provided truly reliable data. For example, administration of very high doses of TiO2 is not relevant to daily human uptake. Nevertheless, since dose makes the poison, the literature provides a valuable source for understanding potential TiO2 toxicity after oral ingestion. Numerous scientific papers have observed that TiO2 can pass and be absorbed by the mammalian gastrointestinal tract; can bioconcentrate, bioaccumulate, and biomagnify in the tissues of mammals and other vertebrates; has a very limited elimination rate; and can cause histopathological and physiological changes in various organs of animals. Such action is contrary to the 1969 decision to approve the use of TiO2 as an inactive ingredient in human food without an established acceptable daily intake, stating that neither significant absorption nor tissue storage following ingestion of TiO2 was possible. Thus, relevant
4
governmental agencies should reassess the safety of TiO2 as an additive in human food and consider establishing an acceptable maximum daily intake as a precautionary measure.
Keywords: Titanium dioxide, E171 food additive, toxicology, risk assessment, oral ingestion.
2.2 INTRODUCTION The first and only risk assessment of TiO2 as a food additive was performed by the Joint FAO/WHO Expert Committee on Food Additives (JECFA) in 1969, who concluded: "Titanium dioxide is a very insoluble compound. The studies in several species, including man, show neither significant absorption nor tissue storage following ingestion of titanium dioxide. Establishment of an acceptable daily intake for man is considered unnecessary" (JECFA 1969). Any subsequent re-evaluations have largely cited the initial assessment and added no new or particularly important data to the discussion. The aim of this manuscript is a critical review of the conclusion of the original expert group. This paper collects results from independent scientists and research laboratories from the last 45 years in order to provide fresh data toward potential risk re-assessment. Furthermore, this paper brings forward the conclusions of governmental expert groups such as the National Cancer Institute and European Commission on the potential toxicology of TiO2 to compare against the more recent conclusions of independent scientists. Given the rapid pace of industry production and deposition of nano/micro TiO2 and the outdated environmental and human health regulations regarding TiO2 discharge and consumption, now is the time to perform proper tests on its toxicity and mode of action .
5
Such results will provide governments with solid, reliable data to be used in risk assessment. The efficacy of the current USA and EU government policies on restriction and use of TiO 2 is dubious. TiO2 is found in food both in its bulk form and as a nanomaterial; in fact, at least 36% of the TiO2 present in food is in nanoform (Weir et al. 2012). Recently, Justo-Hanani and Dayan (2014) performed a review of governmental regulatory policies for nanomaterial risk based on the claim that the states of the world (including the USA) have only "limited power" in transnational nanotechnology risk regulation, while the global private nanotechnology sector has the real power. Examples include private standards on nanoterminology, toxicity guidelines, and voluntary risk management partnerships (EDDuPont 2007; ISO 2010). Although the final conclusion of Justo-Hanani and Dayan (2014) was that governments have much more regulatory power over nanotechnology rulemaking and are not as easy influenced by the private sector as previously thought they are still undergoing large nanotechnology adaptations. 2.2.1 Occurrence and Industrial Characteristics of TiO2 TiO2 can naturally occur in four different mineral forms: anatase, brookite, rutile, and titanium dioxide (B). Brookite has no commercial value and is not being industrially produced, and titanium dioxide (B) has an extremely small market and is usually only used in the production of titanium nanowires (Armstrong et al. 2004). Therefore, rutile and anatase are the only important crystal structures of TiO2 used in commercial products (DuPont 2007). The refractive index is 2.56 and 2.49 for anatase and 2.60-2.61 and 2.892.90 for rutile (Phillips and Griffen 1981). Anatase is a much more active UV catalyst then rutile.
6
The main sources of industrial extraction of TiO2 are mineral and ore deposits. Rutile and anatase mineral deposits may contain up to 95% of TiO2. However these minerals are difficult to extract from primary rocks and never leach out. They can be extracted only from sands in which they are associated with other minerals, and such deposits are rare. Significant rutile deposits of such quality have been found in Australia and South Africa, while anatase is common in Brazil. The majority of the TiO2 pigment used in consumer products
is
being
extracted
from
ilmenite
ore
(FeTiO3)
and
leucoxene
ore
(TiO2.xFeO.yH2O), either by sulfate or chloride processing. Under natural conditions, TiO2 is the least soluble common constituent on the planet, and geochemical balances are constructed assuming TiO2 is immobile (E. Force, personal communication, May 22, 2013). Thus, under natural conditions, TiO2 is predominantly found in "bound state" and is not readily available to interact with the biota. In industry terminology, the size of TiO2 particles refers to the primary particle, essentially single crystals bound by crystal planes. Most commercial products contain TiO2 particles with a size range of 200-300 nm, and commercial pigments rarely use sizes < 100 nm. In order to achieve the most efficient light scattering effect, the TiO2 pigment diameter should be somewhat less than one half the wavelength of light to be scattered. The human eye is most sensitive to a wavelength of 0.55 microns; therefore, the ideal particle size of TiO2 is 200 nm (DuPont 2007). Coatings are frequently used to improve dispersion, durability, and gloss of the TiO2 pigment. TiO2 used as a food additive most often does not contain any artificial coatings, but in all other consumer products, it contains 1-15% of artificial coatings by weight, most commonly oxyhydrates and oxides of silicone and aluminum (IARC 2010).
7
2.2.2 Global Production Estimate of TiO2 for the Period 1916-2012 Nearly six million metric tonnes of TiO2 were consumed worldwide in 2012 as a pigment (USGS 2013). It is unknown what percentage of this quantity can be attributed to nano-TiO2, but Robichaud et al. (2009) estimated that by 2012, close to 5% of all production could be attributed to nanoform amounts. The same report suggested that by 2023, up to 50% TiO2 might be manufactured in nanoform (Robichaud et al. 2009); however, this number might be an overestimate since the most desirable particle size is 200 nm (DuPont 2007). Production of TiO2 was started in 1916 by the Titan Co. (Norway) and what is now known as NL Industries, Inc. (USA). TiO2 was first produced in the USA by the Titanium Pigment Company. In 1925, the National Lead Company purchased a large interest in the Titanium Pigment Company, and production reached 4,000 US short tons. Later, the National Lead Company became NL Industries, Inc., a predecessor of Kronos. By 1971, there were eight US producers of TiO2. This paper estimates that from 1916-2011, a total of 165,050,000 metric tonnes of TiO2 were produced worldwide (Figure 1). These estimates are based on international and national reports, as well as company sources collected on the Internet. The United States was the leading producer until 2010, when it was surpassed by China. The United States produced approximately 35-40% of the world’s TiO2 until 1993, when China began an exponential growth spurt. Before 1955, China produced no TiO2, but by 2010, they had produced 1,475,000 metric tonnes per year, accounting for 29% of the world market. In 2011, China produced nearly 2,000,000 metric tonnes, a 35% share of the global market. Figure 1 represents total production of TiO2 (anatase and rutile) in all industrial sectors; it is
8
not known how much TiO2 is used as a food additive or ends up in the environment each year. 2.2.3 Policy Review of TiO2 as a Food Ingredient and Associated Risks According to Governmental Agencies The Joint FAO/WHO Expert Committee on Food Additives performed the first and only toxicological evaluation of titanium dioxide safety as a food color/additive in 1969 during a one-week meeting in Rome (JECFA 1969), concluding that TiO2 did not call for established daily intake levels due to its insolubility. "Titanium dioxide is a very insoluble compound. The studies in several species, including man, show neither significant absorption nor tissue storage following ingestion of titanium dioxide. Establishment of an acceptable daily intake for man is considered unnecessary" - end of citation. The assessment considered only five published references when making its recommendation for approval of the use of TiO2 in human food. All five studies reported no significant effects on animals, yet one of these references (Brown and Mastromatteo 1962) had nothing to do with TiO 2. The paper only investigated the toxicity of Ba, Bi, Ca, and Pb titanate. The other four papers explored TiO2 oral exposure, intramuscular injections, or intraperitoneal injections in humans, rats, dogs, rabbits, cats, and guinea pigs. Although studies that clearly showed absorption and accumulation effects as early as 5 minutes after exposure (Huggins and Froehlich 1966) were available at the time, they were never considered by the expert group. The two main features on which the expert group based their opinion were lack of absorption and lack of accumulation in body tissue. In 1979, with TiO2 already being an official ingredient of human food, the US government performed the first large scale study trying to link cancer to oral exposure to
9
TiO2. This task was performed by the toxicologists of the National Cancer Institute (National Toxicology Program 1979). Groups of 50 rats of each sex and 50 mice of each sex were given 25000 ppm or 50000 ppm of TiO2 in their diets for 103 weeks and then observed for 1 additional week. No tumors occurred in dosed groups at incidences significantly higher than those for corresponding control groups. Thus, it was concluded that TiO2 was not carcinogenic by the oral route for Fischer 344 rats or B6C3F1 mice. However this study only evaluated the effects of bulk TiO2 and did not consider the effects of nano-TiO2. The International Agency for Research on Cancer (IARC) performed the last reassessment of TiO2 cancer potential in 2010 (IARC 2010). IARC classified TiO2 as a human carcinogen group 2B, since there was enough evidence that nano-TiO2 may cause lung cancer by exposure through inhalation. That classification states, "The agent (mixture) is possibly carcinogenic to humans. The exposure circumstance entails exposures that are possibly carcinogenic to humans." This category is used for chemicals for which there is limited evidence of carcinogenicity in humans and less than sufficient evidence of carcinogenicity in experimental animals. It may also be used if there is sufficient evidence of carcinogenicity in experimental animals but inconclusive evidence of carcinogenicity in humans. Oral exposure was debated by IARC, but the final report was inconclusive due to non-existing standardized procedures for nano-TiO2 risk assessment, as outlined in the journal NanoEthics (Jacobs et al. 2010). In the USA, use of TiO2 as a food coloring agent has been permitted since the year 1966 (Federal Register 1966), three years before the official assessment by JECFA. The US Food and Drug Administration (FDA) allows the use of TiO2 as a food additive as long as its weight does not exceed 1% of overall food weight (FDA 2005). The federal regulation
10
states: "Certification of this color additive is not necessary for the protection of the public health and therefore batches thereof are exempt from the certification requirements of section 721(c) of the act." Japanese authorities, on the other hand, allow the use of TiO2 as a food coloring agent without any limitations whatsoever (JETRO 2011). Meanwhile, India restricts the use of TiO2 as a food additive to 1% of the food weight in chewing gum and 0.01% in powdered concentrate mixes for the production of beverages (FSS 2011). In countries where there is no limit imposed on the quantity of TiO2 in chewing gum, the average concentration is approximately 2 mg g-1, and over 93% is in nanoform (Chen et al. 2013). The European Union allows TiO2 in its food products in most cases at quantum satis levels under good manufacturing practices, with the exception of a few food products in which it is not allowed at all (European Parliament 1994). In 2013, the European Commission’s Scientific Committee on Consumer Safety (EU-SCCS) endorsed and published its opinion on nanoform titanium dioxide (European Commission 2013). Three independent, non-food scientific committees provided the Commission with advice for policy preparation relating to consumer safety. EU-SCSS provided opinions concerning all types of health and safety risks of non-food consumer products and services containing nano-TiO2. Regarding oral toxicity, they analyzed only 7 reports. Two of these papers were characterized as flawed and rejected, namely Wang et al. (2007) and the previously mentioned findings of the National Cancer Institute (National Toxicology Program 1979). Wang et al. (2007) was rejected with the following explanation: "The study has a number of flaws, and is therefore of little value to this assessment. Sufficient characterisation of the nanomaterials used was not carried out, the administered dose (5 g/kg/bw) was very high, frequent oesophageal ruptures were reported that led to
11
animal deaths, translocation of TiO2 from GI tract was measured as titanium with no evidence that it was in nanoparticulate form. It is not clear whether any of the effects observed were due to TiO2 toxicity, or simply overloading the gut at high dose of the particulate material" - end of citation. For the National Cancer Institute report (1979), EUSCSS stated: "No information has been provided on the particle size profile of the material tested in this study. The study is therefore of little value in relation to the current assessment for nanoforms of TiO2." Ultimately, five reports were analyzed: three non peer-reviewed, publicly unavailable internal studies of industrial giants that produce TiO 2 (two by Evonik Degussa, one by DuPont) and two peer-reviewed papers (Duan et al. 2010; Hu et al. 2010). Based on the findings of Duan et al. (2010) and Hu et al. (2010), EU-SCSS concluded that a LOAEL of 5 mg kg-1 body weight day-1 may be derived for nano-TiO2. An early study suggested that average daily human consumption of TiO2 in the UK was 5.4 mg per person (MAFF 1993). Later, a more precise estimate become available with daily estimated human consumption of TiO2 food grade (E171) of 0.2-2 mg kg-1 body weight per day (Weir et al. 2012), which is close to this estimated LOAEL value. 2.3 METHODS Methodology of Data Collection and Studies Published by Independent Scientists A recent review of potential toxicity of nanomaterials to humans through oral exposure revealed only two valid scientific studies dealing with TiO2 (Card et al. 2010). The main reason for such a small number was the rather strict focus of a review on nanomaterials. The authors did not consider studies with a particle diameter > 100 nm. The current review, on the other hand, did not discriminate between "nano" (< 100 nm) and "micro" (> 100 nm) TiO2. Thus, all available studies that investigated toxicity of TiO2 after
12
oral administration were collected, and for all cases particle size was reported. The literature search was performed within five databases—Web of Science, Scirus, Scopus, Google Scholar, and the University of British Columbia library database—using the following keywords in various combinations: titanium dioxide, TiO2, oral exposure, oral administration, toxicity, ADME, bioaccumulation, mammals, rats, mice, nanotoxicology, and risk assessment. Abstracts of numerous hits were read, and downloaded papers were evaluated according to 10 characteristics:
Papers must be written in English.
The administered dose must be close to the estimated human daily exposure of 0.2-2 mg kg-1 body weight per day (Weir et al. 2012).
The crystal structure of TiO2 must be reported (preference was always given to anatase, which is used as food additive in overwhelming majority compared to rutile; only one paper investigating rutile toxicity was included in the final list,).
The primary particle size of TiO2 must be reported.
The hydrodynamic diameter of TiO2 must be reported.
The volume (liquid) or weight (bolus, gavage, food) of the carrier of the orally administered dose must be reported.
The weight of the test animals must be measured and reported.
Testing groups must consist of ten or more animals.
The experimental animals must be mammalian, and the experiments must be performed in vivo.
The performed study must be chronic (at least 90 days long).
13
Interestingly, not a single published scientific study satisfied all designated criteria, indicating a deficiency of good laboratory practice in the current literature regarding toxicity of TiO2. Studies matching at least two thirds of the criteria (score 6/10) were analyzed, and the rest of the studies were discarded. One of the most common missing points was the lack of the volume/weight of the carrier (bolus, gavage, etc.) used to deliver TiO 2 orally, which only appeared in two studies. Other common instances of non-reported important information included lack of hydrodynamic diameter or lack of crystal phase info. Very often, the TiO2 dose exceeded the potential dose that a human could consume on a daily basis. Further, the duration of the studies was acute in many cases, with some as short as five days. Thus, although independent scientific laboratories provided important insight on the potential toxicity of oral consumption of TiO2, good laboratory practice was not strictly followed in the majority of the cases. A total of 16 plausible studies were identified according to the stated criteria (Table 1). Of those, 15 reported toxic effects and/or bioaccumulation of TiO2, while only a single study detected no negative effects. Mice were the model species in 11 studies, rats in 5. 2.4 RESULTS Dietary Exposure to TiO2 and Associated Risks According to Scientific Community As a recent review paper has already discussed the uptake of TiO2 particles via the oral route, including absorption, barriers, and passage through barriers (Frӧhlich et al. 2013), this paper will not focus on details of these issues. We will only focus on the size limit of particles that can be absorbed by intestinal cells. A comprehensive review of current toxicological data of TiO2 can be found in Shi et al. (2013) and Iavicoli et al. (2012).
14
Penetration of food grade TiO2 (E171) into enterocytes of rats has been experimentally confirmed in vivo in the past (Onishchenko et al. 2012). Briefly, TiO2 particles in the intestines are typically found in the anatase crystal form with spherical particle diameter size 100-200 nm (Powell et al. 2010). E171 is claimed by manufacturers (if the information is provided at all) to have a primary particle size around 200 nm (Lomer et al. 2000); therefore, no approval for nanomaterial additive is needed. However, the actual average particle diameter of E171 in food products is 110 nm, with at least 36% of particles < 100 nm and a particle diameter range of 30-400 nm (Weir et al. 2012). Five different powder or paste samples of E171 around the world were analyzed for primary particle and hydrodynamic diameter. Results showed that the average primary particle diameter was between 106 nm and 132 nm with at least 17%-35% particles being 0.05, df = 38) One-Way ANOVA was deployed to test for the effects of two different nano-TiO2 concentrations on zooxanthellae abundance irrespective of the time interval. Indeed, post-hoc comparison of One-Way ANOVA across all of the time intervals together revealed that there is a statistically significant decrease of zooxanthellae abundance (Figure 2B) in the group treated with 10 mg L-1 nano-TiO2 as opposed to control (Dunnet's procedure; P < 0.05, df = 44). The observed decrease in zooxanthellae abundance in the group treated with 0.1 mg L-1 nano-TiO2 was not statistically significant, although the P value was small (Dunnet's procedure; P = 0.16; df = 44). The average number of zooxanthellae (± SEM) in the control group was 0.57 ±0.05 X 107 per cm2; 0.49±0.04 X 107 per cm2 for 0.1 mg L-1 nano-TiO2 group; and 0.43±0.04 X 107 per cm2 for 10 mg L-1 nano-TiO2 group. The number of zooxanthellae in treatment groups represent 14% and 25% decrease from the control group respectively. Gene expression analysis revealed that the gene for the heat-shock protein 70 (HSP70) was upregulated by the treatment at time point 48 hours compared to control (ANOVA; P < 0.01), but not at 7 or 17 days. Addition of 0.1 mg L-1 of nano-TiO2 increased the expression of HSP70 five folds, while addition of 10 mg L-1 of nano-TiO2 increased the expression of HSP 70 19 times (Figure 3). Immune genes for annexin and echinonectin were showing signs of
49 upregulation as well, however these findings were not statistically significant (ANOVA and Dunnett’s procedure, P > 0.05; data not presented). Other genes did not show any signs of upregulation/downregulation. Titanium concentrations in coral tissue and in mixture of burrowing sponges, fungi, bacteria, etc. from posterior side of coral fragments are presented in Table 3. Average concentration (± standard error of the mean) of titanium in controls was 2.82 (±0.51) mg L-1 for coral tissue and 11.82 (±0.97) mg L-1 in the case of posterior mixture of burrowing sponges, fungi, and bacteria etc (N=3). It was assumed that the source of titanium detected in control samples is due to naturally occurring dissolved titanium in world oceans [14] and sediments associated with corals (titanium is 9th most abundant element in Earth’s crust [15]). Thus, any titanium excess above these empirical concentrations, in samples from experimental treatments, was attributed to nano-TiO2 added to the experimental tanks. The following equation was used to calculate concentration of TiO2. TiO2 conc = (Ti experimental group - Ti control group) * mass ratio of TiO2/Ti. Values of 2.82 and 11.82 mg L-1 were subtracted from corresponding experimental treatments before converting the mass of excessive Ti concentration to nano-TiO2 mass. After 17 days of exposure to 0.1 mg L-1 and 10 mg L-1 of nano-TiO2 bioconcentration factor was 62 and 238 (0.1 mg L-1) and 2 and 594 (10 mg L-1) for coral tissue and posterior mixture respectively. Detected concentrations in posterior mixture of burrowing sponges, fungi, and bacteria were significantly higher than the concentrations from coral tissue for each experimental group (t-test, P < 0.05). ICP-MS revealed that the concentration of Ti in the control seawater was 0.007 mg L-1, which is in accordance with the concentration of Ti in the waters of the world oceans (0.0010.009 mg L-1) [16]. Thus, any titanium excess above these empirical concentrations, in samples
50 of seawater from experimental treatments, was attributed to nano-TiO2 added to the experimental tanks. Figure 4 showed the change of the concentration of nano-TiO2, in the water column with the exposure duration, as determined by ICP-MS. Concentration of 0.1 mg L-1 did change over time. After the initial exposure to 0.1 mg L-1 a portion of TiO2 have formed large aggregates and left the water column (settled on the bottom or attached to the aquarium walls). Thus the concentration in the water column dropped to approximately 0.07 mg L-1 on day 2 of the exposure. After 50% water/TiO2 renewal (performed every four days) the actual concentration of TiO2 in the water column began to slowly rise and reached its peak of 0.3 mg L-1 after the last water change. Effective exposure concentration at the very end (0.3 mg L-1) was higher than the initial exposure concentration (0.1 mg L-1). This suggests that during the water draining process TiO2 particles were adsorbed by the tank walls and being re-suspended after the addition of renewal suspension. Thus the effective concentration in the water column to which the coral fragments were exposed was dynamic and increased slowly from 0.07 mg L-1 to 0.3 mg L-1 over time. Higher concentration of 10 mg L-1 aggregated more severely and the part present in the water column was more or less constant - around 1 mg L-1 with the exception of the first renewal (day 4). During the day 4 the suspended TiO2 in the water column was at 5 mg L-1.
3.5 Discussion This study outlined the possibility of nano-TiO2 to interfere with the symbiotic relationship between polyp and algae by reducing algae population inhabiting the polyp. Usual number of zooxanthellae in control samples of M. faveolata is 0.3 X 107 per cm2 - 0.6 X 107 [1719]. Average zooxanthellae number in the control samples of this experiment was 0.57 X 107 per cm2 which falls within the expected range. The usual documented bleaching after experimental
51 exposure to various stressors without lethal effects in M. faveolata is up to 30% loss/expulsion of zooxanthellae which is considered as "slight bleaching" [18]. The more severe "partial bleaching" is documented at the rate of 42% loss/expulsion of zooxanthellae when the coral starts to lose its colour and become pale [18]. In this experiment the decrease of zooxanthellae in 0.1 mg L-1 of nano-TiO2 and 10 mg L-1 of nano-TiO2 treatment groups was 14% and 25% relative to the control group respectively, which can be characterized as "slight bleaching". Early studies have shown that metals such as copper could cause coral bleaching [20], thus it is possible that other metals and metal compounds can express similar trend. Exposure of nano-TiO2 to natural levels (from the sun) of UV radiation can photoactivate TiO2 which then become toxic to marine phytoplankton [21]. The main mechanism of nano-TiO2 phototoxicity is oxidative stress and increased production of ROS. Oxidative stress has been implicated in nano-TiO2 photocatalytic inactivation of Anabaena, Microcystis, and Melosira algae [22]. Exposure to environmental stress (in particular oxidative stress) does promote photoinhibition by inhibition of photosystem II protein synthesis and interruption of CO2 fixation [23]. Photoinhibition is often attributed as the biochemical cause for the zooxanthellae expulsion and coral bleaching [24]. Zooxanthellae decrease in photosynthesis rate, after photoinhibition, has been observed [25], and it has been suggested that ROS generated in TiO2 photoinhibition process will decrease photosynthesis rate in marine phytoplankton as well [21]. Thus, based on previous references it is plausible to expect that TiO2 can cause zooxanthellae expulsion. Stress mediated zooxanthellae expulsion hypothesis, after nano-TiO2 treatment, is further supported by the upregulation of gene for heat-shock protein 70 in this study. HSP70 is a general biomarker for stress, and it can be induced either by heat [26], oxidative stress 27,28], or by other stressors 29,30]. Once the stressful condition is over, or the organism has overcome the
52 stress and adapted to the new condition, the expression of HSP70 gene returns to basal level. In this study HSP70 gene was upregulated after 48 h of exposure to nano-TiO2 compared to control, but there was no statistical difference in the expression at days 7 and 17 compared to the control. No mortality of corals was recorded during the study. This suggests that initial introduction of nano-TiO2 caused a short-term acute stress in corals characterized by slight zooxanthellae expulsion and bleaching, and that subsequent or continuous exposure to nano-TiO2 did not have further deleterious effects indicating physiological acclimation. The possibility of the acclimation phase that we have observed in this study after exposure to nano-TiO2 is similar to the acclimation observed after sublethal exposure of corals to increased sedimentation [31]. However, coral response to chronic oil/sediment pollution can show sublethal effects years later impairing growth and reproduction 32,33]. Nano-TiO2 exposure is similar to sediment exposure in that both increase water turbidity and reduce available light for photosynthesis. In addition, both can physically cover the coral. If corals suddenly get exposed to higher sublethal concentration of sediments than they are usually exposed to, they do get stressed. However, corals can overcome such stress by increasing their respiration rate, increasing the polyp rate of active clearing of the sediment particles with tentacles or cilia, or they entangle particles in mucous and immobilize them to interact with coral cells [31]. In this study, bioconcentration factor in coral tissues was negligible (as supported by ICP-MS results) comparing to bioconcentration on nano-TiO2 in posterior mixture of burrowing sponges, fungi, bacteria, etc. First of all, nano-TiO2 particles are heavy and they tend to aggregate in sea water as evidenced by DLS measurements. Second, nano-TiO2 particles do not stay in initial concentration in the water column and do fall down as aggregates. This is especially evidenced by ICP-MS water analysis (Figure 4B). With the increasing concentration
53 of nano-TiO2 suspension in seawater, nano-TiO2 aggregates more readily, leaves the water column and becomes part of the sediment. Second, the active clearing of sediments from surface tissues exhibited by corals likely entrap nano-TiO2 in mucous. Ciliary movements of polyps push nano-TiO2 further towards the posterior area of coral, where it is permanently admixed with fungi, bacteria, burrowing sponges and incorporated into the coral reef as a building block material. Here, in posterior segment, nano-TiO2 presents an additional threat. Being a strong bactericide [34] it has the potential to exert chronic toxicity on bacterial and fungal mat communities of the coral reefs. According to the additive effects of stressors it is expected that the localized stressor may have additive / synergistic value on global stressors. In fact, mass bleaching of coral reefs has been shown to occur more frequently nowadays than in the past, and the extent cannot be fully justified by ocean warming alone. Other effects such as ocean acidification, pollution, overfishing, UV light, etc. must be taken into consideration in addition to temperature changes alone. The modest ability of nano-TiO2 to cause short term stress and slight zooxanthellae expulsion should not be disregarded, as it is unknown how would corals react if exposed to additional stressors beside nano-TiO2. Concentration of nano-TiO2 is steadily rising in aquatic environment due to increased industry use, and current lack of regulations on nanoparticle discharge into the environment poses a cause for concern. The toxicity of TiO2 combined with global warming and other environmental stressors remains largely unknown and should receive more attention in the future.
Acknowledgements
54 This study was partially funded by the Smithsonian Tropical Research Institute Shortterm Fellowship Program. We owe our most sincere gratitude to Carlos Guevara and Aldo Croquer who collected coral specimens, and the Government of Panama for providing the necessary permits to collect and export the specimens. We are also thankful to Reinhard Niessner and Christine Sternkopf from Institute of Hydrochemistry, Technical University of Munich, Germany, who advised on, and performed ICP-MS analysis. We are also thankful to Hatice Duran from TOBB University of Ankara, Turkey, who helped with TiO2 dry powder characterization. In addition, we are thankful to Giles Goetz from National Oceanic and Atmospheric Administration (NOAA) of Seattle, US, for bioinformatics support.
3.6 References 1. 2. 3.
4.
5. 6.
7. 8.
9.
Palmer CV, Bythell JC, Willis BL. 2010. Levels of immunity parameters underpin bleaching and disease susceptibility of reef corals. The FASEB Journal 24:1935-1946. Hoegh-Guldberg O. 1999. Climate change, coral bleaching and the future of the world's coral reefs. Marine and Freshwater Research 50:839-866. Danovaro R, Bongiorni L, Corinaldesi C, Giovannelli D, Damiani E, Astolfi P, Greci L, Pusceddu A. 2008. Sunscreens Cause Coral Bleaching by Promoting Viral Infections. Environmental Health Perspectives 116:441-447. Melquiades FL, Ferreira DD, Appoloni CR, Lopes F, Lonni AG, Oliveira FM, Duarte JC. 2008. Titanium dioxide determination in sunscreen by energy dispersive X-ray fluorescence methodology. Analytica Chimica Acta 613:135-143. Mueller NC, Nowack B. 2008. Exposure modeling of engineered nanoparticles in the environment. Environmental Science and Technology 42:4447-4453. FDA. 1999. Sunscreen drug products for over the counter human use. FDA Department of Health and Human Services. Federal Register, Rules and Regulations, 64. 21CFR Parts 310, 352, 700 and 40, RIN 0910-AA01.:27666–27693. Newman MC. 2013. Quantitative Ecotoxicology. Second eddition. CRC Press. Boca Raton, FL, USA. Kiser MA, Westerhoff P, Benn T, Wang Y, Pérez-Rivera J, Hristovski K. 2009. Titanium Nanomaterial Removal and Release from Wastewater Treatment Plants. Environmental Science & Technology 43:6757-6763. Westerhoff P, Song G, Hristovski K, Kiser MA. 2011. Occurrence and removal of titanium at full scale wastewater treatment plants: implications for TiO2 nanomaterials. Journal of Environmental Monitoring 13:1195-1203.
55 10.
11. 12.
13. 14. 15. 16. 17.
18.
19.
20. 21. 22.
23. 24.
25.
26.
Chomczynski P, Sacchi N. 2006. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty-something years on. Nature Protocols 1:581-585. Zhao S, Fernald RD. 2005. Comprehensive algorithm for quantitative real-time polymerase chain reaction. Journal of Computational Biology 12:1047-1064. Rodriguez-Lanetty M, Phillips WS, Dove S, Hoegh-Guldberg O, Weis VM. 2008. Analytical approach for selecting normalizing genes from a cDNA microarray platform to be used in q-RT-PCR assays: A cnidarian case study. Journal of Biochemical and Biophysical Methods 70:985-991. Domotor SL, D'elia CF. 1986. Cell-size distributions of zooxanthellae in culture and symbiosis. The Biological Bulletin 170:519-525. Orians KJ, Boyle EA, Bruland KW. 1990. Dissolved titanium in the open ocean. Nature 348:322-325. Barksdale J. 1968. Titanium. The encyclopedia of the chemical elements; Reinhold Book Corporation: Skokie, IL, pp 732-738. IPCS. 1982. Environmental Health Criteria 24- Titanium. International programme on chemical safety. ISBN 92 4 154084 2.1-68. Cruz-Piñón G, Carricart-Ganivet JP, Espinoza-Avalos J. 2003. Monthly skeletal extension rates of the hermatypic corals Montastraea annularis and Montastraea faveolata: biological and environmental controls. Marine Biology 143:491-500. Desalvo MK, Voolstra CR, Sunagawa S, Schwarz JA, Stillman JH, Coffroth MA, Szmant AM, Medina M. 2008. Differential gene expression during thermal stress and bleaching in the Caribbean coral Montastraea faveolata. Molecular Ecology 17:3952-3971. Toller WW, Rowan R, Knowlton N. 2001. Repopulation of Zooxanthellae in the Caribbean Corals Montastraea annularis and M. faveolata following Experimental and Disease-Associated Bleaching. The Biological Bulletin 201:360-373. Jones RJ. 1997. Zooxanthellae loss as a bioassay for assessing stress in corals. Marine Ecology Progress Series 149:163-171. Miller RJ, Bennett S, Keller AA, Pease S, Lenihan HS. 2012. TiO2 Nanoparticles Are Phototoxic to Marine Phytoplankton. PLoS One 7:e30321. Kim S-C, Lee D-K. 2005. Preparation of TiO2-coated hollow glass beads and their application to the control of algal growth in eutrophic water. Microchemical Journal 80:227-232. Takahashi S, Murata N. 2008. How do environmental stresses accelerate photoinhibition? Trends in Plant Science 13:178-182. Smith DJ, Suggett DJ, Baker NR. 2005. Is photoinhibition of zooxanthellae photosynthesis the primary cause of thermal bleaching in corals? Global Change Biology 11:1-11. Warner ME, Fitt WK, Schmidt GW. 1996. The effects of elevated temperature on the photosynthetic efficiency of zooxanthellae in hospite from four different species of reef coral: a novel approach. Plant, Cell & Environment 19:291-299. Hayes RL, King CM. 1995. Induction of 70-kD heat shock protein in scleractinian corals by elevated temperature: significance for coral bleaching. Molecular Marine Biology and Biotechnology 4:36-42.
56 27.
28.
29.
30.
31. 32.
33. 34.
Bajszar G, Dekonenko A. 2010. Stress-induced Hsp70 gene expression and inactivation of Cryptosporidium parvum oocysts by chlorine-based oxidants. Applied and Environmental Microbiology 76:1732-1739. Wong S, Leung P, Djurišić A, Leung K. 2010. Toxicities of nano zinc oxide to five marine organisms: influences of aggregate size and ion solubility. Analytical and Bioanalytical Chemistry 396:609-618. Rossi S, Snyder MJ. 2001. Competition for space among sessile marine invertebrates: Changes in HSP70 expression in two Pacific cnidarians. The Biological Bulletin 201:385393. Tomanek L, Sanford E. 2003. Heat-shock protein 70 (Hsp70) as a biochemical stress indicator: an experimental field test in two congeneric intertidal gastropods (Genus: Tegula). The Biological Bulletin 205:276-284. Rogers C. 1990. Responses of coral reefs and reef organisms to sedimentation. Marine Ecology Progressive Series 62:185-202. Guzmán HM, Burns K, Jackson JBC. 1994. Injury, regeneration, and growth of Caribbean reef corals after a major oil spill in Panama. Marine Ecology Progressive Series 105:231-241. Guzmán HM, Holst I. 1993. Effects of chronic oil-sediment pollution on the reproduction of the Caribbean reef coral Siderastrea siderea. Marine Pollution Bulletin 26:276-282. Coleman HM, Marquis CP, Scott JA, Chin SS, Amal R. 2005. Bactericidal effects of titanium dioxide-based photocatalysts. Chemical Engineering Journal 113:55-63.
57 3.7 Tables and figures
Table 1. Montastraea. faveolata ESTs extraction from GenBank database and assembly
Average length in nucleotides # of successfully annotated sequences Approximate redundancy (%)
Total ESTs extracted from database
Matched (went into contigs)
33206 632
28435
Contigs assembled
Remaining singlets
7102
4771 848
3884
2386
57
52
58 Table 2. List of genes used in BRYT Green qPCR expression analyses
GW269597.1
Best annotated hit (blastx) ribosomal protein L12 [Montastraea franksi]
contig
Accession #
Hit accession # ACO48296.1
% of identity 91/94 (96%) 14/14 (100%
echinonectin [Lytechinus variegatus]
AAC32598.2
contig
ferritin [Hyriopsis cumingii]
E-value
Primer sequence (F-forward, R-reverse)
Annealing temp. ºC
3.00E-47
F - TACAACTGACACCTTGGCCT R - ACTCATCCACACAGCCATCA
58 58
64/129 (49%) 57/126 (45%)
2.00E-29
F - AGTCCCAGCACCATTCAACT R - CAACACAAGGAAGGAACGCA
58 58
ADK25061.1
93/127 (73%)
3.00E-47
F - AGCCCATCAGGTTGAAGAGA R - TGGACTTGGAGAAGCACGTT
58 58
contig
interleukin-1 receptorassociated kinase 1binding protein 1 [Crassostrea gigas]
ADW09009.1
81/199 (40%)
7.00E-36
F - GACTGCACAAACACAGGCTT R - AGTGTAAATCGCCGAGTGGA
58 58
GW262556.1
annexin [Oncorhynchus tshawytscha]
AAX76804.1
81/199 (40%) 49/204 (24%) 24/63 (38%)
2.00E-34
F - AGGCAGGACAAGGGAAGAAA R - TAACCAGCACACGAGTGACA
60 60
contig
cryptochrome CRY1 [Acropora millepora]
ABP97098.1
117/138 (84%) 100/124 (80%)
6.00E-125
F - ACTCCACTCGGCATCAAGAA R - GCTGCCAACAATCCACACTT
61 61
contig
heat shock protein 70 [Pocillopora damicornis]
BAD89540.1
147/163 (90%)
2.00E-68
F - TCGCCGATCTGGTTCTTCAA R - ATCTCACTGGAATCCCACCT
58 58
contig
calmodulin [Geodia cydonium]
CAA76405.1
68/147 (46%)
8.00E-25
F - GCTTCTGGTGAAATGCGTCA R - ATCCAACACGTTAGGGCAGT
58 58
contig
catalase [Anemonia viridis]
AAZ50618.1
106/152 (69%)
1.00E-59
F - AACAGTCATGGAGCGTCTGT R - TTCAGCGCACAAATTCCAGG
58 58
59 Table 3. Concentration of Ti measured by ICP-MS in Montastraea faveolata coral tissue after 17 days of continuous exposure to nano-TiO2. (N=3 per experimental group; total N=36). Exposure concentration (nano-TiO2 mg L-1)
Average Ti concentration ( mg L-1)
SEM ( mg L-1)
Coral tissue
0
2.82
±0.51
Coral tissue
0.1
6.54
±2.56
6.19
Coral tissue Posterior mixture of burrowing sponges, fungi, bacteria, etc. (PMSFB)
10
12.76
±4.38
16.58
0
11.82
±0.97
PMSFB
0.1
26.06
±2.07
23.76
PMSFB
10
3572.05
±1578.24
5940.97
Sample
Average nano-TiO2 concentration ( mg L-1)
% of total nanoparticles detected
60
45 40 35 30 25 20 15 10 5 0 1400 nm
Hydrodynamic diameter (nm)
# of zooxanthellae per cm 2 (x107)
Figure 1. *
0.800 0.700
*
0.600 0.500 0.400 0.300 0.200 0.100 0.000 48 h
7 days
17 days
0.70
7
# of zooxanthellae per cm (x10 )
A
*
2
0.60 0.50 0.40 0.30 0.20 0.10 0.00
B
Figure 2.
1
61 0.12
Heat-shock protein 70
0.10
0.08
0.06
0.04
0.02
0.00 Control
0.1 mg/L
10 mg/L
Concentration of TiO 2 in water (ppm)
Figure 3.
0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 day 2
Concentration of TiO 2 in water (ppm)
A
day 4
day 6
day 8
day 10
day 13
day 15
5.00 4.50 4.00 3.50 3.00 2.50 2.00 1.50 1.00 0.50 0.00
B
Figure 4.
day 2
day 4
day 6
day 10
day 13
day 15
62 Figure captions
Figure 1. Size distribution of nano-TiO2 suspension. Water of Caribbean Sea was used as a medium. PDI=0.48; Z=-9.16 mV.
Figure 2. Changes in number of zooxanthellae per cm2 in control coral fragments and fragments exposed to nano-TiO2. A) Changes in number over time; B) Changes in number irrespective to time frame. Colours: dark grey – control; light grey - nano-TiO2 0.1 mg L-1; striped - nano-TiO2 10 mg L-1. Error bars represents standard deviation from the average value. * indicates that the effect is statistically significant (P < 0.05). (For A N=6, per experimental group; For B N=18, per experimental group).
Figure 3. Nano-TiO2 effect on M. faveolata gene expression for heat-shock protein 70, 48 hours after exposure. The changes in expression are presented as normalized R0 values to gene for ribosomal protein L12 (y-axis) and are unitless. Boxes refer to standard errors and whiskers refer to standard deviations. (N=6, per experimental group).
Figure 4. Change in concentration of nano-TiO2 in water column with time, as determined by ICP-MS. In plot A starting concentration was 0.1 ppm, and 50% of TiO2 suspension in water was renewed every 4 days. In plot B starting concentration was 10 ppm, and 50% of the TiO2 suspension in water was renewed every 4 days.
63 CHAPTER 4. Efficacy of the hatching event in assessing the embryo toxicity of the nano-sized TiO2 particles in zebrafish: A comparison between two different classes of hatching-derived variables Samaee, S-M., Rabbani, S., Jovanović, B., Mohajeri-Tehrani, M.R. & Haghpanah,V. Paper published in Ecotoxicology and Environmental Safety 116, 121-128. Samaee, S-M. and Boris Jovanović contributed equally to this paper.
4.1 Abstract The aim of the present study was to evaluate the nano-TiO2 toxicity to zebrafish embryos through evaluating the success in hatching in relationship with hours post-exposure instead of considering just the total hatching rate. Zebrafish embryos 4 hours post-fertilization were exposed to nTiO2 (0, 0.01, 10, and 1000 µg mL-1) for 130 hours. The hatching rate (HR) was calculated for each concentration (treatment). The HR magnitude was significantly (p0.01) among themselves. 1
mHR-34
78 Table 2. Names and values related to the 4 HR.hpe-derived variables considered in the present study. No. HR.hpe-derived variables nTiO2 concentrations (µg ml-1)*
1 2
Variables name
Description of the HR.hpe-derived variables
0
co
Constant (co) of HR.hpe
42.1(c)
x of HR.hpe
1.10(c)
x
(n=100)
(SD=3.0; CV=7.2) (SD=0.00; CV=2.9)
3 4
F r2
F-statistics of HR.hpe Explanatory effect of HR.hpe
0.01
10
(n=100)
(n=100)
37.0(b)
36.3(b)
(SD=3.7; CV=9.9)
(SD=5.2; CV=14.3)
1.03(b)
1.07(bc)
(SD=0.05; CV=4.9)
(SD=0.05; CV=5.0)
111.4(d)
74.5(c)
60.0(b)
(SD=7.4; CV=6.7)
(SD=9.8; CV=13.1)
(SD=8.9; CV=14.9)
0.80(d) (SD=0.01; CV=1.4)
0.73(c)
0.69(b)
(SD=0.03; CV=4.1)
(SD=0.04; CV=6.0)
1000 (n=100) 4.4(a) (SD=2.2; CV=50.8)
0.8(a) (SD=0.06; CV=7.9)
39.1(a) (SD=8.3; CV=21.2)
0.58(a) (SD=0.05; CV=8.0)
*Sample number (n) = 100 embryos in each treatment. Totally 400 embryos. The values were compared by ANOVA with subsequent Duncan post hoc test. Two values which share one of the signs ( a,b,c,d) are not significantly different (p>0.01) among themselves.
79 Figure 1. Adsorption of nTiO2 suspension to the chorion of zebrafish embryos. a - control; b - 0.01 μg mL-1 nTiO2; c - 10 μg mL-1 nTiO2; and d - 1000 μg mL-1 nTiO2.
Figure 2. Timely hatched zebrafish embryo in the control (a, c, e) and prematurely hatched zebrafish embryo exposed to 1000 μg mL-1 nTiO2 (b, d, f). a, b, c, d, and f - 62 hpf (58 hpe); e - 86 hpf (82 hpe).
Figure 3. Scatter plots showing the magnitude of hatching rate (HR%) in relationship with hour post-exposure (hpe) at different concentrations of nTiO2. N: number of samples. See Table 1 for abbreviations. Sample number (n) = 100 embryos per treatment. Totally 400 embryos.
Figure 4. A dendrogram representing significant differences (confirmed by MANOVA; p 0.1).). The survival rate of the control population was 97 % both for larvae and for adults (Table 1). Survival rate of the larvae exposed to E171 TiO2 was slightly lower and ranged between 92 %, in the lowest concentration, and 85 % at higher concentrations (Table 1). However, the E171 TiO2 treatment affected the development of D. melanogaster larvae and significantly delayed reaching the pupa stage (Figure 1). The effect was dose-dependent and it was highly significant for all of the tested TiO2 concentrations when compared to the control (chisquare test, p < 0.001; and Fischer's exact test p < 0.002). Development time was also affected by the treatments (ANOVA p < 0.001; and Dunnet's procedure p < 0.01) and it was significantly increased in the treated groups (Table 1). Effectively, group treated with the highest concentration of E171 TiO2 reached pupa and adult stadium 48 h after the control group. Adults were emerging from the pupa stadium without any apparent difficulties and the great majority looked healthy with normal phenotype. However, in 2 adults (one in TiO2 2 mg mL-1, and another in TiO2 0.02 mg mL-1) out of 240 exposed larvae a specific aberrant phenotype was observed. The same type of distortions of thorax
93
94 was observed in both flies but on different sides of the thoraxes (Figure 2). Distorted side of the torax did not have wing while the opposite side looked normal and did have wing. There was no significant difference in the fecundity of D. melanogaster between treatments (rANOVA, p >> 0.05), although fecundity was biggest in the control with 15.4 ± 0.9 eggs per female per day. Fecundity of the females exposed to TiO2 was between 12.8 ± 2 and 14.5 ± 3.3 eggs per female per day (Table 2). ICP-MS analysis confirmed that the larvae exposed for 4 days to TiO2 2 mg mL-1 in feeding medium have ingested 1002 ± 105 µg g-1 body weight of TiO2. There was no difference in the titanium content of the adults emerging from TiO2 treated larvae when compared to the control. Gene expression analysis showed that after 4 days of larvae exposure to TiO 2 expression of catalase and superoxide dismutase 2 was significantly down-regulated (Figure 3) in late third instar larvae tissue. Expression of catalase was dose-dependent and it was reduced to 37 % and 25 % of the control values in the TiO2 0.2 mg mL-1 and TiO2 2 mg mL-1, respectively (Dunnet's procedure p < 0.05). Superoxide dismutase 2 expression was downregulated only in the TiO2 0.2 mg mL-1 with 28 % of the control value (Dunnet's procedure p < 0.05). Expression of superoxide dismutase 2 in the TiO2 2 mg mL-1 group was 73 % of the control, however this was not statistically significant. In order to verify these results and exclude any possible pipetting errors, cDNA was synthesized again from the total RNA and real-time PCR was performed for the second time for these two genes. The final results were almost identical with the first run.
5.5 Discussion
94
95 Previous research investigated development, survivorship, reproductive effort and viability of D. melanogaster after oral exposure to TiO2 nanoparticles (Philbrook et al., 2011; Posgai et al., 2011). Nano-TiO2 addition to food led to a significant progeny loss in the fruit fly, as demonstrated by a decline in female fecundity (Philbrook et al., 2011). Although we have performed fecundity experiments in almost the same way, with similar TiO2 concentrations as previous study, we could not observe statistically significant effect of TiO2 on a decline in female fecundity. The only actual difference between the present and the previous study is the grade of TiO2. Previous study used industrial rutile grade of TiO2, while in the present study fruit flies were exposed to human food grade anatase E171 TiO2. Therefore, it is reasonable to believe that the observed difference in the results is due to a difference in the ingested grade of TiO2. In another study neither survival nor time to pupation was significantly affected by nano-TiO2 at doses of up to 0.2 mg mL-1 (Posgai et al., 2011), however the tested TiO2 grade was once again industrial rutile and not E171 anatase. In the present study, all tested concentrations of E171 TiO2 have significantly increased time to pupation in a dose-dependent manner. Investigating the time to pupation in D. melanogaster after exposure to various chemicals is a standard toxicity test which is frequently utilized (Lozinsky et al., 2012; MihajilovKrstev et al., 2014). Recently, this model was successfully applied in nanomaterials toxicity screening as well (Chen et al., 2015). Oxidative stress is frequently associated with the delayed pupation of D. melanogaster and other insects (Hyršl et al., 2007; Lozinsky et al., 2012; Lozinsky et al., 2013). TiO2 is known for its generation of reactive oxygen species (ROS) (Carp et al., 2004) which in turn are causing oxidative stress (Park et al., 2008; Cui et al., 2010; Srivastava et al., 2013). Expression of the catalase gene in
95
96 the present study was downregulated 3-4 times after exposure to TiO2. Such result is in accordance with other studies in which catalase gene was downregulated after exposure to TiO2 (Cui et al., 2010), although there are other conflicting reports in which TiO2 treatment is upregulating expression of catalase (Li et al., 2012; Varela-Valencia et al., 2014). These are just some of the examples as the current scientific literature contains all kind of results regarding effects of TiO2 on catalase expression in various species. Such results varies from downregulation to no observed changes in expression, and finally to overexpression. It is likely that different exposure conditions, different TiO2 grades, and different particle sizes are contributing to the variability in observed results. Illumination of TiO2 under natural sunlight is also an important factor for toxicity expression, as illumination can photoactivate TiO2 changing its behavior and toxicity endpoints (Jovanović, 2015b) due to ROS production. The actual mechanism by which TiO2 caused downregulation of catalase in the present study is not known. However, prolonged exposure or overexposure to ROS can lead to catalase downregulation (Venkatesan et al., 2007; Min et al., 2010). Downregulation of gene expression for catalase or decreased catalase activity was also noted in the studies with delayed pupation of D. melanogaster or other insects (Hyršl et al., 2007; Lozinsky et al., 2012; Lozinsky et al., 2013). In the present research larval development was likely prolonged in order to better cope with TiO2 exposure. It is a situation where less energy is available for growth because of ROS, oxidative stress, and physiological cost of mechanism of detoxification in larval stage. Previous results indicates that after dietary uptake TiO2 can enter the body of third instar larvae of Drosophila and interact negatively with tissues, especially with gut and imaginal disc cells (Carmona et al., 2015). ICP-MS analysis revealed that D.
96
97 melanogaster late third instar larvae ingested 1002 ± 105 µg g-1 body weight of TiO2 after 4 days exposure to 2 mg mL-1 TiO2. However, there was no difference in the titanium content of the adults emerging from TiO2 treated larvae when compared to the control. This means that the TiO2 load was not transferred from pupae to adults. The TiO2 may have been excreted shortly after the larvae stop feeding and before they turned into pupae, or through the formation of meconium after eclosion of adults. Another possible explanation is that during metamorphosis, most of the embryonic and larval tissue is destroyed. The adult tissues develop from groups of cells known as imaginal disc which were allocated in embryogenesis but remained inactive during embryonic and larval stage (Harbecke et al., 1996; Weaver and Krasnow, 2008). It was previously shown that in D. melanogaster nanoparticles predominately accumulate in the fat body of larva and not in imaginal discs (Wang et al., 2012), thus only a small portion of nanoparticles can be incorporated in development of new tissues during metamorphosis. Adults were emerging from the pupa stadium without any apparent difficulties and the great majority looked healthy with normal phenotype. In two adults (one in TiO2 2 mg mL-1, and another in TiO2 0.02 mg mL-1), out of 240 treated larvae, a specific phenotype (Fig. 2) was observed which was consistent with the previously described mutant phenotype NM-mut induced by exposure to gold nanoparticles (Vecchio et al., 2012). However, we can not confirm whether such phenotype was the result of mutation or not, since the observed effect was noted only after fruit flies were euthanized and thus subsequent effects on progeny could not have been tested. In the last five years that the D. melanogaster colony is maintained in our laboratory we have never observed such phenotype before. Previously, dietary exposure of D. melanogaster larvae to 1.6 mg mL-1 anatase nano-TiO2 did not promote
97
98 genotoxicity in the wing-spot test but it did cause significant DNA damage in the hemocytes of Drosophila starting at concentration of 0.4 mg mL-1 in the feed medium (Carmona et al., 2015). Furthermore, authors of the previous study indicated that primary DNA damage associated with nano-TiO2 is likely associated with specific physicochemical properties of nano-TiO2 itself (Carmona et al., 2015). In a similar experiment, dietary exposure of D. melanogaster larvae to 0.1-10 mM anatase nano-TiO2 did not induce genotoxicity in the wing-spot test (Demir et al., 2013). The genotoxicity of TiO2 has been relatively well studied in a wide range of assay systems and organism models, and a possible reason for the genotoxic potential of TiO2 nanoparticles is due to the generation of ROS (Ghosh et al., 2010; Pakrashi et al., 2014; Kansara et al., 2015). In conclusion, dietary exposure of D. melanogaster to E171 TiO2 human food grade in concentrations of up to 2 mg mL-1 TiO2 did not affect survival but have significantly increased larvae time to pupation. Expression of gene for catalase was downregulated by the treatment, while the effect on the downregulation of superoxide dismutase 2 was less pronounced. Fecundity of D. melanogaster was unaffected by the treatment. Two individuals with aberrant phenotype similar to previously described nanoparticle induced mutant phenotypes were detected in the group exposed to TiO2. In general, chronic exposure of a single generation of D. melanogaster to E171 TiO2 concentration, markedly higher than the daily human estimated exposure, showed little signs of direct toxicity predominately manifested as 48 h prolonged time to pupation and modest reduction in expression of antioxidative genes. However, juvenile offspring of water flea adults that were previously exposed to TiO2 exhibited a significantly increased sensitivity to TiO2 compared with the offspring of unexposed adults (Bundschuh et al.,
98
99 2012). Therefore, a further testing with specific lines of Drosophila reared on TiO2 medium over a multiple generations is recommended in order to fully understand possible toxicity of TiO2 and risks associated with its consumption by humans.
Acknowledgements The present research was partially supported by B. Jovanović's Marie Curie FP7 Career Integration Grant within the 7th European Union Framework Programme, Project No. PCIG13-GA-2013-618006.
5.6 References Aparicio, R., Neyen, C., Lemaitre, B., Busturia, A., 2013. dRYBP Contributes to the negative regulation of the Drosophila Imd pathway. PLoS ONE 8, e62052. Bachler, G., von Goetz, N., Hungerbuhler, K., 2015. Using physiologically based pharmacokinetic (PBPK) modeling for dietary risk assessment of titanium dioxide (TiO2) nanoparticles. Nanotoxicology 9, 373-380. Boyd, O., Weng, P., Sun, X., Alberico, T., Laslo, M., Obenland, D.M., Kern, B., Zou, S., 2011. Nectarine promotes longevity in Drosophila melanogaster. Free Radical Bio Med 50, 1669-1678. Bundschuh, M., Seitz, F., Rosenfeldt, R.R., Schulz, R., 2012. Titanium dioxide nanoparticles increase sensitivity in the next generation of the water flea Daphnia magna. PLoS ONE 7, e48956. Carmona, E.R., Escobar, B., Vales, G., Marcos, R., 2015. Genotoxic testing of titanium dioxide anatase nanoparticles using the wing-spot test and the comet assay in Drosophila. Mutat Res-Gen Tox En 778, 12-21. Carp, O., Huisman, C.L., Reller, A., 2004. Photoinduced reactivity of titanium dioxide. Prog Solid State Chem 32, 33-177. Chen, H., Wang, B., Feng, W., Du, W., Ouyang, H., Chai, Z., Bi, X., 2015. Oral magnetite nanoparticles disturb the development of Drosophila melanogaster from oogenesis to adult emergence. Nanotoxicology 9, 302-312. Cui, Y., Gong, X., Duan, Y., Li, N., Hu, R., Liu, H., Hong, M., Zhou, M., Wang, L., Wang, H., Hong, F., 2010. Hepatocyte apoptosis and its molecular mechanisms in mice caused by titanium dioxide nanoparticles. J Hazard Mater 183, 874-880. Demir, E., Turna, F., Vales, G., Kaya, B., Creus, A., Marcos, R., 2013. In vivo genotoxicity assessment of titanium, zirconium and aluminium nanoparticles, and their microparticulated forms, in Drosophila. Chemosphere 93, 2304-2310.
99
100 European Commission, 2011. Commission recomendation of 18 October 2011 on the definition of nanomaterial. Official Journal of the European Union 2011/696/EU, L 275/238 - L275/240. Ghosh, M., Bandyopadhyay, M., Mukherjee, A., 2010. Genotoxicity of titanium dioxide (TiO2) nanoparticles at two trophic levels: Plant and human lymphocytes. Chemosphere 81, 1253-1262. Harbecke, R., Meise, M., Holz, A., Klapper, R., Naffin, E., Nordhoff, V., Janning, W., 1996. Larval and imaginal pathways in early development of Drosophila. Int J Dev Biol 40, 197-204. Hu, Y., Sopko, R., Foos, M., Kelley, C., Flockhart, I., Ammeux, N., Wang, X., Perkins, L., Perrimon, N., Mohr, S.E., 2013. FlyPrimerBank: An online database for Drosophila melanogaster gene expression analysis and knockdown evaluation of RNAi reagents. G3: Genes|Genomes|Genetics 3, 1607-1616. Hyršl, P., Büyükgüzel, E., Büyükgüzel, K., 2007. The effects of boric acid-induced oxidative stress on antioxidant enzymes and survivorship in Galleria mellonella. Arch Insect Biochem 66, 23-31. Jennings, B.H., 2011. Drosophila – a versatile model in biology & medicine. Mater Today 14, 190-195. Jovanović, B., 2015a. Critical review of public health regulations of titanium dioxide, a human food additive. Integrated Environmental Assessment and Management 11 (1) 10-20. Jovanović, B., 2015b. Review of titanium dioxide nanoparticle phototoxicity: Developing a phototoxicity ratio to correct the endpoint values of toxicity tests. Environ Toxicol Chem 34, 1070-1077. Jovanović, B., Bezirci, G., Çağan, A., Coppens, J., Levi, E.E., Oluz, Z., Tuncel, E., Duran, H., Beklioğlu, M., Unpublished. Effects of titanium dioxide nanoparticles on freshwater food web: The first TiO2 outdoor mesocosm experiment. Acceptance pending revision; Nanotoxicology. Jovanović, B., Guzmán, H.M., 2014. Effects of titanium dioxide (TiO2) nanoparticles on caribbean reef-building coral (Montastraea faveolata). Environ Toxicol Chem 33, 1346-1353. Kansara, K., Patel, P., Shah, D., Shukla, R.K., Singh, S., Kumar, A., Dhawan, A., 2015. TiO2 nanoparticles induce DNA double strand breaks and cell cycle arrest in human alveolar cells. Environ Mol Mutagen 56, 204-217. Li, B., Xie, Y., Cheng, Z., Cheng, J., Hu, R., Gui, S., Sang, X., Sun, Q., Zhao, X., Sheng, L., Shen, W., Hong, F., 2012. BmNPV resistance of silkworm larvae resulting from the ingestion of TiO2 nanoparticles. Biol Trace Elem Res 150, 221-228. Lozinsky, O.V., Lushchak, O.V., Kryshchuk, N.I., Shchypanska, N.Y., Riabkina, A.H., Skarbek, S.V., Maksymiv, I.V., Storey, J.M., Storey, K.B., Lushchak, V.I., 2013. Snitrosoglutathione-induced toxicity in Drosophila melanogaster: Delayed pupation and induced mild oxidative/nitrosative stress in eclosed flies. Comp Biochem Phys A 164, 162-170. Lozinsky, O.V., Lushchak, O.V., Storey, J.M., Storey, K.B., Lushchak, V.I., 2012. Sodium nitroprusside toxicity in Drosophila melanogaster: delayed pupation, reduced adult emergence, and induced oxidative/nitrosative stress in eclosed flies. Arch Insect Biochem 80, 166-185.
100
101 Mihajilov-Krstev, T., Jovanović, B., Jović, J., Ilić, B., Miladinović, D., Matejić, J., Rajković, J., Đorđević, L., Cvetković, V., Zlatković, B., 2014. Antimicrobial, antioxidative, and insect repellent effects of Artemisia absinthium essential oil. Planta Med 80, 1698-1705. Min, J.Y., Lim, S.-O., Jung, G., 2010. Downregulation of catalase by reactive oxygen species via hypermethylation of CpG island II on the catalase promoter. FEBS Lett 584, 2427-2432. Ong, C., Yung, L.-Y.L., Cai, Y., Bay, B.-H., Baeg, G.-H., 2015. Drosophila melanogaster as a model organism to study nanotoxicity. Nanotoxicology 9, 396403. Pakrashi, S., Jain, N., Dalai, S., Jayakumar, J., Chandrasekaran, P.T., Raichur, A.M., Chandrasekaran, N., Mukherjee, A., 2014. In vivo genotoxicity assessment of titanium dioxide nanoparticles by Allium cepa root tip assay at high exposure concentrations. PLoS ONE 9, e87789. Park, E.-J., Yi, J., Chung, K.-H., Ryu, D.-Y., Choi, J., Park, K., 2008. Oxidative stress and apoptosis induced by titanium dioxide nanoparticles in cultured BEAS-2B cells. Toxicol Lett 180, 222-229. Philbrook, N.A., Winn, L.M., Afrooz, A.R.M.N., Saleh, N.B., Walker, V.K., 2011. The effect of TiO2 and Ag nanoparticles on reproduction and development of Drosophila melanogaster and CD-1 mice. Toxicol Appl Pharm 257, 429-436. Posgai, R., Cipolla-McCulloch, C.B., Murphy, K.R., Hussain, S.M., Rowe, J.J., Nielsen, M.G., 2011. Differential toxicity of silver and titanium dioxide nanoparticles on Drosophila melanogaster development, reproductive effort, and viability: Size, coatings and antioxidants matter. Chemosphere 85, 34-42. Ruijter, J.M., Ramakers, C., Hoogaars, W.M.H., Karlen, Y., Bakker, O., van den Hoff, M.J.B., Moorman, A.F.M., 2009. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res 37, e45-e45. Srivastava, R., Rahman, Q., Kashyap, M., Singh, A., Jain, G., Jahan, S., Lohani, M., Lantow, M., Pant, A., 2013. Nano-titanium dioxide induces genotoxicity and apoptosis in human lung cancer cell line, A549. Hum Exp Toxicol 32, 153-166. Varela-Valencia, R., Gómez-Ortiz, N., Oskam, G., de Coss, R., Rubio-Piña, J., del RíoGarcía, M., Albores-Medina, A., Zapata-Perez, O., 2014. The effect of titanium dioxide nanoparticles on antioxidant gene expression in tilapia (Oreochromis niloticus). J Nanopart Res 16, 1-12. Vecchio, G., 2015. A fruit fly in the nanoworld: once again Drosophila contributes to environment and human health. Nanotoxicology 9, 135-137. Vecchio, G., Galeone, A., Brunetti, V., Maiorano, G., Rizzello, L., Sabella, S., Cingolani, R., Pompa, P.P., 2012. Mutagenic effects of gold nanoparticles induce aberrant phenotypes in Drosophila melanogaster. Nanomed-Nanotechnol 8, 1-7. Venkatesan, B., Mahimainathan, L., Das, F., Ghosh-Choudhury, N., Ghosh Choudhury, G., 2007. Downregulation of catalase by reactive oxygen species via PI 3 kinase/Akt signaling in mesangial cells. J Cell Physiol 211, 457-467. Wang, B., Chen, N., Wei, Y., Li, J., Sun, L., Wu, J., Huang, Q., Liu, C., Fan, C., Song, H., 2012. Akt signaling-associated metabolic effects of dietary gold nanoparticles in Drosophila. Scientific Reports 2, 1-7.
101
102 Weaver, M., Krasnow, M.A., 2008. Dual origin of tissue-specific progenitor cells in Drosophila tracheal remodeling. Science (New York, N.Y.) 321, 1496-1499. Weir, A., Westerhoff, P., Fabricius, L., Hristovski, K., von Goetz, N., 2012. Titanium dioxide nanoparticles in food and personal care products. Environ Sci Technol 46, 2242-2250. Yang, Y., Doudrick, K., Bi, X., Hristovski, K., Herckes, P., Westerhoff, P., Kaegi, R., 2014. Characterization of food-grade titanium dioxide: The presence of nanosized particles. Environ Sci Technol 48, 6391-6400.
102
103
5.7. Tables and figures Table 1. Survival of D. melanogaster larvae and developmental time (DT) after dietary exposure to various concentrations of human food grade titanium dioxide. Concentration of TiO2 in feed media 2 mg mL-1 0.2 mg mL-1 0.02 mg mL-1 0.002 mg mL-1 control % of exposed larvae reaching pupa stadium 87 85 90 92 97 % of exposed larvae reaching imago stadium 83 85 87 88 97 DT larva to pupa (days) ± SEM 3.54 ± 0.17 2.98 ±0.04 2.75 ± 0.14 2.56 ± 0.32 1.74 ± 0.01 DT larva to adult (days) ± SEM 9.70 ± 0.21 8.89 ± 0.06 8.58 ± 0.24 8.42 ± 0.15 8.07 ± 0.08
Table 2. Fecundity of D. melanogaster adult females after dietary exposure as larvae to various concentrations of human food grade titanium dioxide. Results obtained from 8 females per group. Concentration of TiO2 in feed media Average number of eggs per female per day during the 10 days mating period SEM
2 mg mL-1
0.2 mg mL-1
0.02 mg mL-1
0.002 mg mL-1
control
14 1.7
12.8 2
14.3 1.4
14.5 3.3
15.4 0.9
103
104 Figure captions Figure 1.The effect of E171 TiO2 on delaying the development of D. melanogaster larvae into pupae. The effect is statically significant for each tested concentration when compared to the control group (chi-square test, p < 0.001). Figure 2. Aberrant phenotype in flies treated with E171 TiO2. a - Normal phenotype; b and d fly from TiO2 2 mg mL-1 treatment; c - fly from TiO2 0.02 mg mL-1 treatment. The circles show torax region in normal (a) and aberrant fly (b). The arrows show the place of torax distortion in aberrant flies (b and d). Bars show 1 mm. Figure 3. The effect of E171 TiO2 on the expression of antioxidant genes (A - catalase; B superoxide dismutase 2) of D. melanogaster late third instar larvae. * Indicates that the effects are statistically significant when compared to the control (Dunnet's procedure, p < 0.05). N=5 per group.
104
% of population reaching the pupa stadium
105
100 80
TiO2 2 mg/mL TiO2 0.2 mg/mL
60
TiO2 0.02 mg/mL TiO2 0.002 mg/mL
40
Control
20 0 0
1
2
3
4
5
6
7
Days of exposure
Figure 1
Figure 2
105
106
0.07
Catalase - relative expression
0.06
0.05
0.04
0.03
*
*
0.02
0.01
0.00
A
Control
TiO2 0.2.mg mL
-1
TiO2 2 mg mL
-1
TiO2 2 mg mL
-1
Mean Mean±SE Mean±SD
Super oxide dismutase 2 - relative expression
0.08 0.07 0.06 0.05 0.04 0.03
* 0.02 0.01 0.00
B
Control
TiO2 0.2 mg mL
-1
Mean Mean±SE Mean±SD
Figure 3
106
107 CHAPTER 6. Histopathology of fathead minnow exposed to hydroxylated fullerenes
Boris Jovanović, Elizabeth Whitley & Dušan Palić Paper published in Nanotoxicology 8, 755-763. Boris Jovanović is the first and corresponding author of this paper.
6.1. Abstract Hydroxylated fullerenes are reported to be very strong antioxidants, acting to quench reactive oxygen species (ROS), thus having strong potential for important and widespread applications in innovative therapies for a variety of disease processes. However, their potential for toxicological side effects is still largely controversial and unknown. Effects of hydroxylated fullerenes C60(OH)24 on the fathead minnow (Pimephales promelas) were investigated microscopically after a 72 hour (acute) exposure by intraperitoneal injection of 20 ppm of hydroxylated fullerenes per gram of body mass. Cumulative, semi-quantitative histopathologic evaluation of brain, liver, anterior kidney, posterior kidney, skin, coelom, gills, and the vestibuloauditory system revealed significant differences between control and hydroxylated fullerene-treated fish. Fullerene-treated fish had much higher cumulative histopathology scores. Histopathologic changes included loss of cellularity in the interstitium of the kidney, a primary site of hematopoiesis in fish, and loss of intracytoplasmic glycogen in liver. In the coelom, variable numbers of leukocytes, including many macrophages and fewer heterophils and rodlet cells, were admixed with the nanomaterial. These findings raise concern about in vivo administration of hydroxylated fullerenes in experimental drugs and procedures in human medicine, and should be investigated in more detail. Keywords: nanoparticles, liver, kidney, fish, pathology, hydroxylated fullerenes
107
108
6.2 Introduction Hydroxylated fullerenes (fullerenols) are de facto nanoparticles with primary particle size of 1 nm, made soluble in water by the introduction of hydroxyl groups to C60 molecule during their preparation (Kokubo, 2012). Although readily soluble in water due to hydroxyl groups, the large fullerenol hydrophobic core and π-π interactions are responsible for formation of nanoparticle aggregates with a size range of 20-450 nm (Kokubo, 2012). Due to their intrinsic properties, hydroxylated fullerenes act as a potent, non-selective antioxidant agents and can intercept and quench all of the physiologically relevant reactive oxygen species (ROS) (Ueng et al., 1997; Markovic and Trajkovic, 2008; Yin et al., 2009). Owing to these abilities, C60(OH)24 hydroxylated fullerenes are being investigated as experimental drugs in the treatment of Parkinson’s disease, Alzheimer’s disease, and amyotrophic lateral sclerosis (Cai et al., 2008; Cataldo and da Ros, 2008; Dugan et al., 2001), as well as in other therapeutic and diagnostic purposes such as anti-cancer/tumor/proliferative/metastatic/bacterial and antiviral agents (Bogdanovic et al., 2004; Cataldo and da Ros, 2008, Kokubo 2012). The safety profile of C60(OH)24 is still controversial, with studies demonstrating a range of results. Certain studies claims that C60(OH)24 are non-toxic, well-tolerated by mammals and therefore safe for therapeutic use (Monteiro-Riviere et al., 2012), while others are reporting substantial adverse effects in human cell lines, rats, and fish (Gelderman et al., 2008; Yamada et al., 2010; Nakagawa et al., 2011; Jovanović et al., 2011). Differences in surface modification, i.e., hydroxylation, are likely to contribute to differences in results obtained from various studies. These recent studies have raised concerns about the potential toxicity of C60(OH)24 as, to a certain extent, the properties which benefit some biomedical functions may damage others as
108
109 side effects. For example, the ability of C60(OH)24 to prevent mitochondrial dysfunction and oxidative damage in an MPP+ induced cellular model of Parkinson’s disease (Cai et al., 2008) can also cause mitochondrial arrest and depletion of ATP (Johnson-Lyles et al., 2010) with serious consequences. A frequent method of fullerene delivery to target organisms for potential medicinal use is by injection. This may include intraperitoneal (Mori et al., 2007a; Mori et al., 2007b; Cai et al., 2010; Vapa et al., 2012), subcutaneous (Wang et al., 2006), and intravenous routes (MonteiroRiviere et al., 2012). The usual concentrations of various fullerene species and its derivatives administered for exploration of therapeutic use with a desired protective effect against ROS production are in the range of 1-100 ppm (Monteiro-Riviere, 2012 et al.; Mori et al., 2007a; Mori et al., 2007b; Lin et al., 2002; Cai et al., 2008; Cai et al., 2010; Chen et al., 2004; Vapa et al., 2012). The safety profiles of these concentrations of fullerenes and fullerene derivatives have not been fully explored. Recently, in in vivo and in vitro studies, we showed, using therapeutically relevant concentrations and exposure routes that nanoparticles of hydroxylated fullerenes are immunotoxic to mature and developing fathead minnows (Pimephales promelas Rafinesque, 1820). Hydroxylated fullerenes (0.2–200 ppm in vitro) caused concentration-dependent inhibition of neutrophil function and suppressed oxidative burst, release of Neutrophil Extracellular Traps (NETs) and degranulation of primary granules (up to 70, 40, and 50%, respectively). Administration of 2 ppm of hydroxylated fullerenes in vivo by intraperitoneal injection suppressed these neutrophil functions by 10, 10 and 25 %, respectively (Jovanović et al., 2011). With only 48 hours of topical exposure, experimental administration of 0.01 ppm hydroxylated fullerenes in water resulted in development of severe pericardial edema and yolk
109
110 coagulation in up to 25 % of P. promelas embryos (Jovanović et al., 2011). Intraperitoneal injection of 20 ppm per gram body mass of hydroxylated fullerenes caused 12 % mortality in adult fish within the first 36 hours of exposure (Jovanović et al., 2011). Here, we build on our previous work to characterize morphologic changes associated with hydroxylated fullerene exposure, using a well-established fish model in toxicology – P. promelas (Ankley and Villeneuve, 2006).
6.3 Methodology Fish housing and experimental treatment Adult fathead minnows (average weight 4.5 g) were maintained in the Iowa State University College of Veterinary Medicine Laboratory Animal Resources Facility, Ames, IA, US under conditions approved by the Institutional Animal Care and Use Committee. Fish were housed in a water recirculation system supplied with dechlorinated tap water at 23.5 °C and fed twice daily to satiation with dried flake food (2:1 w/w mixture of Aquatox® and Plankton/Krill/Spirulina flake food, Zeigler Bros Inc., PA, US). Control and hydroxylated fullerene-treated fish were housed under identical daily lighting conditions – 14 hours of daylight and 10 hours in the dark. Minnows were anesthetized with 100 ppm of aerated and buffered (sodium bicarbonate, pH 8.0) solution of tricaine methane sulphonate (MS-222, Argent Laboratories, Redmond WA, US). Anesthetized fish, from the treatment group, (N=32) were weighed and injected intraperitoneally to achieve final concentration of 20 ppm of hydroxylated fullerenes (C60(OH)24 (MER Corporation, Tuscon, AZ, US, cat# MR16, 99.8% purity), per one gram of body mass. Concentration of 20 ppm was chosen because it was the lowest concentration to cause mortality
110
111 (12 % mortality) in our previous study (Jovanović et al., 2011). Fish in the control group (N=30) were injected with HBSS without Ca, Mg, and Phenol Red. Injected fish were transferred to 40 L flow-through tanks (pH 8 and water temperature 23.5 °C) and fed twice daily to satiation. After 72 hours, ten of the surviving fish were randomly selected from the control and experimental groups and euthanized using an overdose of MS-222. These groups consisted of five males and five females in the experimental group, while the control group had four males and six females. A small incision was made into the coelomic cavity through the vent, and fish were immediately fixed by submersion in 10% neutral buffered formalin. Hydroxylated fullerene characterization Fullerenes were dissolved in sterile, non-pyrogenic, Hank’s Balanced Salt Solution (HBSS) without Ca, Mg, and Phenol Red. Some characterization of fullerenes in such medium has been performed earlier by us (Jovanović et al., 2011). Here, additional DLS characterization at the concentration of 2000 ppm was performed (the exact concentration in the syringe with which were the fish injected) using Malvern Zetasizer instrument. Size distribution was multimodal, similar to the earlier observation (Jovanović et al., 2011). Mean polydispersity index (PDI) was 0.46+0.06 (standard error of the mean). Average diameter of the particles (Z-average d.nm) was 153+18 nm; intensity mean 438+47 d.nm; number mean 3.6+0.5 d.nm; and volume mean 5.4+0.5 d.nm. Histopathology Fish were sectioned along the sagittal plane and placed in processing cassettes, demineralized for 12 hours in 25 % formic acid solution, and processed routinely for embedding in paraffin. Tissues were sectioned at 5 microns and stained with hematoxylin and eosin.
111
112 Selected sections were stained with Gram, Ziehl-Neelsen, and Periodic acid-Schiff reagents for bacteria, acid-fast bacteria, and carbohydrates and fungi, respectively. At least two representative sections of each fish were evaluated microscopically. Tissue architecture and cytomorphologic features of the brain, vestibular system, liver, anterior kidney (head kidney), posterior kidney (trunk kidney), skin, coelom, gills, and skeletal muscle were evaluated by a board-certified veterinary pathologist. External factors that might have affected the morphology or interpretation of the tissue sections were considered and, to avoid effects of non-treatment factors on data, samples were processed and stained in parallel and evaluated by a single observer (E.M.W.). Statistics A semi-quantitative grading scale was used to evaluate microscopic features of tissues and cells (Table 1). Significance of differences between histopathology scores were evaluated using a two-tailed Mann-Whitney U test or Wilcoxon Signed Rank Test.
6.4 Results Within 72 hours of exposure 3 of 32 fish (9.5 %) died in experimental hydroxylated fullerene treatment. There was no mortality in the control (HBSS-injected group N=30) during this time. There was no observed difference in the feeding behavior of fish between the groups and all of the fish consumed food ad libitum during the experiment. Personal observation, however, indicated that the hydroxylated fullerene-injected fish were more lethargic and tended to spend more time on the aquarium bottom, clustered in a school, as opposed to HBSS-injected fish which exhibited normal activity levels and swimming behavior.
112
113 Large aggregates of hydroxylated fullerenes were visualized in the coelomic cavity of treated fish and were often infiltrated and surrounded by epithelioid macrophages. In hematoxylin and eosin-stained sections, the nanomaterial was finely particulate to amorphous and golden brown. The nanomaterial was distributed throughout the ventral portion of the coelomic cavity, on the serosal surfaces and the mesentery between organs (liver and pancreas in Figure 1A, small intestine and pancreas in Figure 1B). In fish treated with hydroxylated fullerenes, serosal pigment of the coelomic wall was clumped by phagocytes. Variable numbers of leukocytes, including macrophages and fewer heterophils and rodlet cells, were admixed with the nanomaterials (Figures 1C and 1D). Some phagocytes were distended by abundant intracytoplasmic nanomaterial (Figure 1D). Examination of representative sections stained individually with Gram, Periodic acid Schiff, or Ziehl-Neelsen stains did not reveal any infectious agents. Cumulative semi-quantitative histopathologic scoring of the brain, liver, anterior kidney, posterior kidney, skin, coelom, gills, and the vestibuloauditory system revealed significant differences between control and fullerene-treated fish (P < 0.001, Figure 2A). Individual histopathology scores of the coelomic cavity and the anterior kidney (Figure 2B and 2C) were significantly higher in fish treated with hydroxylated fullerenes (P < 0.001). Fish treated with hydroxylated fullerenes also had significantly higher posterior kidney histopathology scores (Figure 2D, P < 0.05). Histopathology score for liver morphology (Figure 2E) was significantly higher in hydroxylated fullerene treated fish, compared with control (P < 0.001). In the liver of fullerene-treated fish, hepatocytes were relatively small, with condensed cytoplasm and finely crystalline intracytoplasmic proteins (Figure 3A). Hepatocyte morphology was not related to gender. Staining with Periodic acid-Schiff reagent (Figure 3B) revealed scant
113
114 carbohydrate in hepatocytes of fullerene-treated fish, followed by loss of pink staining after amylase treatment, consistent with the presence of minimal intracytoplasmic glycogen (Figure 3C). The cytoplasm of hepatocytes of control fish, in contrast, were vacuolated and pale, with condensed to crystalline, intracytoplasmic proteins with hematoxylin and eosin staining and have moderate to abundant intracytoplasmic glycogen as identified by Periodic acid-Schiff staining (Figure 3D-F). Similar reduction in amylase-sensitive carbohydrate was observed in skeletal muscle in hydroxylated fullerene-treated fish, consistent with reduced glycogen storage (data not shown). Accumulation of pigments in hepatic melanomacrophage centers was not assessed, because of the difficulty of differentiating lipofuscin and nanoparticles and the non-homogenous distribution of hepatic melanomacrophage centers in livers of control fish. Compensatory hepatic hematopoietic tissue was not observed in control or treated fish. Reduced numbers of hematopoietic cells, both myeloid and lymphoid lineages, were present in the interstitium of the anterior and posterior kidneys. (Figures 4A-D). Melanomacrophage centers in fullerene-treated fish often were expanded by amorphous, golden brown material, consistent with nanomaterial and/or lipofuscin. Morphologic changes in the nephron or increased numbers of mitotic figures or apoptotic bodies among interstitial hematopoietic cells between treatment groups were not observed. The heart was not present in enough tissue sections, even with repeated sectioning of the paraffin blocks, to provide accurate statistical data. Golden brown intracytoplasmic pigment was present in many fixed atrial phagocytes, critical members of the teleost mononuclear phagocyte system, in 3 of 7 fullerene-treated fish for which heart was present on the slides but were not present in the atria of control fish (data not shown). Significant differences in morphology of the
114
115 gills, skin, brain, or vestibuloauditory system between treatment groups were not observed. Splenic tissue was rarely present in examined sections, due to orientation of tissue sections.
6.5 Discussion Administration of 20 ppm of hydroxylated fullerenes per gram body mass caused 9.5% mortality in experimental fish population which is congruent with previously reported mortality of 12 % (Jovanović et al., 2011) and contrasts to 0% mortality among control fish. C60(OH)24 also caused pathologic changes in several vital organ systems in adult, tank-raised fathead minnows. Morphologic lesions include reduced numbers of renal interstitial hematopoietic cells and depletion of hepatic and skeletal glycogen stores. These changes are expected to reflect functional alterations in the innate immune response and energy metabolism, respectively, and will be the focus of future investigations. The results of this study complement our previous findings (Jovanović et al., 2011) which demonstrated that hydroxylated fullerenes have a direct effect on the teleost immune system. This work is also congruent with the work of others that demonstrate that various species of hydroxylated fullerenes can interact (either benevolently or malevolently) with cells of the murine or human immune system, in particular, natural killer cells (Bunz et al., 2012), dendritic cells (Yang et al., 2010), mast cells and basophils (Ryan et al., 2007), and macrophages (Pirutin et al., 2012). Here, we demonstrate a phagocytic response to hydroxylated fullerenes in the coelomic cavity (Figure 1C and D) and in renal melanomacrophage centers. Furthermore, both the anterior and posterior kidney of hydroxylated fullerene-treated fish contained reduced numbers of myeloid and lymphoid cells, suggesting the probability of impaired innate and adaptive immune responses. One of the critical functions of the fish kidney is to serve as a major
115
116 myelopoietic and lymphopoetic site (Kobayashi et al., 2006; Zapata, 1979), as teleost fish have no intraosseous medullary hematopoiesis. Possible mechanisms for the loss of hematopoietic cells includes cell death, perhaps by calcium flux-mediated apoptosis as has been described in endothelial cells (Gelderman, et al., 2008) or disruption of cell membranes (Tramer et al., 2012). Less likely, to account for this loss of cells would be massive mobilization of phagocytes in response to foreign nanoparticles, because this mechanism would not account for the observed loss of multiple cell lineages and the absence of compensatory proliferation. The loss of hematopoietic cells was more pronounced in the anterior kidney, probably because this organ is the central organ for immune regulation in teleosts. Compensatory hepatic hematopoiesis was not observed, perhaps due to the short duration of the study or to treatment-associated toxicity to a precursor population. The loss of hematopoietic potential is expected to have serious repercussions for homeostasis and would reduce immunocompetency during a concurrent infectious disease. Alterations in energy metabolism secondary to exposure to hydroxylated fullerenes are suggested by loss of glycogen stores in the liver and skeletal muscle. The liver of fishes is an important storage site for large amounts of glycogen or lipid, depending on fish species (Hinton et al., 2008). The main difference between teleost and mammalian hepatic architecture is the absence of functional metabolic zonation, and thus glycogen storage in the teleost liver is not heterotopically distributed in the parenchyma as in the mammalian liver (Hinton et al., 2008), where it can serve as an indicator of mild hepatocyte damage. The cytoplasm of hepatocytes of control fish in this study was vacuolated and pale, with condensed to crystalline, intracytoplasmic proteins and moderate to abundant intracytoplasmic glycogen. Treatment with hydroxylated fullerenes caused marked loss of intracytoplasmic glycogen in hepatocytes. One of
116
117 the main functions of the liver is to catabolise stored glycogen during starvation or stress, via the process of glycogenolysis. Glycogenolysis in the liver and skeletal muscle is particularly important in stressful situations, such as fight-or-flight responses as it provides a ready supply of glucose to be used in glycolysis as precursor for ATP. A previous study has demonstrated that treatment of animals with hydroxylated fullerenes can cause mitochondrial arrest and depletion of ATP (Johnson-Lyles et al., 2010). Such toxic effects can be attributed to the mode of action of hydroxylated fullerenes, being potent antioxidants with the ability to quench ROS (Markovic and Trajkovic, 2008; Jovanović et al., 2011). In animals, mitochondrial compartments are the largest producers of ROS within cells, and ROS are essential for the process of oxidative phosphorylation. When ROS are quenched, ATP is depleted and intensive glycogenolysis must take place to replenish ATP stores. This ability is likely met with limited success when animals are treated with hydroxylated fullerenes, explaining the loss of glycogen from the liver and skeletal muscle that we observed in fish treated with hydroxylated fullerenes. Alternatively, fullerene-treated fish may have had less hepatic glycogen due to reduced feeding although no difference in feeding patterns was observed between experimental and control group in this study. Fullerene-treated fish exhibited diminished swimming performance, were lethargic, and were observed to spend a large amount of time lying on the aquarium floor. However, we did not conduct extensive behavioral analyses. This manuscript identifies pathology in target organs caused by hydroxylated fullerenes that have not been observed in several other studies (Monteiro-Riviere et al., 2012; Vapa et al., 2012). In particular, our study evaluated several sites of hematopoiesis in fish. Histopathologic evaluation of bone marrow, a site of hematopoiesis in mammals, has not been reported in previous similar studies (Chen et al., 1998; Monteiro-Riviere et al., 2012). Differences in results
117
118 across studies may also be associated with other factors, such as variances in fullerene chemistry and conjugation, environmental lighting conditions, and dis-similarities in physiology and oxidative stress responses among animal species. In contrast to studies using small numbers of rodents (Chen et al., 1998; Monteiro-Riviere et al, 2012), this study had the benefit of higher animal numbers per group, allowing robust statistical analysis. The semi-quantitative histologic scoring system we describe was developed for this project to allow evaluation of the cellular and architectural changes associated with fullerene exposure. Although it is a time-consuming process, the application of semi-quantitative techniques to evaluating histologic sections provides information otherwise inaccessible through qualitative, nominal descriptions. The scoring system was developed using a combination of specific and arbitrary categories reflecting organ-specific features associated with cell injury, with arbitrary categories assigned to features for which numerical parameters were not wellidentified or for features that were represented by a continuum (accumulation of hepatic glycogen, for example). The ordinal data generated from this scoring system allowed summarization of several morphologic features from a single organ and from multiple organs, with data reported as the means and standard deviations of the population in each group.
Our
laboratory also performs computer-aided image analysis of histologic sections for lesiontreatment correlations, which allow numerical quantification of various features, but the small size of this animal model and difficulties in sample orientation during tissue processing do not routinely provide broad-scale comparable sections of individual organs that are most amenable to computer-aided image analysis.
118
119 In conclusion, treatment of fish with hydroxylated fullerenes caused clear histopathological changes with main features being loss of renal interstitial hematopoietic cells and loss of glycogen from the liver and skeletal muscle, which was consistent with previous research and apparent mode of action of hydroxylated fullerenes. The morphologic changes associated with hydroxylated fullerenes raise concern about their use in experimental drugs and procedures in human medicine, and the potential for adverse effects of hydroxylated fullerenes should be further investigated.
6.6 References Ankley GT, Villeneuve DL, 2006. The fathead minnow in aquatic toxicology: past, present and future. Aquat Toxicol 78:91–102. Bogdanovic G, Kojic V, Dordevic A, Canadanovic-Brunet J, Vojinovic-Miloradov M, Baltic VV, 2004. Modulating activity of fullerol C60(OH)22 on doxorubicin-induced cytotoxicity. Toxicol In Vitro 18:629–637. Bunz H, Plankenhorn S, Klein R. 2012. Effect of buckminsterfullerenes on cells of the innate and adaptive immune system: an in vitro study with human peripheral blood mononuclear cells. Int Nanomed 7:4571–4580. Cai X, Hao J, Zhang X,Yu B, Ren J, Luo C, Li Q, Huang Q, Shi X, Li W, Liu J. 2010. The polyhydroxylated fullerene derivative C60(OH)24 protects mice from ionizing-radiationinduced immune and mitochondrial dysfunction. Toxicol Appl Pharmacol 243:27-34. Cai X, Jia H, Liu Z, Hou B, Luo C, Feng Z, Li W, Liu J. 2008. Polyhydroxylated fullerene derivative C60(OH)24 prevents mitochondrial dysfunction and oxidative damage in an MPP+ induced cellular model of Parkinson’s disease. J Neurosci Res 86:3622–3634.
119
120 Cataldo F, da Ros T. (Eds.) (2008). Medicinal chemistry and pharmacological potential of fullerenes and carbon nanotubes. First ed. Berlin: Springer. 223-266. Chen Y-W, Hwang KC, Yen C-C, Lai Y-L, 2004. Fullerene derivatives protect against oxidative stress in RAW 264.7 cells and ischemia-reperfused lungs. J Physiol Regul Integr Comp Physiol 287:21–26. Chen HH, Yu C, Ueng TH, Chen S, Chen BJ, Huang KJ, Chiang LY. 1998. Acute and subacute toxicity study of water-soluble polyalkylsulfonated C60 in rats. Toxicol Pathol 26(1):14351. Dugan LL, Lovett EG, Quick KL, Lotharius J, Lin TT, O’Malley KL, 2001. Fullerene-based antioxidants and neurodegenerative disorders. Parkinsonism Relat Disord 7:243–246. Gelderman MP, Simakova O, Clogston JD, Patri AK, Siddiqui SF, Vostal AC, Simak J. 2008. Adverse effects of fullerenes on endothelial cells: Fullerenol C60(OH)24 induced tissue factor and ICAM-1 membrane expression and apoptosis in vitro. Int J Nanomedicine. 3(1):59–68. Hinton DE, Segner H, Au DWT, Kullman SW, Hardman RC. 2008. Liver Toxicity. 327-400. In Di Guilio RT, Hinton DE. (Eds.). The toxicology of fishes. CRC Press. Taylor & Francis Group. Johnson-Lyles DN, Peifley K, Lockett S, Neun BW, Hansen M, Clogston J, Stern ST, McNeil SE. 2008. Fullerenol cytotoxicity in kidney cells is associated with cytoskeleton disruption, autophagic vacuole accumulation, and mitochondrial dysfunction. Toxicol Appl Pharmacol 248:249–258.
120
121 Jovanović B, Anastasova L, Rowe EW, Palić D. 2011. Hydroxylated fullerenes inhibit neutrophil function in fathead minnow (Pimephales promelas Rafinesque, 1820). Aquat Toxicol 101:474–482. Kobayashi I, Sekiya M, Moritomo T, Ototake M, Nakanishi T. 2006. Demonstration of hematopoietic stem cells in ginbuna carp (Carassius auratus langsdorfii) kidney. Dev Comp Immunol 30:1034–1046. Kokubo K. 2012. Water soluble single-nano carbon particles: Fullerenol and its derivatives. In: Hashim AA. Ed. The delivery of nanoparticles. InTech. 317-332. ISBN 978-953-51-06159. Lin AM, Fang SF, Lin SZ, Chou CK, Luh TY, Ho LT. 2002. Local carboxyfullerene protects cortical infarction in rat brain. Neurosci Res. 43(4):317-21. Markovic Z, Trajkovic V, 2008. Biomedical potential of the reactive oxygen species generation and quenching by fullerenes C60. Biomaterials 29:3561–3573. Monteiro-Riviere NA, Linder KE, Inman AO, Saathoff JG, Xia XR, Riviere JE 2012. Lack of hydroxylated fullerene toxicity after intravenous administration to female Sprague-Dawley rats. J Toxicol Environ Health A. 75(7):367-373. Mori T, Ito S. Namiki M, Suzuki T, Kobayashi S, Matsubayashi K, Sawaguchi T. 2007a. Involvement of free radicals followed by the activation of phospholipase A2 in the mechanism that underlies the combined effects of methamphetamine and morphine on subacute toxicity or lethality in mice: comparison of the therapeutic potential of fullerene, mepacrine, and cooling. Toxicol 236(3):149-157.
121
122 Mori T, Ito S, Kita T, Narita M, Suzuki T, Matsubayashi K, Sawaguchi T. 2007b. Oxidative stress in methamphetamine-induced self-injurious behavior in mice. Behav Pharmacol. 18(3):239-249. Nakagawa Y, Suzuki T, Ishii H, Nakae D, Ogata A. 2011. Cytotoxic effects of hydroxylated fullerenes on isolated rat hepatocytes via mitochondrial dysfunction. Arch Toxicol. 85(11):1429-1440. Pirutin SK, Turovetskiĭ VB, Kedrov AV, Kudriashov IB, Shaĭtan KV, Rubin AB. 2012. Effect of hydroxylated fullerene C60(OH)25 on macrophage plasma membrane integrity. Radiats Biol Radioecol 52(3):252-256. Ryan JJ, Bateman HR, Stover A, Gomez G, Norton SK, Zhao W, Schwartz LB, Lenk R, Kepley CL. 2007. Fullerene nanomaterials inhibit the allergic response. J Immunol 179:665–672. Tramer F, Da Ros T, Passamonti S. 2012. Screening of fullerene toxicity by hemolysis assay. Methods Mol Biol 926:203-217. Ueng T-H, Kang J-J, Wang H-W, Cheng Y-W, Chiang LY. 1997. Suppression of microsomal cytochrome P450-dependent monooxygenases and mitochondrial oxidative phosphorylation by fullerenol, a polyhydroxylated fullerene C60. Toxicol Lett 93:29–37. Vapa I, Milic-Torres V, Djordjevic A, Vasovic V, Srdjenovic B, Dragojevic-Simic V, Popović JK. 2012. Effect of fullerenol C60(OH)24 on lipid peroxidation of kidneys, testes and lungs in rats treated with doxorubicine. Eur J Drug Metab Pharmacokinet 37(4):301-307. Wang J, Chen C, Li B, Yu H, Zhao Y, Sun J, Li Y, Xing G, Yuan H, Tang J, Chen Z, Meng H, Gao Y, Ye C, Chai Z, Zhu C, Ma B, Fang X, Wan L. 2006. Antioxidative function and biodistribution of [Gd@C82(OH)22]n nanoparticles in tumor-bearing mice. Biochem Pharmacol 71(6):872-881.
122
123 Yamada T, Nakaoka R, Sawada R, Matsuoka A, Tsuchiya T. 2010. Effects of intracerebral microinjection of hydroxylated-[60] fullerene on brain monoamine concentrations and locomotor behavior in rats. J Nanosci Nanotechnol 10(1):604-611. Yang D, Zhao Y, Guo H, Li Y, Tewary P, Xing G, Hou W, Oppenheim JJ, Zhang N. 2010. Nanoparticles, [Gd@C82(OH)22]n, induces dendritic cell maturation and activates Th1 immune responses. ACS Nano 4(2):1178–1186. Yin J-J, Lao F, Fu PP, Wamer WG, Zhao Y, Wang PC, Qiu Y, Sun B, Xing G, Dong J, Liang XJ, Chen C. 2009. The scavenging of reactive oxygen species and the potential for cell protection by functionalized fullerene materials. Biomaterials 30:611–621 Zapata, A. 1979. Ultrastructural study of the teleost fish kidney. Dev Comp Immunol 3:55–65.
123
124 6.7 Tables and Figures Table 1. Semi-quantitative histopathology scoring system used to evaluate tissues and organs. Each pathological feature is scored 0-3. If the evaluated organ has more than one pathological feature than the score of each pathological feature is summed to give a histopathology score for the organ. Histopathology score of the organ may therefore be greater than 3. Organ Brain
Liver
Anterior Kidney
Posterior Kidney
Skin
Coelom
Gills
Vestibuloauditory
Score
Pathologic Feature Congestion
None
1 Mildly distended vessels
Hemorrhage
None
Mild or focal
Inflammation in meninges Rodlet cells in meninges Rodlet cells in neuropil Congestion
None None None None
Mild 1-3/40X field 1/40X field Mildly distended vessels
Hepatocyte glycogen accumulation
Normal, finely vacuolated, pale hepatocytes
Mildly reduced
Moderately reduced
Lipid accumulation
None
Hepatocyte degeneration, necrosis or apoptosis Mononuclear cell infiltration Sinusoidal hematopoietic cells
0/40X field
3 alarm cells/40X field Multiple or large ulcers Large groups of leukocytes Pigment absent
None
Mild
Moderate
Severe
None
Mild disorganization or rare apoptosis
Moderate
Frequent apoptosis or loss of many cells
Alarm Cells
0
2 Moderately distended vessels Moderate focal or mild multifocal Moderate 4-8/40X field 2-4/40X field Moderately distended vessels
3 Vessels markedly distended Multifocal or severe focal Severe >8/40X field >4/40X field Vessels markedly distended Densely eosinophilic hepatocyte cytoplasm >10 lipid-laden cells/40X field >10/40X field
Severe Severe
124
125
A
C
B
D
125
126
Histopathology score - coelom
Cumulative histopathology scores
Figure 1
**
2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 Control
Hydroxylated fullerenes
**
4 3.5 3 2.5 2 1.5 1 0.5 0 Control
2B
Hydroxylated fullerenes
0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
**
Control
Histopathology score - posterior kidney
Histopathology score - anterior kidney
2A
Hydroxylated fullerenes
2C
2D
*
4 3.5 3 2.5 2 1.5 1 0.5 0 Control
Hydroxylated fullerenes
Histopathology score - liver
6
**
5 4 3 2 1 0
2E
Control
Hydroxylated fullerenes
126
127 Figure 2
A
B
D
E
C
F
Figure 3
127
128
A A
B B
C
D
Figure 4
128
129 Figure Legends
Figure 1. Presence of hydroxylated fullerenes in the coelomic cavity. Amorphous to finely particulate, yellow to golden brown fullerene nanomaterial (black arrows) is present in the coelomic cavity and is loosely associated with serosal surfaces of organs, liver (1A), pancreas (1A, 1B, 1C), small intestine (1B). Variable numbers of leukocytes with the morphology of macrophages and fewer heterophils and rodlet cells are present, with some phagocytes ingesting abundant nanomaterial (1C, 1D). Nuclear morphology of cells with abundant intracytoplasmic nanomaterial closely resembles normal, non-phagocytic cells of the monocytic/macrophage lineage, indicating lack of activation.
Figure 2. Histopathology Scores. Semi-quantitative scores representative of histopathologic features in control and fullerene-treated fish. In Figure 2A, the mean cumulative histopathology scores for all organs evaluated (brain, liver, anterior kidney, posterior kidney, skin, coelom, gills, and vestibuloauditory system) demonstrate a significant difference (p=0.001) between the control (n=10) and treated (n=10) groups. Comparison of mean histopathology scores for the coelomic cavity (Figure 2B), anterior kidney (Figure 2C), posterior kidney (Figure 2D), and liver (Figure 2E) in these same populations of fish similarly reveal significant differences in morphology associated with fullerene treatment. * Indicates that the effect is statistically significant at P < 0.05; and ** indicates that the effect is statistically significant at P < 0.001. Whiskers indicate standard error of the mean.
129
130
Figure 3. Liver of P. promelas treated with hydroxylated fullerenes showing hepatocyte morphology (A-C); Liver of P. promelas from the control group showing normal hepatocyte morphology (D-F). Hepatocyte cytoplasm in hydroxylated fullerene-treated fish contains scant carbohydrate. Some of the intracytoplasmic material is glycogen, indicated by pink staining with periodic acid-Schiff reagent (3B) and loss of this coloration after amylase treatment (3C). Hepatocyte cytoplasm is pale with crystalline to clumped intracytoplasmic proteins in this female fish from the control group (3D) with abundant intracytoplasmic glycogen (3E, 3F). Hematoxylin and eosin (3A, 3D), periodic acid-Schiff reagent (3B, 3E) and periodic acid-Schiff with amylase pre-treatment (3C, 3F). 1000X magnification.
Figure 4. Histhopathology of anterior and posterior kidney of P. promelas exposed to hydroxylated fullerenes. The anterior kidney of hydroxylated fullerene-treated fish (4B) often contained reduced numbers of lymphoid and myeloid cells compared to control fish (4A). 400X magnification. The interstitium of the posterior kidney in this representative hydroxylated fullerene-treated fish (4D) contains reduced numbers of lymphoid and myeloid cells compared to control (4C). 400X magnification.
130
131
CHAPTER 7. Titanium dioxide nanoparticles increased mortality of fish exposed to bacterial pathogen
Boris Jovanović, Elizabeth Whitley, Kayoko Kimura, Adam Crumpton & Dušan Palić A paper published in Environmental Pollution 203, 153-164. Boris Jovanović is the first and corresponding author of this paper.
7.1. Abstract Nano-TiO2 is immunotoxic to fish and reduces the bactericidal function of fish neutrophils. Here, fathead minnows (Pimephales promelas) were exposed to low and high environmentally relevant concentration of nano-TiO2 (2 ng g-1 and 10 µg g-1 body weight, respectively), and were challenged with common fish bacterial pathogens, Aeromonas hydrophila or Edwardsiella ictaluri. Pre-exposure to nano-TiO2 significantly increased fish mortality during bacterial challenge. Nano-TiO2 concentrated in the kidney and spleen. Phagocytosis assay demonstrated that nano-TiO2 has the ability to diminish neutrophil phagocytosis of A. hydrophila. Fish injected with TiO2 nanoparticles displayed significant histopathology when compared to control fish. The interplay between nanoparticle exposure, immune system, histopathology, and infectious disease pathogenesis in any animal model has not been described before. By modulating fish immune responses and interfering with resistance to bacterial pathogens, manufactured nano-TiO2 has the potential to affect fish survival in a disease outbreak. Capsule abstract: By modulating fish immune responses and interfering with resistance to bacterial pathogens, internalized environmentally relevant concentrations of nano-TiO2 have potential to increase mortality of fish exposed to infectious disease challenge.
Keywords: titanium dioxide, nanoparticles, immune response, disease resistance, fish, bacteria, histopathology.
7.2 Introduction
131
132 From 1916-2011, an estimated 165,050,000 metric tonnes of titanium dioxide (TiO2) pigment (nano and bulk combined) were produced worldwide [1]. Nano-TiO2 is used as a constituent in personal, household, and food products. As an ingredient in food products nanoTiO2 has an estimated human consumption of 1 mg kg-1 body weight per day [2]. Nano-TiO2 is also considered as an additive of drinking water in water treatment plants in a protocol for the removal of arsenic from water [3]. The most frequent predicted concentration of nano-TiO2 in surface water is 21 ng L-1 [4], while the highest potential concentration is 16 µg L-1 [5]. The nano-TiO2 concentration of wastewater effluent is documented in the µg L-1 range [4,6,7]. However, in urban runoff this concentration can be as high as 0.6 mg L-1 [8], and in raw sewage up to 3 mg L-1 of nano-TiO2 has been detected [6,7]. Nano-TiO2 can be absorbed by the gills, skin, and intestine of fish, although the highest potential uptake is through diet [9]. The experiments with perfused intestines of fish demonstrated TiO2 uptake across the intestine both for the nano-TiO2 and its bulk counterpart with average particle aggregates diameter of up to 1124±331 nm [10]. Although nano-TiO2 is classified as a non-bioaccumulative substance in the fish embryos with the bioconcentration factor (BCF) < 100 [11], it is still present in the juvenile and adult fish body upon exposure [12,13] with BCF of 181 [14]. Another study with adult fish determined BCF in the range 600-700, indicating possible increase of risk [15]. Since nano-TiO2 can be transferred via the trophic food chain to fish [13,14], and although observed biomagnification factor is < 1, this suggests that the fish can internalize nano-TiO2 on a daily basis through diet leading to chronic exposure [14]. Nano-TiO2 has a strong bactericidal effect and can kill fish pathogens in vitro [16,17]. Therefore, addition of nano-TiO2 to the water of fish farms has been recommended in order to prevent or mitigate bacterial disease outbreaks [16]. However, methods that are successfully used for bacterial killing in vitro are frequently not efficient when applied to in vivo bacterial killing, due to the differences in the intracellular environment and the specific antibacterial function of phagocytic cells [18]. It was recently demonstrated that nano-TiO2 acts as a strong immunomodulator of fish neutrophil function [19]. Cell-mediated immunity and the phagocytic cells are the primary targets of nano-TiO2 immunotoxicity in aquatic animals. Immunotoxicity is manifested through lysosomal destabilization, frustrated phagocytosis, and change in function of the phagocytic cells [20].
132
133 Aeromonas hydrophila is a Gram-negative motile rod and one of the most important bacterial pathogens of aquatic animals in temperate waters [21,22]. A. hydrophila infection causes a systemic disease resulting in dermal ulceration, tail or fin rot, ocular ulceration, and erythrodermatitis, which leads to the descriptive disease appellations of “hemorrhagic septicemia”, “red sore disease”, “red rot disease”, and “scale protrusion disease”, among others [23]. In the acute form of disease, rapid septicemia is the most common cause of mortality [23]. Pathogenic mechanisms include the production of a cytotoxic enterotoxin, a type 3 secretion system, hemolysins, and an exotoxin [24], along with cytotoxic and haemolytic activities of the bacterial extracellular polysaccharides [25], which collectively have lethal effects on renal tubular epithelium, precipitating acute renal failure. It is important to note that A. hydrophila is a member of the normal intestinal flora of healthy fish [26]. The presence of the bacteria itself in fish does not indicate the disease per se and stress is often considered to be a contributing factor in disease outbreaks caused by A. hydrophila [23]. Edwardsiella ictaluri is a Gram-negative rod from Enterobacteriaceae family. It is the causative agent of Enteric Septicemia Disease that affects a variety of fish species [27]. Clinical signs, apart from signs of generalized systemic bacterial infection, include the presence of an open ulcer on the frontal bone of the skull between the eyes, and intradermal petechial hemorrhage of the jaws [28]. The infection is initiated by transport of bacteria from the environment through the olfactory sac to the brain, with subsequent systemic dissemination of bacteria, causing generalized septicemic infection [28]. During the infection, E. ictaluri may overcome phagocytic activities of neutrophils and other granulocytic cells, and multiplies intracellularly in foci of inflammation [29]. Therefore, previously observed suppression of fish neutrophil function caused by nano-TiO2 [19] has the potential to favor non-bactericidal phagocytosis of E. ictaluri. Nano-TiO2 is immunotoxic to fish and changes the function of fish neutrophils in vivo. After exposure of fathead minnows to 10 µg/g body weight of nano-TiO2 for 48 h, respiratory burst, degranulation of primary granules, and neutrophil extracellular trap (NET) release were significantly reduced [19]. The potential of nano-TiO2 to interfere with resistance to infectious disease as a consequence of the ability to modulate immune responses has not been studied, and there are no available reports addressing possible outcomes of nanoparticle pre-exposure followed by bacterial challenge. The aim of this study was to determine if the outcome of
133
134 bacterial challenge would be more severe in fish that are exposed to environmentally relevant concentrations of nano-TiO2, as compared with bacterial-challenged fish without prior exposure to nano-TiO2. Our hypothesis was that fish exposed to nano-TiO2 would have higher morbidity and mortality than non-exposed fish after challenge with A. hydrophila and E. ictaluri.
7.3 Materials and methods Animal care Fathead minnows (Pimephales promelas) with average weight 2.5 ± 0.5 g were maintained in the Iowa State University, College of Veterinary Medicine, Ames, Iowa, USA. Fish were housed in a water recirculation system supplied with dechlorinated tap water at 20 ºC in 120 L tanks, and fed twice daily with live brine shrimp larvae and dried flake food. Fish were cared for in accordance with approved Iowa State University animal care guidelines.
Bacterial culture A. hydrophila (fish pathogen group, outbreak strain, USDA), and E. ictaluri (fluorescent transformed strain 93-146 pAKgfp1 [30]) were plated on trypticase soy agar (TSA) with 5% of sheep blood plates and incubated at 37 ºC overnight (A. hydrophila) or at 27 ºC for two days (E. ictaluri). Morphologically distinct colonies were selected and placed in trypticase soy broth in a sterile tube. Cultures of A. hydrophila or E. ictaluri were incubated at 37 ºC or 27 ºC, respectively, to achieve logarithmic growth. The optical density of the broth culture was measured spectrophotometrically at 450 nm. Using a previously determined growth curve, colony forming unit (CFU) was determined based on optical density. After diluting the cultures with Hank’s Balanced Salt Solution without Ca, Mg and Phenol Red (HBSS) to obtain the desired CFU, they were used immediately for intraperitoneal (i.p.) injections. To confirm the actual CFU used for bacterial challenge, the diluted cultures were plated on TSA sheep blood plates and enumerated.
Nanoparticle characterization Nano-TiO2 (anatase, nanopowder, < 25nm, 99.7 % purity; Sigma-Aldrich Corp, St. Louis, MO, USA) was used in all experiments. Nano-TiO2 was suspended in sterile HBSS, pH = 7.3. The suspensions of nanoparticles were used as non-filtered or were filtered through a 220
134
135 nm general purpose filter. The non-filtered nano-TiO2 suspension contained particles with average aggregate diameter of 585 nm, average zeta potential of -16.4 mV, and conductivity of 16 mS cm-1. Polydispersity index (PDI) was 0.21. After filtration, the aggregate size had an average diameter of 86 nm, zeta potential of -8.87 mV, and conductivity of 15.4 mS cm-1 as determined by dynamic light scattering (DLS) technique with Malvern Zetasizer Nano ZS-90 instrument (Malvern Instruments Ltd, Malvern, Worcestershire, UK). Since the fish were later injected with the 24 h aged suspension (concentration had to be analytically verified first) DLS measurements were also performed on a 24 h aged suspension. Prior to measurements suspension was sonicated for 10 min in a benchtop portable sonicator. The detailed characterization of the nano-TiO2 is provided in the Supplementary Information.
Nano-TiO2 accumulation in fish tissues To determine the accumulation of nano-TiO2 in fish organs, fish were injected i.p. with 10 µg g-1 body weight with non-filtered nano-TiO2 suspension in HBSS. Negative control was injected with HBSS and both groups fed ad libitum for 48 h. After 48 h fish were euthanized with an overdose of tricaine methane sulphonate (MS-222, Argent Laboratories, Redmond WA, USA) and kidney, spleen, and liver were each dissected from three individuals per treatment and control group. This time period was chosen to demonstrate that the administered nano-TiO2 was present in the body at the beginning of the bacterial challenge study, as well as to provide information on biodistribution. Inductively coupled plasma mass spectrometry (ICP-MS) was performed according to our previously established methodology [31] with some minor modifications. Briefly, organs were weighed and digested in nitric acid. In addition, five whole individuals per group were digested with nitric acid. After digestion, the concentration of Ti isotopes 47 and 49 were measured with ICP-MS using a scandium (Sc) internal standard (m/z=45). The preparation standard used for this analysis was created by spiking blank samples with Ti and Sc. Results were corrected for the natural abundance of Ti isotopes, averaged between the two Ti isotopes measured, and converted to TiO2 concentration as µg g-1 of sample weight.
Nano-TiO2 treatment and challenge with Aeromonas hydrophila
135
136 To investigate the effects of in vivo application of nano-TiO2 on the ability of the immune system to resolve bacterial infection, fish were anesthetized with 100 mg L-1 of aerated and buffered (sodium bicarbonate, pH 8.0) solution of the MS-222. Upon entering the third stage of anesthesia [32], fish were weighed and injected i.p. with sterile preparations of nanoparticles as described above or with HBSS. The fish were randomly divided into five groups (two nanoparticle treatment groups, and three control groups). The first treatment group was injected with 10 µg g-1 body weight of non-filtered nanoTiO2 suspended in HBSS as a standard accepted approach for toxicological, disease challenge, and immunological studies in various species [33]. The second treatment group was injected with nano-TiO2 suspended in HBSS and filtered through 220 nm general purpose filter to remove large aggregates. The concentration of nano-TiO2 after the filtration was determined with ICPMS and fish were administered nano-TiO2 with a final concentration of 2 ng g-1 body weight. The high dose of 10 µg g-1 is close to the concentration and particle size of nano-TiO2 present in raw sewage [6,7]. The low dose of 2 ng g-1 that was administered to the experimental fish is close to the estimated concentration of nano-TiO2 in surface water [5]. The low dose of 2 ng g-1 is, also, 10X less than the concentration of nano-TiO2 present in treated effluent of waste water treatment facilities [6,7]. Concomitantly, the low dose of 2 ng g-1 is 500X less than an estimated human consumption of 1 mg kg-1 body weight per day [2]. It is however important to note that administered nano-TiO2 concentration is the internal concentration in fish, not external concentration in the environment. In the aquatic ecosystem, fish internal and external (environmental) concentration of nano-TiO2 will not necessarily be equal as this depends on many factors. Furthermore, although the selected internal concentrations correspond to externally environmentally relevant concentrations, the delivery method (i.p.) is not environmentally relevant. Two control groups were included: one group of fish was injected with 10 µL g-1 body weight of HBSS; and a no-injection control group was also included. All treatment and control groups had 30-32 individual fish per group. After the injections, fish were transferred to 38 L tanks, and fed to satiation for 48 h. We have previously determined that 48 h after the administration of nano-TiO2 to fathead minnows, their neutrophil function is diminished [19]. After the 48 h incubation period, fish from two treatment groups and one control group (bacteria control) were anesthetized again, as described above, and injected i.p. with 10 µL per gram body
136
137 weight of 5.5 X 107 CFU mL-1 of live A. hydrophila culture suspension (previously determined to cause 10-15% mortality). Fish of the negative control group were injected with 10 µL of sterile soy broth g-1 body weight. After the injections, fish were returned to their 38 L tanks and fed to satiation for 21 days. Mortality events were recorded twice per day (every 12 h) to the end of experiment. Dead fish were sampled for bacterial culture and observed by gross examination of the skin, peritoneal cavity, and kidney. In all instances, a culture of live A. hydrophila colonies was isolated on TSA sheep blood plates from fish that died before the end of the experiment. In a subsequent experiment, A. hydrophila cultures were killed by exposure to 60 ºC for 30 minutes. Inactivation was confirmed as no colonies grew on TSA sheep blood agar. Experimental design and injections of fish were performed as described above.
Nano-TiO2 treatment and challenge with Edwardsiella ictaluri Experimental setup for E. ictaluri was the same as the one described for A. hydrophila. Two concentrations of live E. ictaluri (10 µL per gram body weight of 2.2 X 106 CFU mL-1 and 4.4 X 106 CFU mL-1) were administered. The challenge lasted for 28 days. Mortality events and confirmation of an active infection were recorded as above. In all instances of fish deaths, live and fluorescent E. ictaluri were detected by fluorescent microscopy.
Phagocytosis assay Phagocytosis of A. hydrophila was determined by flow cytometric detection of fluorescent bacteria in neutrophils. Fluorescein isothiocyanate (FITC) labeling of A. hydrophila was performed following the previously described method [34]. Briefly, bacteria were grown in trypticase soy broth together with 50 µg mL-1 FITC (Sigma F7250) at 37 ºC overnight. Following two washes with PBS, bacteria were heat-killed at 60ºC for 30 minutes. Prior to killing, bacteria were plated on blood agar to confirm CFU. Heat-killing of bacteria was also confirmed by plating on blood agar. The bacterial pellet was resuspended with trypticase soy broth, divided into aliquots, and stored at 4 ºC until used. For the phagocytosis assay, a suspension of neutrophils was prepared as previously described [35] and adjusted to 1 x 107 cells mL-1. Neutrophil suspensions were made from each experimental group, each containing pooled neutrophils from the anterior kidney of 10 randomly
137
138 selected P. promelas. Cell suspensions (25 µL) were added to the wells of 96-well plate containing 50 µL of 3% fetal bovine serum (FBS), and 50 µL of non-filtered nano-TiO2 in HBSS (final concentration in the wells of 333 µg mL-1) or HBSS (negative control). After 1 hour incubation at the room temperature, 25 µL of FITC-labeled and opsonized A. hydrophila at concentration of 1 x 109 CFU mL-1 in 5 % carp serum (Common carp serum, courtesy of Wisconsin Department of Natural Resources, Yellowstone Lake, WI) were added to the wells. Additional wells without bacteria were prepared as controls. The whole experimental setup was performed in duplicate. Plates were centrifuged at 400 × g for 2 minutes and incubated at room temperature for 2 h. After incubation, plates were washed twice and centrifuged at 430 × g for 1 minute, supernatant was discarded and cell pellets were resuspended with 1% paraformaldehyde. Flow cytometry data were acquired by a FACSCanto flow cytometer (BD Biosciences, San Jose, CA) and data were analyzed with FlowJo version 9.4.11 software. The phagocytic activity was reported as the percentage of neutrophils that had performed phagocytosis, and as mean fluorescence intensity (MFI) of phagocytosis-positive cells. In addition to in vitro evaluation, an ex vivo validation of phagocytosis was also performed. Fish were anaesthetized and injected i.p. with 10 µg g-1 body weight of non-filtered nano-TiO2 and 2 ng g-1 body weight of filtered nanoTiO2 suspended in HBSS. The control group was injected with HBSS. After 48 h, fish were euthanized and neutrophils were extracted as described above. For ex vivo validation, kidneys of four fish from the same experimental group were pooled as a single sample and phagocytosis levels were determined for 4-7 samples per experimental/control group.
Histopathology Under anesthesia, fish were administered i.p. filtered or non-filtered sterile preparations of nano-TiO2, as described above. After 72 hours, randomly selected fish (n=10) from experimental and control groups were euthanized and immediately fixed in 10% neutral buffered formalin. Bodies were sectioned sagittaly, placed in processing cassettes, demineralized for 18 hours, and processed for routine paraffin embedding. Tissue sections were cut at 6 microns, with most blocks requiring at least two levels of sectioning to allow evaluation of major organs. Results were evaluated by a ACVP board-certified veterinary pathologist masked to treatments, using a modified scoring system as previously described [36], with additional criteria for morphologic changes in anterior and posterior kidney, including glomerular morphology,
138
139 interstitial infiltration of neutrophils, and presence of pigment. In the glomerulus, thickening of capillary walls, capillary dilation and expansion of the mesangium were scored as no increase (0), mild (1), moderate (2), or severe (3). In the interstitium of the kidney, infiltration by neutrophils was scored as none (0), mild (scattered neutrophils) (1), moderate (2), or severe (broad sheets of neutrophils) (3). The presence of interstitial, intravascular, or intraepithelial rodlet cells was scored as none (0), 1-3 per 400X field (1), 4-8 per 400X field (2), and >9 per 400X field (3). Melanomacrophage groups in the posterior kidney were scored as number of groups in a 400X field, with no groups (0), one group (1), two groups (2), and three groups (3), with volume estimation when melanomacrophages were dispersed.
Ultrastructural pathology Fish were injected i.p. with non-filtered or filtered, sterile suspensions of nano-TiO2 or HBSS, and fed ad libitum for 72 hours as above. Immediately after euthanasia, fish were necropsied and samples of heart and anterior kidney were immersed in 2.5% glutaraldehyde in 0.1M-cacodylate buffer at 4OC. Fixed samples were rinsed in cacodylate buffer, post-fixed in 1% osmium tetroxide, dehydrated in alcohols, cleared in propylene oxide, and embedded in epoxy resin. Areas of interest in the atrium and anterior kidney were selected by light microscopic examination of 1-micron thick, toluidine blue-stained, semi-thin sections, and ultrathin sections were cut, stained with uranyl acetate and lead citrate, and examined with a FEI Tecnai 12 Biotwin transmission electron microscope (FEI, Hillsboro, OR).
Statistics The statistical difference in mortality rate between groups was calculated using the ChiSquare Test. The differences in nano-TiO2 distribution among organs and in histopathology scores among treatments were evaluated with Analysis of Variance (ANOVA) or Kruskal-Wallis test, if the population was not in Gaussian distribution, followed by Tukey-Kramer or Dunn’s multiple comparison tests, respectively. Phagocytosis assay data were subjected to the Dunnett’s test procedure or Student t-test where applicable.
7.4 Results Nano-TiO2 accumulation in fish tissues
139
140 ICP-MS analysis confirmed the injected concentration of 10 µg g-1 body weight. After 48 h of exposure whole-body concentration was 9.0 + 0.8 (mean ± standard error of the mean – SEM) µg g-1 body weight of TiO2. TiO2 had the highest bioconcentration in kidney (78.7 + 28.3 µg g-1 kidney), followed by spleen (46 + 0.9 µg g-1 spleen), and liver (8.6 + 3.2 µg g-1 liver) (Fig. 1). The bioconcentration of nano-TiO2 in kidney and spleen was significantly higher than in the whole body (P < 0.01 and P < 0.05, respectively). In contrast, the concentration measured in the liver was not statistically different from the average concentration of the whole body. In the control samples that did not receive any injections of nano-TiO2, TiO2 concentration was below the detection limit of the instrument (0.1 µg L-1).
Challenge with Aeromonas hydrophila The bacteria control (fish that received HBSS and then were challenged with A. hydrophila) had cumulative mortality of 13.5 % (Fig. 2). The fish in the group that was pretreated with 2 ng g-1 body weight of filtered nano-TiO2 and challenged with A. hydrophila had 60 % cumulative mortality. The fish in the group pre-treated with 10 µg g-1 body weight of nonfiltered nano-TiO2 and challenged with A. hydrophila had 82.5 % of cumulative mortality. Both filtered and non-filtered nano-TiO2 treatments, followed by A. hydrophila challenge, caused statistically significant increase in mortality comparing to the bacteria control (not exposed to nano-TiO2; challenged with A. hydrophila) (Chi-Square, P < 0.05). There were no mortalities observed in fish from nano-TiO2 control (nano-TiO2 treated; no bacterial challenge) or shaminjection control groups. Visual examination of fish that were pre-treated with nano-TiO2 and challenged with A. hydrophila revealed development of larger and more severe hemorrhages than in the fish that were subjected to A. hydrophila challenge only. In fish injected with heatkilled A. hydrophila, there were no mortalities observed in any of the treatment or control groups.
Challenge with Edwardsiella ictaluri Bacteria controls treated with 10 µL per gram body weight of 2.2 X 106 CFU mL-1, and 4.4 X 106 CFU mL-1 of live E. ictaluri had cumulative mortality of 19 % and 45 % respectively. The fish in the groups that were pre-treated with 2 ng g-1 body weight of filtered nano-TiO2 and challenged with 2.2 X 106 CFU mL-1, and 4.4 X 106 CFU mL-1 E. ictaluri had significantly (Chi-
140
141 Square, P < 0.05 and P < 0.01 respectively) higher cumulative mortality rate of 47 % and 74 % respectively, as compared with bacteria control (Fig. 3A). The fish in the groups pre-treated with 10 µg g-1 body weight of non-filtered nano-TiO2 and challenged with 2.2 X 106 CFU mL-1 or 4.4 X 106 CFU mL-1 E. ictaluri had significantly higher cumulative mortality rate of 56 % and 97 % respectively, as compared with bacteria control (Chi-Square, P < 0.01 and P < 0.001 respectively) (Fig. 3B). There were no mortalities in nano-TiO2 (nano-TiO2 treated; no bacterial challenge) and no injection control groups.
Phagocytosis assay Exposure of neutrophils for one hour to nano-TiO2 results in significantly reduced phagocytosis in vitro. The percentage of neutrophils that have performed phagocytosis of A. hydrophila was 15 % lower (Fig. 4A) in nano-TiO2 group as compared with the control (t-test, P < 0.05). MFI was lower by 22 % (t-test, P < 0.05), indicating that the neutrophils that have performed phagocytosis in nano-TiO2 group have phagocytized on average 22 % fewer bacteria per neutrophil (Fig. 4B). Ex vivo validation revealed the same pattern of reduction in phagocytosis rate 48 h after exposure to nano-TiO2. In the control group 44.3 ± 3.5 % (mean ± SEM) of neutrophils were phagocytic while only 36.1 ± 2.9 % and 24.4 ± 0.5 % of neutrophils from fish exposed to 10 µg g-1 body weight of non-filtered nano-TiO2 and 2 ng g-1 body weight of filtered nano-TiO2, respectively, were capable of performing phagocytosis.
Histopathology Semi-quantitative morphologic scoring of tissue changes in fish administered filtered or non-filtered nano-TiO2, as compared with sham-injected (negative) controls, revealed significant differences in the anterior kidney and posterior kidney (P < 0.01 and P < 0.0001, respectively). In the anterior kidney, fish injected with filtered nano-TiO2 often had increased numbers of neutrophils with abundant, homogeneous eosinophilic cytoplasm and mild to moderate loss of mononuclear cells with the morphology of macrophages and lymphocytes (Fig. 5). There was a mild increase of neutrophils or loss of mononuclear cells in the anterior kidney of fish exposed to non-filtered nano-TiO2. In the posterior kidney, histologic changes, including mild to moderate interstitial congestion, reduction in melanomacrophage groups, increased numbers of neutrophils with abundant cytoplasm, and irregular thickening of capillary walls, dilated capillaries and/or
141
142 expansion of the mesangium, contributed to statistically significant differences between fish exposed to filtered nano-TiO2 compared to control (Fig. 6A). Among these histologic features in the posterior kidney, there were significantly reduced numbers of hematopoietic cells after exposure to filtered nano-TiO2 (Figures 6B, C, D). Also, there were significant differences in the glomerular morphology with administration of filtered or non-filtered nanoparticles, with mesangial edema thickening of the glomerular capillary loop walls (Figure 6F). Populations of melanomacrophages were reduced in the renal interstitium of fish receiving filtered nano-TiO2, often with smaller or disseminated groups of cells (Figure 6E). Statistically significant differences were not observed in the brain, coelomic cavity, or liver.
Ultrastructural pathology In fish exposed to non-filtered or filtered nano-TiO2, many phagocytes lining the fibromuscular trabeculae of the atrium or admixed with atrial blood contain variably sized, intracytoplasmic aggregates of electron-dense material when compared to the control group (Figure 7A). Some intracellular aggregates are membrane-bound, while a membrane was not observed to surround other aggregates of this material (Figure 7B). This electron-dense material did not have the fine tubular ultrastructure of Weibel-Palade bodies, secretory organelles typical of endothelia [37], although Weibel-Palade bodies were present in some endothelial cells. The atrial trabeculae of fish exposed to a filtered preparation of nano-TiO2 were markedly expanded by clear space between cardiomyocytes, consistent with edema (Figure 7C), with disruption of many intercellular junctions between endothelial cells and between cardiomyocytes (Figure 7D) and regional loss of myofibrillar architecture. Rarely, endocardial phagocytes with intracytoplasmic aggregates of electron-dense material were observed in a control fish.
7.5 Discussion In vivo exposure of P. promelas, a common freshwater teleost, to environmentally relevant concentrations of nano-TiO2 has important biological effects. TiO2 bioaccumulated in the kidney and spleen, both critical organs involved in hematopoiesis and immune protection. Groups of fish pre-treated with nano-TiO2 and subsequently exposed to common bacterial pathogens of fish, A. hydrophila or E. ictaluri, resulted in markedly increased mortality. Based on results, mechanisms of toxicity appear to target neutrophil function, hematopoiesis, and renal
142
143 glomerular architecture. The results of this study are in accordance with previous research demonstrating the potential for nano-TiO2-mediated immunotoxicity in fish [20]. The reduced function of P. promelas neutrophils after exposure to nano-TiO2 has been demonstrated previously [19]. Present study also demonstrated that the kidney is one of the major organs for nano-TiO2 bioaccumulation in fish as soon as 48 h after parenteral administration, which is in accordance with previous investigations. Rainbow trout exposed to nano-TiO2 by i.p. injection demonstrated renal bioaccumulation; with almost no clearance even 90 days post-exposure [38]. Another recent study demonstrated that in rainbow trout up to 94% of TiO2 concentrated in the kidney after intravenous injection [39]. In fish, the kidney has a major role in hematopoiesis and serves as a neutrophil depot [40]. Therefore, the neutrophil population that is continuously produced and resides in the fish kidney can be chronically exposed to nano-TiO2. Histopathologic examination of tissues from TiO2-exposed fish support the storage of nanoparticles in renal neutrophils, as sheets of large cells with nuclear morphology consistent with neutrophils with a distended cytoplasmic compartment were observed in some fish exposed to filtered nano-TiO2. The loss of mature and progenitor hematopoietic and immune system cells in the anterior and posterior kidneys in fish exposed to nano-TiO2 represents another mechanism through which nanoparticles may cause an ineffective antibacterial response. Loss of hematopoietic and immune system cells in the fish kidney after exposure to nanoparticles appear to be a common histopatological feature after nanoparticle exposure, irrespective to the type of nanoparticles [36]. Significant differences in the glomerular morphology with administration of filtered or nonfiltered nanoparticles, with thickening of the glomerular capillary loop walls and mesangial edema were also observed by light microscopy in this study. The irregularly thickened exterior surfaces of glomerular capillary loops suggest pathology of the glomerular filtration barrier, which is composed of fenestrated capillaries, basal lamina of endothelial cells, and podocytes, with a charge- and size-selective sieve between podocytes foot processes [41]. Phagocytes lining the atrial trabeculae have critical functions in removal of particulate matter in teleosts, similar to macrophage populations in mammalian lymph nodes [42]. The cardiac endothelium also functions as a semi-selective barrier between the plasma compartment and underlying contractile cardiomyocytes with a critical role in maintaining cardiac performance [43]. Many endocardial phagocytes in fish exposed to nano-TiO2 in these
143
144 experiments had ingested electron-dense particulate material (which in its appearence resembled nano-TiO2) and had a rounded morphology with abundant cytoplasm, consistent with an activated phenotype. Since followup elemental analyses of those cells were not performed by electron spectroscopic imaging and parallel electron energy loss spectroscopy there is no definite proof that the observed electron-dense material is indeed TiO2. However, the electron microscopy presentation of previously imaged nano-TiO2 anatase in tissues [44,45] is consistent with material observed in samples from nano-TiO2 exposed fish (Fig 7). In fish exposed to filtered nano-TiO2, we observed separation of endocardial cells from the underlying trabeculae, with disruption of endothelial tight junctions as well as multifocal dissolution of intercellular junctions of the intercalated disk between cardiomyocytes. Disruption of the endothelial lining, accumulation of interstitial edema, and loss of cardiomyocyte communication in muscular trabeculae of the atrium is expected to potentiate intravascular coagulation and to reduce cardiac function. Scant electron-dense particulate matter in rare endothelial cells of control fish was much less than in TiO2-treated fish and probably represents background environmental exposure. Heat-inactivated A. hydrophila did not cause mortality in any of the experimental groups. This is consistent with previous findings [25]. The mechanism of A. hydrophila pathogenicity include the use of a type 3 secretion system and secreted toxins [46], with both mechanisms requiring viable bacteria. Samples of heat-killed A. hydrophila, as used in this experiment, are expected to contain abundant lipopolysaccharide (LPS), because LPS is a component of the outer membrane of Gram-negative bacteria. While nano-TiO2 can act as a carrier of LPS through protein corona formation [47], the absence of mortality in the experimental group exposed both to nano-TiO2 and subsequently heat-killed A. hydrophila suggests that delivery of LPS by nanoTiO2 to the kidney cells is not an important pathogenic mechanism. The observed increase in mortality with live A. hydrophila pretreated with nano-TiO2 suggests direct immunotoxic effects of nano-TiO2 on renal granulocytic population [19], as these cells are critical for successful antibacterial defenses. Present study further demonstrated that the neutrophil phagocytosis rate of A. hydrophila in vitro was decreased by 15 % after exposure to nano-TiO2. On average, neutrophils that have performed phagocytosis had phagocytized 22 % fewer individual bacteria per neutrophil after exposure to nano-TiO2. We theorize that this reduction in phagocytosis is due to nanoparticle competition. Nano-TiO2 is heavily internalized by immune cells through macropinocytosis [48];
144
145 thus, there is a partitioning of available phagosomal and cytoplasmic space between nano-TiO2 and bacteria, as reflected by the significant decrease in MFI we observed in association with nano-TiO2 exposure. Treatment of freshwater invertebrates with various nanoparticles, including TiO2, is known to reduce phagocytosis by immune cells [49,50]. Cumulatively, results support the concept that nano-TiO2 increases the pathogenenicity of A. hydrophila infection through loss of immune cell populations and reduced phagocytic function, resulting in immunosuppression and failure to mount an effective antibacterial response. Infection by E. ictaluri yielded results similar to A. hydrophila challenge. Pretreatment with nano-TiO2 significantly increased mortality. Although E. ictaluri is susceptible to phagocytosis by fish neutrophils, intracellular killing is not an effective means to control this bacterium, and the main bactericidal effects are expressed through neutrophilic extracellular killing mechanisms [51]. There are numerous references documenting that E. ictaluri can survive and replicate within fish neutrophils and macrophages [52-55]. Thus, decreased neutrophil extracellular function, predominately NET release in vivo after exposure to nano-TiO2 [19] can contribute to bacterial survival in, and in the vicinity of, phagocytes and result in progression of infection to death [56]. The concentrations of nano-TiO2 to which the fish were exposed in present study are environmentally relevant, and represent external concentration that the fish may encounter in the environment. A dose of 2 ng g-1 body weight of nano-TiO2 falls close to or within the estimated environmental concentration in the surface water that ranges from 21 ng L-1 [4] to 16 µg L-1 [5]. The concentration of 2 ng g-1 is also 10 times less than the concentration of nano-TiO2 present in effluent of the waste water treatment facilities [6,7]. It is important to note that since the fish were injected they were exposed internally to this concentration. In the aquatic ecosystem, fish internal and external (concentration in water) concentration of nano-TiO2 will not necessarily be equal as this depends on many factors. However, this internal concentration of 2 ng g-1 is 500 times smaller than the internal concentration to which humans are exposed orally on a daily base - 1 µg g-1 body weight per day of nano-TiO2/E171 [2]. Therefore, this level of exposure raises potential health concerns regarding the current practice of supplementing drinking water, food, and pharmaceuticals with TiO2 intended for human consumption. In conclusion, the interaction of nano-TiO2 with innate immune cells and their progenitors impaired host defenses of fish sufficiently to result in significantly increased
145
146 mortality and morbidity during subsequent challenge by bacterial pathogens. Morphologic changes in glomerular and endocardial architecture suggest that there may also be altered renal filtering function and cardiac function, respectively, with nano-TiO2 exposure. These findings indicate that environmental contamination by nano-TiO2 could negatively affect fish survival by interfering with immune responses and internal organ function during disease outbreaks.
Acknowledgments We are thankful to Travis Witte for his help with ICP-MS analysis; Diane Gerjets for histopathology processing; and Judith Stasko for electron microscopy. This research was partially supported by a Marie Curie FP7 Career Integration Grant (B. Jovanović) within the 7th European Union Framework Programme - Project No PCIG13-GA-2013-618006.
7.6 References 1.
2.
3. 4.
5. 6.
7.
8.
9. 10.
Jovanović B. 2015. Critical review of public health regulations of titanium dioxide, a human food additive. Integrated Environmental Assessment and Management 11 (1) 1020. Weir A, Westerhoff P, Fabricius L, Hristovski K, von Goetz N. 2012. Titanium dioxide nanoparticles in food and personal care products. Environmental Science & Technology 46:2242-2250. EPA. 2010. Nanomaterial case studies: Nanoscale titanium dioxide in water treatment and in topical sunscreen Vol. EPA/600/R-09/057F Gottschalk F, Sonderer T, Scholz RW, Nowack B. 2009. Modeled environmental concentrations of engineered nanomaterials (TiO2, ZnO, Ag, CNT, fullerenes) for different regions. Environmental Science & Technology 43:9216-9222. Mueller NC, Nowack B. 2008. Exposure modeling of engineered nanoparticles in the environment. Environmental Science & Technology 42:4447-4453. Kiser MA, Westerhoff P, Benn T, Wang Y, Pérez-Rivera J, Hristovski K. 2009. Titanium nanomaterial removal and release from wastewater treatment plants. Environmental Science & Technology 43:6757-6763. Westerhoff P, Song G, Hristovski K, Kiser MA. 2011. Occurrence and removal of titanium at full scale wastewater treatment plants: implications for TiO2 nanomaterials. Journal of Environmental Monitoring 13:1195-1203. Kaegi R, Ulrich A, Sinnet B, Vonbank R, Wichser A, Zuleeg S, Simmler H, Brunner S, Vonmont H, Burkhardt M, Boller M. 2008. Synthetic TiO2 nanoparticle emission from exterior facades into the aquatic environment. Environmental Pollution 156:233-239. Handy R, Henry T, Scown T, Johnston B, Tyler C. 2008. Manufactured nanoparticles: their uptake and effects on fish—a mechanistic analysis. Ecotoxicology 17:396-409. Al-Jubory AR, Handy RD. 2013. Uptake of titanium from TiO2 nanoparticle exposure in the isolated perfused intestine of rainbow trout: nystatin, vanadate and novel CO2sensitive components. Nanotoxicology 7:1282-1301.
146
147 11.
12.
13.
14.
15.
16.
17.
18. 19.
20.
21. 22.
23.
24.
25.
López-Serrano Oliver A, Muñoz-Olivas R, Sanz Landaluze J, Rainieri S, Cámara C. In Press. Bioaccumulation of ionic titanium and titanium dioxide nanoparticles in zebrafish eleutheroembryos. Nanotoxicology:DOI: 10.3109/17435390.2014.980758. Ates M, Demir V, Adiguzel R, Arslan Z. 2013. Bioaccumulation, subacute toxicity, and tissue distribution of engineered titanium dioxide nanoparticles in goldfish (Carassius auratus). Journal of Nanomaterials 2013:6. Fouqueray M, Noury P, Dherret L, Chaurand P, Abbaci K, Labille J, Rose J, Garric J. 2013. Exposure of juvenile Danio rerio to aged TiO2 nanomaterial from sunscreen. Environ Sci Pollut Res 20:3340-3350. Zhu X, Wang J, Zhang X, Chang Y, Chen Y. 2010. Trophic transfer of TiO2 nanoparticles from daphnia to zebrafish in a simplified freshwater food chain. Chemosphere 79:928-933. Zhang XZ, Sun HW, Zhang TZY. 2006. Bioaccumulation of titanium dioxide nanoparticles in carp. Huan Jing Ke Xue-Chinese Journal of Environmental Science 27:1631-1635. Cheng TC, Chang CY, Chang CI, Hwang CJ, Hsu HC, Wang DY, Yao KS. 2008. Photocatalytic bactericidal effect of TiO2 film on fish pathogens. Surface and Coatings Technology 203:925-927. Cheng TC, Yao KS, Yeh N, Chang CI, Hsu HC, Chien YT, Chang CY. 2009. Visible light activated bactericidal effect of TiO2/Fe3O4 magnetic particles on fish pathogens. Surface and Coatings Technology 204:1141-1144. Segal AW. 2005. How neutrophils kill microbes. Annual Review of Immunology 23:197223. Jovanović B, Anastasova L, Rowe E, Palić D. 2011. Effects of nanosized titanium dioxide on innate immune system of fathead minnow (Pimephales promelas Rafinesque, 1820). Environmental Toxicology and Safety 74:675-683. Jovanović B, Palić D. 2012. Immunotoxicology of non-functionalized engineered nanoparticles in aquatic organisms with special emphasis on fish - Review of current knowledge, gap identification, and call for further research. Aquatic Toxicology 118119:141-151. Angka SL. 1990. The pathology of the walking catfish, Clarias batrachus (L.), infected intraperitoneally with Aeromonas hydrophila. Asian Fish Sci 3:343-351. Esteve C, Biosca EG, Amaro C. 1993. Virulence of Aeromonas hydrophila and some other bacteria isolated from European eels Anguilla anguilla reared in fresh water. Dis Aquat Org 16:15-20. Cipriano RC. 2001. Aeromonas hydrophila and motile aeromonad septicemias of fish. Fish disease leaflet 68 United States department of the interior Fish and Wildlife Service Division of Fishery Research Washington, D C 20240 http://wwwlscusgsgov/fhb/leaflets/FHB68pdf. Grim CJ, Kozlova EV, Sha J, Fitts EC, van Lier CJ, Kirtley ML, Joseph SJ, Read TD, Burd EM, Tall BD, Joseph SW, Horneman AJ, Chopra AK, Shak JR. 2013. Characterization of Aeromonas hydrophila wound pathotypes by comparative genomic and functional analyses of virulence genes. mBio 4. Rodríguez I, Novoa B, Figueras A. 2008. Immune response of zebrafish (Danio rerio) against a newly isolated bacterial pathogen Aeromonas hydrophila. Fish & Shellfish Immunology 25:239-249.
147
148 26.
27. 28. 29. 30. 31.
32.
33. 34.
35.
36. 37. 38.
39.
40. 41.
42.
Trust TJ, Bull LM, Currie BR, Buckley JT. 1979. Obligate anaerobic bacteria in the gastrointestinal microflora of the grass carp (Ctenopharyngodon idella), goldfish (Carassius auratus), and rainbow trout (Salmo gairdneri). Journal of the Fisheries Research Board of Canada 36:1174-1179. Baxa DV, Groff JM, Wishkovsky A, Hedrick RP. 1990. Susceptibility of nonictalurid fishes to experimental infection with Edwardsiella ictaluri. Dis Aquat Org 8:113-117. Miyazaki T, Plumb JA. 1985. Histopathology of Edwardsiella ictaluri in channel catfish, Ictalurus punctatus (Rafinesque). Journal of Fish Diseases 8:389-392. Miyazaki T, Kaige N. 1985. Comparative histopathology of Edwardsiellosis in fishes. Fish Pathology 20:219-227. Karsi A, Lawrence ML. 2007. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid 57:286-295. Jovanović B, Guzmán HM. 2014. Effects of titanium dioxide (TiO2) nanoparticles on caribbean reef-building coral (Montastraea faveolata). Environmental Toxicology and Chemistry 33:1346-1353. Palić D, Herolt DM, Andreasen CB, Menzel BW, Roth JA. 2006. Anesthetic efficacy of tricaine methanesulfonate, metomidate and eugenol: Effects on plasma cortisol concentration and neutrophil function in fathead minnows (Pimephales promelas Rafinesque, 1820). Aquaculture 254:675-685. Janeway C, Murphy KP, Travers P, Walport M. 2008. Janeway’s immunobiology. Garland Science, New York. White-Owen C, Alexander JW, Sramkoski RM, Babcock GF. 1992. Rapid whole-blood microassay using flow cytometry for measuring neutrophil phagocytosis. Journal of Clinical Microbiology 30:2071-2076. Palić D, Andreasen CB, Frank DE, Menzel BW, Roth JA. 2005. Gradient separation and cytochemical characterisation of neutrophils from kidney of fathead minnow (Pimephales promelas Rafinesque, 1820). Fish & Shellfish Immunology 18:263-267. Jovanović B, Whitley EM, Palić D. 2014. Histopathology of fathead minnow (Pimephales promelas) exposed to hydroxylated fullerenes. Nanotoxicology 8:755-763. Valentijn KM, Sadler JE, Valentijn JA, Voorberg J, Eikenboom J. 2011. Functional architecture of Weibel-Palade bodies. Blood 117:5033-5043. Scown TM, van Aerle R, Johnston BD, Cumberland S, Lead JR, Owen R, Tyler CR. 2009. High doses of intravenously administered titanium dioxide nanoparticles accumulate in the kidneys of rainbow trout but with no observable impairment of renal function. Toxicological Sciences 109:372-380. Boyle D, Al-Bairuty GA, Henry TB, Handy RD. 2013. Critical comparison of intravenous injection of TiO2 nanoparticles with waterborne and dietary exposures concludes minimal environmentally-relevant toxicity in juvenile rainbow trout Oncorhynchus mykiss. Environmental Pollution 182:70-79. Zapata A. 1979. Ultrastructural study of the teleost fish kidney. Dev Comp Immunol 3:5565. Tryggavason K. 1999. Unraveling the mechanisms of glomerular ultrafiltration: nephrin, a key component of the slit diaphragm. Journal of the American Society of Nephrology 10:2440-2445. Nakamura H, Shimozawa A. 1994. Phagocytic cells in the fish heart. Arch Histol Cytol 57:415-425.
148
149 43. 44. 45.
46.
47.
48. 49.
50.
51.
52. 53.
54. 55.
56.
Brutsaert DL. 2003. Cardiac Endothelial-Myocardial Signaling: Its Role in Cardiac Growth, Contractile Performance, and Rhythmicity. Physiological Reviews 83:59-115. Geiser M, Kreyling W. 2010. Deposition and biokinetics of inhaled nanoparticles. Particle and Fibre Toxicology 7:2. Mühlfeld C, Rothen-Rutishauser B, Blank F, Vanhecke D, Ochs M, Gehr P. 2008. Interactions of nanoparticles with pulmonary structures and cellular responses. American Journal of Physiology - Lung Cellular and Molecular Physiology 294:L817-L829. Rosenzweig JA, Chopra AK. 2013. Modulation of host immune defenses by Aeromonas and Yersinia species: convergence on toxins secreted by various secretion systems. Front Cell Infect Microbiol:Oct 30;3:70. Ashwood P, Thompson RPH, Powell JJ. 2007. Fine particles that adsorb lipopolysaccharide via bridging calcium cations may mimic nacterial pathogenicity towards cells. Experimental Biology and Medicine 232:107-117. Bartneck M, Keul HA, Zwadlo-Klarwasser G, Groll J. 2010. Phagocytosis independent extracellular nanoparticle clearance by human immune cells. Nano letters 10:59-63. Couleau N, Techer D, Pagnout C, Jomini S, Foucaud L, Laval-Gilly P, Falla J, Bennasroune A. 2012. Hemocyte responses of Dreissena polymorpha following a shortterm in vivo exposure to titanium dioxide nanoparticles: Preliminary investigations. Science of The Total Environment 438:490-497. Gagné F, Auclair J, Turcotte P, Fournier M, Gagnon C, Sauvé S, Blaise C. 2008. Ecotoxicity of CdTe quantum dots to freshwater mussels: Impacts on immune system, oxidative stress and genotoxicity. Aquatic Toxicology 86:333-340. Waterstrat PR, Ainsworth AJ, Capley G. 1991. In vitro responses of channel catfish, Ictalurus punctatus, neutrophils to Edwardsiella ictaluri. Developmental & Comparative Immunology 15:53-63. Ainsworth AJ, Chen DX. 1990. Differences in the phagocytosis of four bacteria by channel catfish neutrophils. Dev Comp Immunol 14:201-9. Baldwin TJ, Newton JC. 1993. Pathogenesis of enteric septicemia of channel catfish, caused by Edwardsiella ictaluri: Bacteriologic and light and electron microscopic findings. Journal of Aquatic Animal Health 5:189-198. Booth NJ, Elkamel A, Thune RL. 2006. Intracellular replication of Edwardsiella ictaluri in channel catfish macrophages. Journal of Aquatic Animal Health 18:101-108. Morrison EE, Plumb JA. 1994. Olfactory organ of channel catfish as a site of experimental Edwardsiella ictaluri infection. Journal of Aquatic Animal Health 6:101109. Arazna M, Pruchniak MP, Demkow U. 2013. Neutrophil extracellular traps in bacterial infections: Strategies for escaping from killing. Respiratory Physiology & Neurobiology 187:74-77.
149
150 7.7 Figures and Tables
Figure captions Figure 1. Distribution of nano-TiO2 in P. promelas organs 48 h after i.p. injection of non-filtered nano-TiO2 10 µg g-1 body weight. Concentration was determined by ICP-MS. N=5. Bars represent standard error of the mean.
Figure 2. Cumulative mortality rate of P. promelas exposed to nano-TiO2 and challenged with Aeromonas hydrophila. Filled squares represent the negative control (HBSS without Ca, Mg and Phenol Red with soy broth); Filled triangles represent the bacteria control (HBSS without Ca, Mg and Phenol Red + 5.5 X 107 CFU mL-1 of live A. hydrophila); Empty squares represent a group treated with filtered nano-TiO2 (2 ng g-1 body weight + 10 µL per gram body weight of 5.5 X 107 CFU mL-1 of live A. hydrophila); Empty triangles represent a group treated with nonfiltered nano-TiO2 (10 µg g-1 body weight + 10 µL per gram body weight of 5.5 X 107 CFU mL-1 of live A. hydrophila). At 0 h time point fish were anaesthetized and injected i.p. with either HBSS or nano-TiO2 (treatment or control, respectively). The dashed line at 48 h time point indicates administration of A. hydrophila and reset of x axis to 0 h of exposure to A. hydrophila. The experiment was run for 21 days. Since no changes in survival rate occurred at a later time point, the last time point presented on x-axis is 168 h. * indicates that the effect of nano-TiO2 on survivability rate is statistically significant when compared with bacteria control (Chi – Square, P < 0.05).
Figure 3. Cumulative mortality rate of P. promelas exposed to nano-TiO2 and challenged with 10 µL per gram body weight of 2.2 X 106 CFU mL-1 (Fig. A), and 4.4 X 106 CFU mL-1 (Fig. 3B) of live E. ictaluri. At 0 h time point, fish were anaesthetized and injected i.p. with either sterile preparations of HBSS or nano-TiO2 (control or treatment, respectively). The dashed line at the day 2 time point indicates administration of E. ictaluri and reset of x axis to 0 h of exposure to E. ictaluri. * indicates that the effect of nano-TiO2 on survivability rate is statistically significant when compared with bacteria control.
150
151 Figure 4. Phagocytosis of A. hydrophila by P. pomephales neutrophils in vitro (Fig. 4A), and mean fluorescent intensity (MFI) of phagocytosed bacteria (Fig. 4B). Neutrophils were pretreated for 1 hour with HBSS (control) or nano-TiO2 prior to phagocytosis assay. * indicates that the effect of nano-TiO2 is significant compared with control (t-test, P < 0.05).
Figure 5. Histologic changes in the anterior kidney associated with in vivo exposure of fathead minnows (P. promelas) to TiO2 nanoparticles. Significant differences (ANOVA, P < 0.05) are present in the semi-quantitative histologic scores of the anterior kidney of fish injected with nano-TiO2 (Fig. 5A). * indicates significant difference from the control group. Histopathology of filtered (2 ng/g) TiO2 anterior kidney (Fig 5B) and control (non-injected) (Fig 5C). The scale bar is 50 microns in length.
Figure 6. Histologic changes in the posterior kidney associated with in vivo exposure of P. promelas to TiO2 nanoparticles. Significant differences (ANOVA, P < 0.0001) are present in the semi-quantitative histologic scores of the posterior kidney of fish injected with filtered or nonfiltered nano-TiO2 (Fig. 6A). Nano-TiO2 exposure resulted in reduced numbers of hematopoietic cells in the interstium (Fig. 6B). Note the significant differences in hematopoietic cell populations (black arrows in Fig 6C, control fish) from the interstitium of the posterior kidney (filtered TiO2, Fig 6D). In each photomicrograph, bar size = 5 microns. Populations of melanomacrophages were reduced in the renal interstitium of fish receiving filtered nano-TiO2, often with smaller or disseminated groups of cells (Fig 6E). Significant differences in the glomerular morphology, after administration of nanoparticles, with mesangial edema and thickening of the glomerular capillary loop walls are presented in Figs 6F, 6G (control) and 6H (filtered nano-TiO2). * indicates significant difference from the control group.
Figure 7. Ultrastructural changes in the heart associated with in vivo exposure of P. promelas to TiO2 nanoparticles. A phagocyte (P) in the atrium of a fish exposed to non-filtered TiO2 contains electron-dense material (Figs 7A and B) with two closely apposed, degenerating cells with electron-dense material (A and B), a lymphocyte (L), and many erythrocytes (E) in close proximity to the phagocyte in Fig 7A. An atrial phagocyte (P) lining a fibromuscular trabecular and a cardiomyocyte (C) contain similar electron-dense material (Fig 7C). In panels A and C,
151
152 arrows point to electron dense material consistent with nano-TiO2 morphology [44,45]. There is expanded space between cardiomyocytes (asterisk) and disruption of intercellular junctions (arrows) in Fig 7D. Bars in A, B, D = 500 nm and C = 2 microns.
152
TiO2 µg g-1 body/organ weight
153
120 100 80 60 40 20 0 Spleen
Kidney
Liver
Whole fish
Figure 1.
153
% of survival
154
100 90 80 70 60 50 40 30 20 10 0
*
*
0
12
24
36
48
12
24
36
48
60
72
84
96
108 120 132 144 156 168
Exposure time (h)
Figure 2.
154
155
% of survival
A
100 90 80 70 60 50 40 30 20 10 0
HBSS/broth or TiO2/broth HBSS/ E. ictaluri TiO2 filtered 2 ng g-1/E. ictaluri TiO2 crude 10 µg g-1/E. ictaluri
* *
1 2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Exposure time in days
B 100 90 80 70 60 50 40 30 20 10 0
HBSS/broth or TiO2/broth HBSS/ E. ictaluri
% of survival
TiO2 filtered 2 ng g-1/E. ictaluri TiO2 crude 10 µg g-1/E. ictaluri
*
1
2
1
2
3
4
5
6
7
8
*
9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Exposure time in days
Figure 3.
155
156
140 140
120
* MFI - % of control
Phagocytosis - % of control
120
100
80
100
80
60
60
0
A
*
Control
Control
0
TiO2 crude 333 ug/mL
Crude TiO2 333 µg mL-1
B
Control
Control
TiO2 333 crude ug/mL
Crude TiO2 333 µg mL-1
Figure 4.
156
Histopathology score - anterior kidney
157
3
*
2.5 2
1.5 1
0.5 0 A
B
Control
1 -1 filtered TiO2 2 ng g
TiO2 10 ug g-1 crude
C
Figure 5.
157
Histopathology score - posterior kidney
158
9
*
8 7
*
6 5 4 3 2 1 0 Control
TiO2 2 ng g-11 filtered
TiO2 10 ug g-1 crude
Histopathology score - posterior kidney Loss of hematopoietic cell population
A 1.8
*
1.6 1.4 1.2
*
1 0.8 0.6 0.4 0.2 0 B
Control
TiO2 2 ng g1-1 filtered
TiO2 10 ug g-1 crude
Figure 6.
158
159
C
D
Figure 6. continued
159
160
Histopathology score Melanomacrophage groups
2.5 2 1.5
* 1 0.5 0
Histopathology score - Glomeruli
E
Control
2.0
1 g-1 filtered TiO2 2 ng
TiO2 10 ug g-1 crude
* *
1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0
F
G
Control
TiO2 2 ng g1-1 filtered
TiO2 10 ug g-1 crude
H
Figure 6. continued
160
161
Fig. A
Fig. B
Figure 7.
161
162
Fig. C
Fig. D
Figure 7. continued
162
163 7.8 Supplementary Information
Nanoparticle characterization Brunauer-Emmett-Teller (BET) Surface Area Analysis: BET analysis was performed with Autosorb iQ Station 1, in N2 atmosphere. The surface area of TiO2 NP was calculated to be 52.77 m2/g. BET surface area calculated from the linear part of the BET plot. Below Supplementary Figure S1 shows the BET N2 adsorption isotherm of TiO2 NP at various pressures.
Supplementary Figure S1. N2 adsorption isotherms and Brunauer-Emmett-Teller (BET) pore size distribution plots of TiO2 NPs. XPS analysis for TiO2 NP chemical structure analysis: XPS analyses were carried out using Thermo Scientific K-Alpha. The Mg K (1253.6 eV) X-ray source was operated at 300 W. A pass energy of 117.40 eV was used for the survey spectra. The spectra were recorded using a 60° take-off angle relative to the surface normal. Major characteristic transition peaks for Ti, O and C were found in the XPS survey spectrum is shown in Supplementary Figure S2. The detected peaks are attributed to the C 1s (285 eV), Ti 2p doublet (458 eV and 464 eV), O 1s (530
163
164 eV), Ti 2s (565 eV) and the correspondent Auger peaks Ti LMM, O KLL and C KLL. The occurrence of C 1s and C KLL peaks is attributed to the surface contamination since the samples were exposed to air before the measurement.
4x10
5
O1s
Intensity (a.u.)
3x10
5
Ti 2p
2x10
5
Ti 2s
1x10
O KLL
C KLL
5
Ti LMM C1s
0 0
200
400
600
800
1000
1200
Binding Energy (eV) Supplementary Figure S2. XPS survey spectrum of TiO2 NP. Supplementary Figure S3 shows the XPS TiO2 2p spectra of the NPs obtained at 293 K. The peaks at around 458 and 464 eV in the XPS spectra correspond to Ti 2p3/2 and Ti 2p1/2 of TiO2, respectively. The titanium to oxygen atomic ratio was obtained by integration of Ti 2p and O 1s peaks. The Ti 2p and Ti 2s peak positions and the titanium to oxygen ratio (1 : 1.93) indicates that TiO2 NPs have mainly anatase crystal structure.
Intensity (a.u.)
Ti 2p3/2
Ti 2p1/2
455
460
465
Binding Energy (eV)
Supplementary Figure S3. XPS 2p spectra of the TiO2 NPs.
164
165 XRD analysis for TiO2 NP crystal structure analysis: X-ray diffraction measurements were made using a Pananalytical X'pert Pro multi-purpose X-Ray diffractometer in the reflection geometry. The CuK radiation (=0.154 nm) was used operating at 40 kV and 40 mA. Measurements were made in the 2θ range from 1 to 80 in steps of 0.05. The XRD pattern of the TiO2 NPs is shown in Supplementary Figure S4. The peaks of the powder materials are identified to corresponding (101), (004), (200), (105), (211), (204), (116), (220) and (303) crystal planes. All these diffraction peaks are well defined and can be perfectly assigned to the anatase
20
30
40
50
60
70
(303)
(116) (220)
(204)
(105) (211)
(200)
(004)
Relative Intensity (a.u.)
(101)
TiO2.
80
2deg.) Supplementary Figure S4. XRD patterns of the TiO2 NPs. Crystal size and morphology analysis of TiO2 NPs: Transmission electron microscopic (TEM) images were obtained for TiO2 nanoparticles by using FEI Tecnai G2 F30 instrument. Samples were prepared by drop casting one to two drops of particle dispersions in ethanol onto a carbon coated cop. The TEM investigation revealed that the TiO2 NPs have broad size distributions with sharp and well defined clean edges. The average particle size of the TiO2 particles was calculated to be (19.10 ± 3) nm.
165
166
CHAPTER 8. Review of titanium dioxide nanoparticle phototoxicity: Developing a phototoxicity ratio to correct the endpoint values of toxicity tests Boris Jovanović A paper published in Environmental Toxicology and Chemistry 34 (5), 1070-1077.. Boris Jovanović is the sole and corresponding author of this paper.
8.1. Abstract Titanium dioxide nanoparticles are photoactive and under natural sunlight, produces reactive oxygen species. Reactive oxygen species can be detrimental to many organisms, causing oxidative damage, cell injury, and death. Most studies investigating TiO2 nanoparticle toxicity did not consider photoactivation and performed tests either in dark conditions or under artificial lighting that did not simulate natural irradiation. This paper summarizes the literature and derives a “phototoxicity ratio” (PR) between the results of nano-TiO2 experiments conducted in the absence of sunlight and conducted under solar or simulated solar radiation (SSR) for aquatic species. Therefore, PR can be used to correct endpoints of the toxicity tests with nano-TiO2 which were performed in absence of sunlight. Such corrections may also be important for regulators and risk assessors when reviewing previously published data. A significant difference was observed between the PRs of two distinct groups: (a) aquatic species belonging to order Cladocera and (b) all other aquatic species. Order Cladocera appeared very sensitive and prone to nano-TiO2 phototoxicity. On average nano-TiO2 was 20 times more toxic to non-Cladocera and 1867 times more toxic to Cladocera (median values 3.3 and 24.7 respectively) after illumination. Both median values and 75% quartile of PR are chosen as the most practical values for the correction of endpoints of nano-TiO2 toxicity tests which were performed in dark conditions, or in the absence of sunlight.
166
167 Keywords: TiO2, Nanoparticles, Photoxicity, Simulated solar radiation, Photoactivation
8.2 Introduction Titanium dioxide (TiO2) is a component of many sunscreens, soaps, shampoos, toothpastes, cosmetics, paper products, plastics, ink, paint, and building materials [1] both in its bulk and nanoform. It is also used in human food as a colorant and inactive ingredient where it can also be present both in the bulk and nanoform [1,2]. From 1916 to 2011, an estimated total of 165,050,000 metric tonnes of TiO2 pigment were produced worldwide (bulk and nanoform combined), with a current annual estimated production of over six million metric tonnes per year [2]. Reviews of nano-TiO2 toxicology are available across various evolutionary groups of species [3-8], often summarizing half maximal effective concentration (EC50), half maximal inhibitory concentration (IC50), and median lethal concentration (LC50) values. However, nano-TiO2 is also photoactive and produces reactive oxygen species upon illumination [9]. Reactive oxygen species can be detrimental to many organisms, causing oxidative damage, cell injury, and, ultimately, death [10]. Recently, it has been argued that photoactivation of nano-TiO2 under natural levels of sunlight is sufficient to affect the output of LC50 and EC50 values in standard toxicology tests [11,12]. The majority of studies investigating nano-TiO2 toxicity did not take photoactivation into account and performed tests either in dark conditions or under indoor commercial artificial lighting that did not simulate natural solar irradiation. The aim of present study is to derive a “phototoxicity ratio” (PR) between the results of the nano-TiO2 experiments conducted in the absence of sunlight and conducted in the presence of solar or simulated solar radiation (SSR). To achieve this aim, the literature was searched for studies that included nano-TiO2 experiments both with and without irradiance under the same
167
168 experimental setup and otherwise identical conditions. Therefore, PR can be used to correct endpoints of the toxicity tests with nano-TiO2 which were performed in absence of natural sunlight or SSR. Such corrections may also be important for regulators and risk assessors when reviewing previously published data. Another aim is to provide information for improvement of risk assessment of nano-TiO2. For example, one of the current challenges for conducting risk assessment of nanoparticles such as TiO2 is lack of consistent toxicity data due to the varieties of materials as well as test conditions. A PR derived from existing literature will help to harmonize the toxicity data. Currently, regulatory thresholds for nano-TiO2 does not exist, but regulation of nanoparticles discharge and monitoring in aquatic environment is anticipated in the future. It is expected that regulators will use the PR when deriving thresholds for nano-TiO2 since majority of the published literature reported toxicity endpoints for nano-TiO2 in the absence of natural sunlight or SSR. Of course, the PR value calculated in present study is not absolutely precise and correct for all environmental conditions and species, but it considerably reduces the possible error of data endpoints obtained in the absence of natural sunlight or SSR. It also mitigates uncertainties in the risk assessment process by taking into account the photoactivation and phototoxicity of nano-TiO2.
8.3 Methods A comprehensive literature review was conducted to collect available toxicity endpoints for nano-TiO2. The literature search (September 2014) was performed within four databases— Web of Science, Scopus, Google Scholar, and the University of British Columbia library database—using the following keywords in various combinations: titanium dioxide, TiO2,
168
169 nanoparticles, phototoxicity, photoactivation, EC50, LC50, IC50, and LOEC. Abstracts of numerous hits were read, and downloaded papers were checked for useful information. Only papers that reported results under the same environmental conditions for two different nano-TiO2 exposure groups (with and without SSR) in the form of EC50, LC50, IC50, LOEC, or a ratio were selected. Thus, all included data were based on dose-response curves, ensuring the highest possible quality. Such methodology approach was selected based on the previous study of nano "Toxicity Ratio" [13]. PR was calculated in the form of a ratio: PR = TiO2 LC50, EC50, IC50, LOEC without sunlight or SSR / TiO2 LC50, EC50, IC50, LOEC with sunlight or SSR. A PR greater than 1 means nano-TiO2 is phototoxic. In a few isolated cases, results were not given in the form of a number, but it was possible to derive a number based on figures provided. Since the papers only reported irradiance (power of electromagnetic radiation per unit area) intensity and not actual insolation (total amount of solar radiation or SSR energy received on a given surface area during a given time), insolation value was calculated where possible. Insolation was calculated based on the irradiance (W/m2), actual duration of irradiance (h) and total duration of the toxicity test. In cases where irradiance intensity was reported in units other than W/m2, the data were converted for consistency. For the studies for which data exists only in the form of full spectrum insolation it was important to at least approximate the levels of UVA and UVB used in the studies. At sea level UVA spectra is accountable for 5.7 % of the total sunlight, while UVB is accountable for 0.3 % of the total sunlight [14]. Thus, UVA and UVB approximations were performed on the studies reporting full spectrum with factors of 0.057 and 0.003 for UVA and UVB respectably. Such conversions allowed to check whether UVA and UVB levels used in the studies were of environmental
169
170 relevance by comparing the data with published averaged UVA and UVB levels over Europe. The original data of insolation of the full spectrum are also presented. Since the focus of the present study is environmental relevance, in all cases, data points were excluded from evaluation if testing conditions did not represent environmentally relevant exposure conditions, such as in vitro toxicity tests with cells. Only data from in vivo studies were used. In several studies, nano-TiO2 toxicity was reported as “>” than the highest exposure concentration with no negative toxic effects. In those cases, the highest tested concentration value was used to derive PR. This procedure was only applied if the reported “>” value was from the control TiO2 group that was not exposed to SSR or sunlight. This might have led to a slight underestimation of the PR value, which can be seen as a conservative approach. In all cases the crystal structure of the nano-TiO2 particles, their primary particle size, and their hydrodynamic diameter were reported and the data are presented in Table 1. Therefore, collected data are a mixture of both anatase and rutile crystal forms as well as various particle sizes. Ecosystems generally contain a mixture of all sizes and types of crystal structures of anthropogenically introduced nanoparticles with which decision makers have to cope simultaneously; thus, the aim of the PR is to provide a distinct value within a muddle. The coating of nano-TiO2 was not taken into account when evaluating phototoxicity of nano-TiO2 as all of the collected studies have investigated exclusively bare nano-TiO2. Data were checked for normality with the Kolmogorov-Smirnov test and were found to be not of normal distribution. Spearman rank correlation was performed between the PR value and (a) time duration of the reported toxicity test, (b) time duration of irradiance, (c) irradiance intensity, (d) insolation, and (e) the organism taxa in order to determine whether any of these variables drove the output value. In the case of organism taxa, for the purpose of analysis, a code
170
171 of five different digits was assigned to bacteria, algae, invertebrates, fish, and amphibians. Kruskal-Wallis analysis of variance with a posthoc multiple comparison and/or Mann-Whitney U test were also performed where applicable. Validation of PR in correction of toxicity tests endpoint values was performed on data obtained in absence of sunlight or SSR. "True" phototoxicity data summarized in Table 1 (obtained in the presence of sunlight or SSR), served as a control group. Results were log10 transformed and than statistically compared to either log10 data, log10 (data/median PR), or log10 (data/75 % PR quartile). These three groups of results originated from the same set of analyzed studies but were obtain in the absence of sunlight or SSR.
8.4 Results The literature search resulted in 25 usable references, from which a total of 62 pairs of data were generated for calculation of PR (see Table 1). In total, experiments were performed on 20 different species, ranging from bacteria to amphibians. Applied total irradiance was between 0.46 and 231 W/m2 (mean 35.63 W/m2, median 17 W/m2), while effective total insolation was between 0.013 and 200 Wh/m2 (mean 17.44 Wh/m2, median 2.83 Wh/m2). The recalculated and approximated insolation mean and median data for UVA are 5.64 W/m2 and 1.7 W/m2; and for UVB 0.243 W/m2 and 0.015 W/m2 respectively. Majority of the studies have used the same nano-TiO2 products - P25 Degussa resulting in a fairly similar size span of primary particle diameter. Minimum and maximum values for PR were 0.84 and 16778, respectively, while mean and median values were 407.5 and 3.7. The discrepancy between the mean and median was primarily caused by the data associated with the Cladocera taxon. First, when the data were
171
172 analyzed for susceptibility of bacteria, algae, invertebrates, fish, and amphibians to phototoxicity, the invertebrates were significantly different compared to other groups. Nano-TiO2 was significantly more toxic to invertebrates after exposure to light compared to other groups resulting in bigger PR ratio (Kruskal-Wallis followed by posthoc multiple comparison). On the other hand, the Spearman rank correlation test was not statistically significant for phylogeny and PR (decreased or increased phototoxicity of nano-TiO2 from species on the lower organism stadium such as bacteria towards more complex organisms such as amphibians). Also, there was no correlation between PR and (a) irradiation intensity, (b) duration of irradiation, or (c) received insolation. Indeed, when exclusive Cladocera data were analyzed against all other taxons (Figure 1), the statistical difference was highly significant (Mann-Whitney U test, P < 0.01). Due to the clear need for data segregation, separate descriptive statistics were performed for Cladocera and nonCladocera PR values (Table 2). On average nano-TiO2 was 20 times more toxic to nonCladocera and 1867 times more toxic to Cladocera (median values 3.3 and 24.7 respectively) after illumination. Significant statistical difference was observed between "true" phototoxicity data and data obtained in the absence of sunlight or SSR (Figure 2). Once the data were corrected by dividing data obtained in the absence of sunlight or SSR with a median PR or a 75% quartile PR value there was no longer statistical difference compared to the data obtained in the presence of sunlight or SSR (Figure 2). However, we do not claim that values for median PR and 75% PR quartile are definite, as they will change over time as more data points become available from future studies.
172
173 8.5 Discussion The fact that the Cladocera taxon was more sensitive to nano-TiO2 phototoxicity can not be explained by the intensity of irradiation or received insolation during testing, since such correlation was not statistically significant (Spearman rank correlation test). In Cladocera-related experiments, median irradiation and insolation were even smaller than in experiments with other species. After checking the original publications from which data were derived, there was no evidence that Cladocera were exposed to any specific grade, type, or size of nano-TiO2 particles to which other taxons were not exposed. UV sensitivity of the taxon has to be ruled out as well, since appropriate exposure controls to UV were included and no increase in toxicity was detected. Although at higher exposure doses, UV is toxic and lethal to Cladocera, at lower doses, numerous protection mechanisms prevent hazardous occurrences [15]. Both UV and nano-TiO2 toxicity are based on reactive oxygen species (ROS) and oxidative stress was indicated in Cladocera exposed to either UV [15,16] or nano-TiO2 [17]. However, this does not necessarily mean that UV and nano-TiO2 have the same toxicity mechanism. While generation of ROS and consequently oxidative stress following exposure to UV radiation requires endogenous photosensitizer molecules, generation of ROS by nano-TiO2 under UV radiation is a direct photochemical process, and the substantial ROS production can readily damage or kill cells or organisms such as Cladocera. Why exactly Cladocera are more sensitive to irradiated nano-TiO2 remains unclear and more targeted research is needed. However, one possible explanation for the high sensitivity of Cladocera to nano-TiO2 phototoxicity is that photoinduced ROS on the surface of Cladocera carapace may interfere with the respiratory gas exchange. In fact surface attachment of nano-TiO2 to Cladocera carapace has been observed in previous studies [18,19] and the inner wall of the carapace is a major site of respiratory gas exchange for Cladocera [20].
173
174 Sunlight is composed of visible, UV, and infrared spectra. Some of the analyzed studies reported irradiance values exclusively within the UV spectrum, while others reported values for the full spectrum. Thus insolation data were also presented based on reported irradiance spectrum. When the data were segregated into what appeared to be insolation values for the full spectrum, the mean insolation was 25.9 Wh/m2 while median was 5 Wh/m2. The studies that supposedly only reported values for the UV spectrum had the mean insolation of 8.72 Wh/m2 while median was 2.83 Wh/m2. For the purpose of comparison, a solar constant (irradiance of the Sun when positioned at one astronomical unit compared to Earth at zenith) measured at the outer surface of Earth’s atmosphere is approximately 1360 W/m2 [21]. A significant amount of the solar constant is lost by the time sunlight reaches a location on the Earth's surface, depending on atmosphere, latitude, and time of day. For example, average insolation of the visible spectrum over a decade of measurements over Europe is between 5-302 Wh/m2 in winter and 285-430 Wh/m2 in summer [22]. Therefore both mean and median (25.9 Wh/m2 and 5 Wh/m2 respectively) insolation used in the studies reporting only values for full spectrum are much less than insolation values over Europe. The most likely culprits for TiO2 phototoxicity are UVA and UVB spectrum since those photons would have enough quantum energy (UVA 3.10 – 3.94 eV per photon; UVB 3.94 – 4.43 eV per photon) [23] vs. energy of visible light photon (1.6-3.4 eV) to overcome the band gap. When UVA and UVB levels approximations were performed on the studies reporting full spectrum and combined with studies directly reporting UVA and UVB mean and median values were 5.64 W/m2 and 1.7 W/m2 for UVA; and 0.243 W/m2 and 0.015 W/m2 respectively for UVB. The actual UV spectrum insolation over Europe is on average 0.7-37.7 Wh/m2 in winter and 3464.2 Wh/m2 in summer for UVA; and 0.001-1.08 Wh/m2 in winter and 0.77-2.05 Wh/m2 in
174
175 summer for UVB [22]. Therefore the mean and the median values for UVA and UVB used in toxicity studies are well within the range of UVA and UVB values over Europe [22]. Therefore the current experimental setups represent realistic and natural conditions, and the obtained results should not be doubted. Thus, levels used in experimental setups are credible for the purpose of risk assessment, as they do not exceed natural conditions. However it is important to note, that approximation to the UVA and UVB values were based under assumption that all of the irradiation lamps spectra used in the phototoxicity studies fully correspond to sunlight spectrum. An early study in 1965 suggested that this may not be the case [24]. Although the technology has advanced significantly over the years there is no absolute guarantee that all of the studies had the proper irradiation lamps. Furthermore, a significant amount of irradiation at sea level altitude is lost due to reflection and asdsorption in the water column following Beer-Lambert law Iz = I0e-kz where z is depth and I0 is the energy of the sunlight at the surface of the water. Although attenuation in pure water might not affect energy of UV light, reflectance of the water surface may - thus reducing the actual UV energy to which aquatic organisms are exposed. However, an opposite effect may occur in shallow waters due to strong scattering of light, thus multiplying the UV exposure levels [25]. Shading effects of macrophyte vegetation may also affect the level of available light. Therefore, although UV insolation levels currently used in nano-TiO2 phototoxicity studies are credible at the water surface level it is still not clear whether they are credible for the risk assessment bellow the water surface. The fact that different studies used different exposure time and different irradiances only suggest that current scientific community does not really have a standardized toxicity test to check for the phototoxicity effects of nanoparticles. Therefore we strongly recommend that universal agreement on irradiation time and irradiance in a standard nanomaterial phototoxicity test is necessary.
175
176 A validation test of PR correction (Figure 2) showed that after correction with a median PR value the corrected data are no longer statistically different from the real data obtained in the presence of sunlight or SSR. Data correction for the PR 75 % quartile was still not significantly different from the real data (P = 0.052) but in general generated much lower endpoints (higher toxicity) as expected. However the value of 75 % quartile application is that compared to the median PR it can more successfully prevent false toxicity underestimation. The use of PR does not mean that the newly corrected data are the true representation of endpoints from toxicity tests, but are likely as close as possible. The only true correction of data can be achieved by defining a function through regression analysis. However, due to the fact that many variables will likely influence the phototoxicity of nano-TiO2 (even if their effect is not statistically significant they will contribute certain % of variability) such as: particle size, hydrodynamic diameter, crystal structure, illumination time, irradiance, insolation, species, organic matter content in test media etc. it will be hard to generate such function. Its use in practice will likely not be feasible as well. Therefore, the use of PR is an oversimplified method which can provide an approximate correction with lots of versatility. One recent study [13] deployed a similar methodology to the present PR approach to determine which is more toxic in the environment, nanosized or dissolved metals. In a later case, “toxicity ratio” was calculated between LD50, LC50, EC50, and IC50 values of dissolved and nanoparticulated metals in order to provide corrections for threshold values in existing regulatory standards. Therefore, the ratio metric approach, whether "toxicity ratio," "phototoxicity ratio," or "nano-ratio" is an inexpensive, straightforward method that mitigates uncertainties for the purpose of risk assessment and management, assuming enough literature is available.
176
177 In conclusion, present study found that nano-TiO2 is phototoxic to aquatic species based on PR values substantially being >1 for majority of analyzed studies. Existing literature on the subject is likely credible for the purpose of risk assessment, since the insolation levels used in experimental setups did not exceed UV levels under natural conditions at the water surface. A significant difference was observed between the PRs of two analyzed groups: aquatic species belonging to order Cladocera and all other aquatic species. Order Cladocera is very sensitive and prone to nano-TiO2 phototoxicity, at least in laboratory based toxicity tests. A median PR value and 75% quartile of PR were chosen as the most practical approach for correcting nano-TiO2 toxicity endpoints obtained in the absence of sunlight or SSR. Using median PR value in correction is a more conservative approach, while using 75 % quartile lowers the chance of underestimating toxicity, and may be therefore more favorable by risk assessors when analyzing previously published data. The values for PR are not definite, and may change as more data become available in the future. Acknowledgement This research was supported by a Marie Curie FP7 Career Integration Grant within the 7th European Union Framework Programme - Project No PCIG13-GA-2013-618006.
8.6 References 1.
2. 3.
4.
Weir A, Westerhoff P, Fabricius L, von Goetz N. 2012. Titanium Dioxide Nanoparticles in Food and Personal Care Products. Environmental Science & Technology 46:22422250. Jovanović B. 2015. Critical review of public health regulations of titanium dioxide, a human food additive. Integrated Environmental Assessment and Management 11:10-20. Clément L, Hurel C, Marmier N. 2013. Toxicity of TiO2 nanoparticles to cladocerans, algae, rotifers and plants – Effects of size and crystalline structure. Chemosphere 90:1083-1090. Jovanović B, Palić D. 2012. Immunotoxicology of non-functionalized engineered nanoparticles in aquatic organisms with special emphasis on fish—Review of current
177
178
5. 6. 7. 8. 9. 10. 11.
12.
13.
14.
15. 16.
17.
18.
19. 20.
21.
knowledge, gap identification, and call for further research. Aquatic Toxicology 118– 119:141-151. Menard A, Drobne D, Jemec A. 2011. Ecotoxicity of nanosized TiO2. Review of in vivo data. Environmental Pollution 159:677-684. Minetto D, Libralato G, Volpi Ghirardini A. 2014. Ecotoxicity of engineered TiO2 nanoparticles to saltwater organisms: An overview. Environment International 66:18-27. Nam D-H, Lee B-c, Eom I-c, Kim P, Yeo M-K. 2014. Uptake and bioaccumulation of titanium- and silver-nanoparticles in aquatic ecosystems. Mol Cell Toxicol 10:9-17. Shi H, Magaye R, Castranova V, Zhao J. 2013. Titanium dioxide nanoparticles: a review of current toxicological data. Particle and Fibre Toxicology 10:15. Carp O, Huisman CL, Reller A. 2004. Photoinduced reactivity of titanium dioxide. Progress in Solid State Chemistry 32:33-177. Fu PP, Xia Q, Hwang H-M, Ray PC, Yu H. 2014. Mechanisms of nanotoxicity: Generation of reactive oxygen species. Journal of Food and Drug Analysis 22:64-75. Ma H, Brennan A, Diamond SA. 2012. Photocatalytic reactive oxygen species production and phototoxicity of titanium dioxide nanoparticles are dependent on the solar ultraviolet radiation spectrum. Environmental Toxicology and Chemistry 31:2099-2107. Ma H, Brennan A, Diamond SA. 2012. Phototoxicity of TiO2 nanoparticles under solar radiation to two aquatic species: Daphnia magna and Japanese medaka. Environmental Toxicology and Chemistry 31:1621-1629. Notter DA, Mitrano DM, Nowack B. 2014. Are nanosized or dissolved metals more toxic in the environment? A meta-analysis. Environmental Toxicology and Chemistry 33:27332739. Moan J. 2001. Visible light and UV radiation. In: Radiation at home, outdoors and in the workplace. Eds. D.Brune, R.Hellborg, B.R.R.Persson and R.Pääkkönen. Scandinavian Science Publisher, Oslo, pp. 69-85. Rautio M, Tartarotti B. 2010. UV radiation and freshwater zooplankton: damage, protection and recovery. Freshw Rev 3:105-131. Vega MP, Pizarro RA. 2000. Oxidative stress and defence mechanisms of the freshwater cladoceran Daphnia longispina exposed to UV radiation. Journal of Photochemistry and Photobiology B: Biology 54:121-125. Kim KT, Klaine SJ, Cho J, Kim S-H, Kim SD. 2010. Oxidative stress responses of Daphnia magna exposed to TiO2 nanoparticles according to size fraction. Science of The Total Environment 408:2268-2272. Dabrunz A, Duester L, Prasse C, Seitz F, Rosenfeldt R, Schilde C, Gabriele ES, Schulz R. 2011. Biological surface coating and molting inhibition as mechanisms of TiO2 nanoparticle toxicity in Daphnia magna. PLoS One 6:e20112. Ma H, Diamond SA. 2013. Phototoxicity of TiO2 nanoparticles to zebrafish (Danio rerio) is dependent on life stage. Environmental Toxicology and Chemistry 32:2139-2143. Pirow R, Wollinger F, Paul RJ. 1999. The sites of respiratory gas exchange in the planktonic crustacean Daphnia magna: an in vivo study employing blood haemoglobin as an internal oxygen probe. Journal of Experimental Biology 202:3089-3099. Kopp G, Lean JL. 2011. A new, lower value of total solar irradiance: Evidence and climate significance. Geophysical Research Letters 38:L01706.
178
179 22.
23. 24. 25.
26.
27.
28.
29.
30. 31.
32.
33.
34.
35.
36.
37.
Häder D-P, Lebert M, Schuster M, Ciampo Ld, Helbling EW, McKenzie R. 2007. ELDONET—A Decade of Monitoring Solar Radiation on Five Continents. Photochemistry and Photobiology 83:1348-1357. ISO. 2007. 2138:2007(E) (International Standard), Space Environment (Natural and Artificial)—Process for Determining Solar Irradiances, Geneva, Switzerland. Monash S. 1965. Composition of sunlight and of a number of ultraviolet lamps. Archives of Dermatology 91:495-496. Garcia-Pichel F, Bebout BM. 1996. Penetration of ultraviolet radiation into shallow water sediments: high exposure for photosynthetic communities. Marine Ecology Progress Series 131:257-262. Binh CTT, Tong T, Gaillard J-F, Gray KA, Kelly JJ. 2014. Common freshwater bacteria vary in their responses to short-term exposure to nano-TiO2. Environmental Toxicology and Chemistry 33:317-327. Tong T, Shereef A, Wu J, Binh CTT, Kelly JJ, Gaillard J-F, Gray KA. 2013. Effects of material morphology on the phototoxicity of nano-TiO2 to bacteria. Environmental Science & Technology 47:12486-12495. Clemente Z, Castro VL, Jonsson CM, Fraceto LF. 2014. Minimal levels of ultraviolet light enhance the toxicity of TiO2 nanoparticles to two representative organisms of aquatic systems. J Nanopart Res 16:1-16. Dalai S, Pakrashi S, Kumar RSS, Chandrasekaran N, Mukherjee A. 2012. A comparative cytotoxicity study of TiO2 nanoparticles under light and dark conditions at low exposure concentrations. Toxicology Research 1:116-130. Adams LK, Lyon DY, Alvarez PJJ. 2006. Comparative eco-toxicity of nanoscale TiO2, SiO2, and ZnO water suspensions. Water Research 40:3527-3532. Kim S, An Y-J. 2012. Effect of ZnO and TiO2 nanoparticles preilluminated with UVA and UVB light on Escherichia coli and Bacillus subtilis. Appl Microbiol Biotechnol 95:243-253. Angelstorf JS, Ahlf W, Kammer FVD, Heise S. 2014. Impact of particle size and light exposure on the effects of TiO2 nanoparticles on Caenorhabditis elegans. Environmental Toxicology and Chemistry 33:2288-2296. Dalai S, Pakrashi S, Chandrasekaran N, Mukherjee A. 2013. Acute toxicity of TiO2 nanoparticles to Ceriodaphnia dubia under visible light and dark conditions in a freshwater system. PLoS ONE 8:e62970. Bar-Ilan O, Louis KM, Yang SP, Pedersen JA, Hamers RJ, Peterson RE, Heideman W. 2012. Titanium dioxide nanoparticles produce phototoxicity in the developing zebrafish. Nanotoxicology 6:670-679. Faria M, Navas JM, Soares AMVM, Barata C. 2014. Oxidative stress effects of titanium dioxide nanoparticle aggregates in zebrafish embryos. Science of The Total Environment 470–471:379-389. Amiano I, Olabarrieta J, Vitorica J, Zorita S. 2012. Acute toxicity of nanosized TiO2 to Daphnia magna under UVA irradiation. Environmental Toxicology and Chemistry 31:2564-2566. Li S, Pan X, Wallis LK, Fan Z, Chen Z, Diamond SA. 2014. Comparison of TiO2 nanoparticle and graphene–TiO2 nanoparticle composite phototoxicity to Daphnia magna and Oryzias latipes. Chemosphere 112:62-69.
179
180 38.
39.
40. 41.
42.
43.
44.
45.
46.
47.
Mansfield CM, Alloy MM, Hamilton J, Verbeck GF, Newton K, Klaine SJ, Roberts AP. 2015. Photo-induced toxicity of titanium dioxide nanoparticles to Daphnia magna under natural sunlight. Chemosphere 120:206-210. Marcone GPS, Oliveira ÁC, Almeida G, Umbuzeiro GA, Jardim WF. 2012. Ecotoxicity of TiO2 to Daphnia similis under irradiation. Journal of Hazardous Materials 211– 212:436-442. Miller RJ, Bennett S, Keller AA, Pease S, Lenihan HS. 2012. TiO2 nanoparticles are phototoxic to marine phytoplankton. PLoS ONE 7:e30321. Dasari TP, Pathakoti K, Hwang H-M. 2013. Determination of the mechanism of photoinduced toxicity of selected metal oxide nanoparticles (ZnO, CuO, Co3O4 and TiO2) to E. coli bacteria. Journal of Environmental Sciences 25:882-888. Tong T, Binh CTT, Kelly JJ, Gaillard J-F, Gray KA. 2013. Cytotoxicity of commercial nano-TiO2 to Escherichia coli assessed by high-throughput screening: Effects of environmental factors. Water Research 47:2352-2362. Bundschuh M, Zubrod JP, Englert D, Seitz F, Rosenfeldt RR, Schulz R. 2011. Effects of nano-TiO2 in combination with ambient UV-irradiation on a leaf shredding amphipod. Chemosphere 85:1563-1567. Li S, Wallis LK, Ma H, Diamond SA. 2014. Phototoxicity of TiO2 nanoparticles to a freshwater benthic amphipod: Are benthic systems at risk? Science of The Total Environment 466–467:800-808. Kim J, Lee S, Kim C-m, Seo J, Park Y, Kwon D, Lee S-H, Yoon T-H, Choi K. 2014. Non-monotonic concentration–response relationship of TiO2 nanoparticles in freshwater cladocerans under environmentally relevant UV-A light. Ecotoxicology and Environmental Safety 101:240-247. Lee W-M, An Y-J. 2013. Effects of zinc oxide and titanium dioxide nanoparticles on green algae under visible, UVA, and UVB irradiations: No evidence of enhanced algal toxicity under UV pre-irradiation. Chemosphere 91:536-544. Zhang J, Wages M, Cox SB, Maul JD, Li Y, Barnes M, Hope-Weeks L, Cobb GP. 2012. Effect of titanium dioxide nanomaterials and ultraviolet light coexposure on African clawed frogs (Xenopus laevis). Environmental Toxicology and Chemistry 31:176-183.
180
181 8.6 Tables and figures Table 1. Review of nano-TiO2 phototoxicity to various species. TiO2 primary particle size (nm) Anatase - A; Rutile -R
Hydrodyna mic diameter of TiO2 (nm)
Endpoint
Organism
Control group
Experimental group
EC50; IC50; LC50; LOEC… mg/L
EC50; IC50; LC50; LOEC… mg/L
Dark
UVA
Indoor light
UVB
Irradian ce (W/m2)
Test duratio n (h)
Irradiance duration (h:min)
Full spectrum Insolation (Wh/m2)
UVA Insolation (Wh/m2)
UVB Insolation (Wh/m2)
PR
Referen ce
200
2
2:00
200.00
11.4
0.6
10.0
[26]
full spectrum
Aeromonas hydrophilla
81 A
?
EC50
25*
2.5*
Aeromonas hydrophilla
50-120 A
299-666
IC50
100
40
1/3
2.5
[27]
Aeromonas hydrophilla
20-50 A
253-608
IC50
100
50
1/3
2.0
[27]
Aeromonas hydrophilla
50-130 A
236-618
IC50
100
60
1/3
1.7
[27]
Aeromonas hydrophilla
70-200 A
279-427
IC50
100
100
1/3
1.0
[27]
Aeromonas hydrophilla
15-25 A/R
401-872
IC50
100
100
1/3
1.0
[27]
Artemia salina
25 A
1600-2400
EC50
480.7
4.05
6
48
48:00
6
0.342
0.018
118.7
[28]
Artemia salina
25 A/R
1400-3700
EC50
284.8
4.03
6
48
48:00
6
0.342
0.018
70.7
[28]
Bacillus licheniformis
25 A
20-2000
EC50
19.57
5.23
3.7
[29]
Bacillus licheniformis
25 A
20-2000
EC50
17.66
4.98
2
2:00
3.5
[29]
Bacillus subtilis
66 A/R
320
ratio
X
X
20
6:00
2.5
[30]
200
1
1:00
8.2
1/3
0:20
5.68
1/3
0:20
231
96
0:30
48
16:00
25
*
0.5
*
Bacillus subtilis
81 A
?
EC50
Bacillus subtilis
> 0.1) when compared to the control (Figure 4A-C). Analysis of the zooplankton biomass revealed that TiO2 did not induce any change in the biomass of Cladocera or Copepoda, separately or combined (Figure 5A). However, the biomass of Rotifera was significantly reduced in the TiO2 25 µg L-1 (by 32%) and TiO2 250 µg L-1 (57%) treatments (Dunnett's test P < 0.01) when compared to the control (Figure 5B-C). The ratio of
220 zooplankton to phytoplankton dry biomass was not significantly different when TiO2 treatments were compared with the control; thus, there was no difference in zooplankton grazing pressure on phytoplankton. There was no statistical difference in macrophytes PVI% between the treatments and control at any single point in time. At the very end of the experiment, the average PVI% was 86. Also, no difference was found between the treatments and control in the biomass of P. pectinatus or P. perfoliatus at the end of the experiment. After the macrophytes were harvested, washed, and separated, two additional species were detected in each mesocosm: Chara sp. and Najas sp. These species were not initially planted but grew from seeds in the sediment. There was no difference in the biomass of either Chara sp. or Najas sp. between the treatments and control. Also, there was no difference in the total biomass of all of the macrophytes or periphyton biomass between the treatments and control. Analysis of abundance and biomass of Chironomus plumosus did not reveal any statistical difference among treatments (Table 2). During the experiment, 2 out of 72 fish died. One died in the TiO2 250 µg L-1 group; the second died in the control group. There were no visible signs of lesions or infection on any deceased or living fish. The majority of the fish were recovered with a net after the experiment, and neither the average mass per fish nor the estimated biomass were statistically different between the treatments and control (Table 2).
10.5 Discussion and conclusion E171 from Fiorio Colori Spa has been previously characterized as having (a) an average particle size of 117 nm, with at least 20% of the particles by number having a diameter < 100
221 nm; (b) anatase crystal structure; (c) 0.13% of Al2O3 impurities and < 1% of SiO2 by dry weight; and (d) an isoelectric point < 2.5 ((Yang et al., 2014). The same producer's sample has been partially characterized elsewhere as having an average particle size of 110 nm, with at least 36% of the particles by number having a diameter < 100 nm (Weir et al., 2012). Although the results of the present study are not exactly the same as those of previous studies, they are fairly similar. The present study found the average primary particle size of the sample to be 167 nm, with pure anatase crystal structure partially covered with hydroxide OH groups. Previously, it was determined that E171 characteristics can vary significantly among producers (Yang et al., 2014); however, the present study indicates that even different batches from the same producer may differ. However, methodology and measuring instruments may also contribute to observed discrepancies. The ability of E171 TiO2 to reduce SRP concentrations was significant in the present study. It is known that nano-TiO2 has a high adsorption rate of phosphorous (28.3 mg g-1) and a very low desorption capacity; thus, obtained results are not unexpected (Moharami and Jalali, 2014). However, because a total of 1.42 mg L-1 or 14.25 mg L-1 of E171 TiO2 was added to two experimental mesocosm groups over 78 days of exposure and the observed decrease in SRP concentration was 1 and 2 µg L-1, respectively, when compared to the control, the TiO2 efficiently removed a maximum of 0.7 mg of SRP per g of TiO2. This is 30X less than the previously determined adsorption coefficient. The previous study (Moharami and Jalali, 2014) was performed under optimum conditions for adsorption time, temperature, pH, and adsorbent dosage, while the present results were obtained under natural conditions. Although the TiO2 reduced SRP concentration in the mesocosms, this change had no biological consequences since
222 the biomass production capacity of the phytoplankton and macrophytes was not limited by the phosphorous. TiO2 nanoparticles are photoactive and are significantly more toxic under natural sunlight to a variety of aquatic species (Jovanović, 2015b). Aggregation of TiO2 nanoparticles and biological surface coating both of phytoplankton (Miller et al., 2012) and zooplankton (Dabrunz et al., 2011) has been described as the reason for this toxicity expression (Jovanović, 2015b). TiO2 phototoxicity is manifested by the particle production of reactive oxygen species, which cause oxidative damage (Li et al., 2014; Miller et al., 2012). Additionally, the inhibition of molting, reproduction, swimming, growth, or available food reduction for zooplankton (Campos et al., 2013; Dabrunz et al., 2011; Jacobasch et al., 2014) is yet another mode of action. All of these toxic effects would essentially reduce the available biomass of the target taxon in an ecosystem. However, such toxic effects have been demonstrated only in laboratory settings using standardized water media with a single species environment and may be lost in a multispecies ecosystem environment. Nekton organisms may actively seek shelter from sunlight, minimizing the phototoxicity effects of TiO2. Food partitioning of consumer organisms in the presence of TiO2 to avoid increased competition may be another mechanism to maintain ecosystem balance. In an aquatic ecosystem, TiO2 particles can settle at the bottom rapidly due to presence of natural organic matter or can even be covered by sediment. In fact, it was previously suggested that nano-TiO2 has a significant sedimentation rate (Keller et al., 2010; Velzeboer et al., 2014). The present study also demonstrated that concentration of suspended nano-TiO2 in lake water decreased approximately 50% within the 24 h period due to sedimentation. Concomitantly, rapid aggregation of the particles was detected. Such behavior of nanoparticles introduces a new variable - the "nanoparticle snowing effect". The snowing effect normally occurs in the aquatic
223 environment within the proximity of nanoparticle pollution sources due to the persistent input. While it is difficult to simulate such effect in the conventional laboratory toxicity tests without multispecies environment, the present outdoor mesocosm study provides conditions close to reality. This is especially important since concentration of nano-TiO2 is not unequivocal in the aquatic ecosystem due to the sedimentation and aggregation; and it is changing dynamically on a spatiotemporal scale. As a result, different species/individuals, even different parts of a single individual, (e.g., macrophytes) will be exposed to a different concentration of nano-TiO2 based on their biological traits and ecological roles. Individuals from two different ecosystem compartments may be exposed to equal effective exposure concentrations expressed as g L-1. At the same time, they may also be exposed to two drastically unequal concentrations if expressed as g m-2 or particle# L-1. Although the outdoor mesocosm studies are more realistic compared to laboratory toxicity tests in terms of risk assessment, quantification and characterization of nanoparticles are much more difficult. Real time quantification and characterization of nanoparticles in a mesocosm on a spatiotemporal scale are currently impossible due to technical restrictions, while available snapshot analyses provide only limited data regarding effective exposure concentration. The present study could not demonstrate any effects of environmentally relevant concentrations of E171 TiO2 on biomass changes of phytoplankton, Cladocera, Copepoda, macrophytes, C. plumosus, or P. parva in mesocosms over a prolonged period of exposure. The only apparent effect was for Rotifera, which experienced a significant reduction in biomass compared to the control. Very little literature exists on the effect of nanoparticles or TiO2 on rotifers. Previously, it was demonstrated that rotifers are able to ingest plastic nanoparticles of various sizes (Snell and Hicks, 2011). Nano-TiO2 toxicity has been investigated in only one
224 euryhaline rotifer species, Brachionus plicatilis, and it caused growth inhibition at a concentration far exceeding those of the present study (Clément et al., 2013). The five most common rotifer taxa observed in the present study were Hexarthra, Polyarthra, Keratella, Asplanchna, and Lecane, accounting for more than 90% of all counted individuals. Thus, there is not enough scientific information to explain observed effects. A possible reason for the rotifer biomass reduction may be biological surface coating with nano-TiO2, which was previously described for other zooplankton organisms (Dabrunz et al., 2011) and led to impaired food filtering or reproduction. In addition, rotifers are inefficient swimmers, spending up to 60% of their metabolism energy for locomotion (Epp and Lewis, 1984). Thus, coating with a material of high specific gravity such as TiO2 (3.77–4.23 g cm-3) may induce starvation and exhaustion or may cause rotifers to sink. Reduced swimming capability likely increases the risk of falling prey to copepods or other zooplankton species. Although rotifers play an important role in many freshwater plankton communities, they are not considered a keystone species (Waltz, 1997). They may, however, play a significant role in the microbial web (Arndt, 1993). In conclusion, environmentally relevant concentrations of E171 TiO2 nanoparticles may negatively affect certain parameters and taxa of the freshwater lentic aquatic ecosystem. In particular, treatments of 25 µg L-1 TiO2 and 250 µg L-1 TiO2 caused a reduction in the amount of available soluble reactive phosphorus in experimental mesocosms by 15% and 23%, respectively. The biomass of Rotifera was significantly reduced by 32% and 57% in the TiO2 25 µg L-1 and TiO2 250 µg L-1 treatments, respectively, when compared to the control. Finally, the intensity of PAR light increased by 5% throughout the water column in the TiO 2 250 µg L-1 treatment. However, none of these negative effects were significant enough to affect the overall
225 function of the ecosystem, as there were no cascade effects leading to a major change in its trophic state or primary production. Acknowledgements The present research was partially supported by B. Jovanović's Marie Curie FP7 Career Integration Grant within the 7th European Union Framework Programme, Project No. PCIG13GA-2013-618006. B. Jovanović also extends acknowledgement to the Scientific and Technological Research Council of Turkey (TUBITAK) for partial support through the visiting scientist fellowship programme, TUBITAK 2221. M. Beklioğlu was supported by the MARS project (Managing Aquatic ecosystems and water Resources under multiple Stress), funded under the 7th EU Framework Programme, Theme 6 (Environment including Climate Change), Contract No. 603378 (http://www.mars-project.eu).We would also like to extend our gratitude to the TUBITAK Marmara Research Center of Turkey, Gebze - Kocaeli, for the help with ICP-MS analysis.
10.6 References Altomare, M., Selli, E., 2013. Effects of metal nanoparticles deposition on the photocatalytic oxidation of ammonia in TiO2 aqueous suspensions. Catalysis Today 209, 127-133. Arndt, H., 1993. Rotifers as predators on components of the microbial web (bacteria, heterotrophic flagellates, ciliates) — a review. Hydrobiologia 255-256, 231-246. Bottrell, H.H., Duncan, A., Gliwicz, Z.M., Grygierek, E., Herzig, A., Hillbricht-Ilkowska, A., Kurasawa, H., Larsson, P., Weglenska, T., 1976. A review of some problems in zooplankton production studies. Norw. J. Zool. 24, 419-456. Campos, B., Rivetti, C., Rosenkranz, P., Navas, J.M., Barata, C., 2013. Effects of nanoparticles of TiO2 on food depletion and life-history responses of Daphnia magna. Aquatic Toxicology 130–131, 174-183. Cheng, T.C., Chang, C.Y., Chang, C.I., Hwang, C.J., Hsu, H.C., Wang, D.Y., Yao, K.S., 2008. Photocatalytic bactericidal effect of TiO2 film on fish pathogens. Surface and Coatings Technology 203, 925-927. Clément, L., Hurel, C., Marmier, N., 2013. Toxicity of TiO2 nanoparticles to cladocerans, algae, rotifers and plants – Effects of size and crystalline structure. Chemosphere 90, 1083-1090.
226 Coleman, H.M., Marquis, C.P., Scott, J.A., Chin, S.S., Amal, R., 2005. Bactericidal effects of titanium dioxide-based photocatalysts. Chemical Engineering Journal 113, 55-63. Culver, D.A., Boucherle, M.M., Bean, D.J., Fletcher, J.W., 1985. Biomass of freshwater crustacean zooplankton from length–weight regressions. Canadian Journal of Fisheries and Aquatic Sciences 42, 1380-1390. Dabrunz, A., Duester, L., Prasse, C., Seitz, F., Rosenfeldt, R., Schilde, C., Schaumann, G.E., Schulz, R., 2011. Biological surface coating and molting inhibition as mechanisms of TiO2 nanoparticle toxicity in Daphnia magna. PLoS ONE 6, e20112. Epp, R.W., Lewis, W.M., 1984. Cost and speed of locomotion for rotifers. Oecologia 61, 289292. European Commission, 2008. Follow-up to the 6th Meeting of the REACH Competent Authorities for the implementation of Regulation (EC) 1907/2006; (REACH). http://ec.europa.eu/environment/chemicals/reach/pdf/nanomaterials.pdf European Parliament, 2006. Regulation (EC) No. 1907/2006 of the European Parliament and of the Council of 18 December 2006 concerning the Registration, Evaluation, Authorisation and Restriction of Chemicals (REACH) (OJ L 396, 30.12.2006). Haghighi, M., Heidarian, S., Teixeira da Silva, J., 2012. The effect of titanium amendment in Nwithholding nutrient solution on physiological and photosynthesis attributes and micronutrient uptake of tomato. Biol Trace Elem Res 150, 381-390. Huang, Z., Maness, P.-C., Blake, D.M., Wolfrum, E.J., Smolinski, S.L., Jacoby, W.A., 2000. Bactericidal mode of titanium dioxide photocatalysis. Journal of Photochemistry and Photobiology A: Chemistry 130, 163-170. Jacobasch, C., Völker, C., Giebner, S., Völker, J., Alsenz, H., Potouridis, T., Heidenreich, H., Kayser, G., Oehlmann, J., Oetken, M., 2014. Long-term effects of nanoscaled titanium dioxide on the cladoceran Daphnia magna over six generations. Environmental Pollution 186, 180-186. Jespersen, A.M., Christoffersen, K., 1987. Measurements of chlorophyll a from phytoplankton using ethanol as extraction solvent. Archiv fu¨r Hydrobiologie 109, 445-454. Jovanović, B., 2015a. Critical review of public health regulations of titanium dioxide, a human food additive. Integrated Environmental Assessment and Management 11, 10-20. Jovanović, B., 2015b. Review of titanium dioxide nanoparticle phototoxicity: Developing a phototoxicity ratio to correct the endpoint values of toxicity tests. Environmental Toxicology and Chemistry 34, 1070-1077. Kaegi, R., Ulrich, A., Sinnet, B., Vonbank, R., Wichser, A., Zuleeg, S., Simmler, H., Brunner, S., Vonmont, H., Burkhardt, M., Boller, M., 2008. Synthetic TiO2 nanoparticle emission from exterior facades into the aquatic environment. Environmental Pollution 156, 233-239. Kasprzak, P., Padisák, J., Koschel, R., Krienitz, L., Gervais, F., 2008. Chlorophyll a concentration across a trophic gradient of lakes: An estimator of phytoplankton biomass? Limnologica - Ecology and Management of Inland Waters 38, 327-338. Keller, A.A., Wang, H., Zhou, D., Lenihan, H.S., Cherr, G., Cardinale, B.J., Miller, R., Ji, Z., 2010. Stability and aggregation of metal oxide nanoparticles in natural aqueous matrices. Environmental Science & Technology 44, 1962-1967. Kim, E., Kim, S.-H., Kim, H.-C., Lee, S., Lee, S., Jeong, S., 2011. Growth inhibition of aquatic plant caused by silver and titanium oxide nanoparticles. Toxicol. Environ. Health Sci. 3, 16.
227 Kiser, M.A., Westerhoff, P., Benn, T., Wang, Y., Pérez-Rivera, J., Hristovski, K., 2009. Titanium nanomaterial removal and release from wastewater treatment plants. Environmental Science & Technology 43, 6757-6763. Kulacki, K.J., Cardinale, B.J., 2012. Effects of nano-titanium dioxide on freshwater algal population dynamics. PLoS ONE 7, e47130. Kulacki, K.J., Cardinale, B.J., Keller, A.A., Bier, R., Dickson, H., 2012. How do stream organisms respond to, and influence, the concentration of titanium dioxide nanoparticles? A mesocosm study with algae and herbivores. Environmental Toxicology and Chemistry 31, 2414-2422. Landkildehus, F., Søndergaard, M., Beklioglu, M., Adrian, R., Angeler, D.G., Hejzlar, J., Papastergiadou, E., Zingel, P., Çakiroğlu, A.I., Scharfenberger, U., Drakare, S., Nõges, T., Sorf, M., Stefanidis, K., Tavşanoğlu, Ü.N., Trigal, C., Mahdy, A., Papadaki, C., Tuvikene, L., Larsen, S.E., Kernan, M., Jeppesen, E., 2014. Climate change effects on shallow lakes: design and preliminary results of a cross-European climate gradient mesocosm experiment Estonian Journal of Ecology 63, 71-89. Lehtinen, K.-J., Larsson, Ȧ., Klingstedt, G., 1984. Physiological disturbances in rainbow trout, Salmo gairdneri (R.), exposed at two temperatures to effluents from a titanium dioxide industry. Aquatic Toxicology 5, 155-166. Li, S., Pan, X., Wallis, L.K., Fan, Z., Chen, Z., Diamond, S.A., 2014. Comparison of TiO2 nanoparticle and graphene–TiO2 nanoparticle composite phototoxicity to Daphnia magna and Oryzias latipes. Chemosphere 112, 62-69. Liu, X., Chen, G., Erwin, J.G., Adam, N.K., Su, C., 2013. Release of phosphorous impurity from TiO2 anatase and rutile nanoparticles in aquatic environments and its implications. Water Research 47, 6149-6156. Luo, Z., Wang, Z., Wei, Q., Yan, C., Liu, F., 2011. Effects of engineered nano-titanium dioxide on pore surface properties and phosphorus adsorption of sediment: Its environmental implications. Journal of Hazardous Materials 192, 1364-1369. Mackereth, F.G.H., Heron, J., alling, J.F., 1978. Water analysis: Some revised methods for limnologists. Freshwater Biological Association, Ambleside, 36. McCauley, E., 1984. The estimation of the abundance and biomass of zooplankton in samples. In Downing, J. A. & F. H. Rigler (Eds.): A manual on methods for the assessment of secondary productivity in freshwaters, 228-265. Michaloudi, E., 2005. Dry weights of the zooplankton of Lake Mikri Prespa (Macedonia, Greece). Belg. J. Zool. 135, 223-227. Miller, R.J., Bennett, S., Keller, A.A., Pease, S., Lenihan, H.S., 2012. TiO2 nanoparticles are phototoxic to marine phytoplankton. PLoS ONE 7, e30321. Moharami, S., Jalali, M., 2014. Effect of TiO2, Al2O3, and Fe3O4 nanoparticles on phosphorus removal from aqueous solution. Environmental Progress & Sustainable Energy 33, 12091219. Mueller, N.C., Nowack, B., 2008. Exposure modeling of engineered nanoparticles in the environment. Environmental Science & Technology 42, 4447-4453. OECD, 2006. Guidance document on simulated freshwater lentic field tests (outdoor microcosms and mesocosms). OECD Environment Health and Safety Publications Series on Testing and Assessment No. 53, Paris, France. ENV/JM/MONO(2006)17.
228 Parparov, A., Zohary, T., Berman, T., Gal, G., 2014. Seston and organic matter. In: Lake Kinnaret; Ecology and management. Editors Zohary, T., Sukenik, A., Berman, T., and Nishri, A. Springer, New York. Aquatic Ecology Series, Vol. 6. 473-484. Rosen, R.A., 1981. Length-dry weight relationships of some freshwater zooplankton. Journal of Freshwater Ecology 1, 225-229. Ruttner-Kolisko, A., 1977. Suggestions for biomass calculations of plankton rotifers. Arc. Hydrobiol. Beih. Ergebn. Limnol. 8, 71-76. Snell, T.W., Hicks, D.G., 2011. Assessing toxicity of nanoparticles using Brachionus manjavacas (Rotifera). Environmental Toxicology 26, 146-152. Velzeboer, I., Quik, J.T.K., van de Meent, D., Koelmans, A.A., 2014. Rapid settling of nanoparticles due to heteroaggregation with suspended sediment. Environmental Toxicology and Chemistry 33, 1766-1773. Waltz, N., 1997. In: Streit, B., Stadler, T., & Lively, C. M. (Eds.). Evolutionary ecology of freshwater animals: concepts and case studies. Vol. 82. Springer. pp.119-149. Weir, A., Westerhoff, P., Fabricius, L., Hristovski, K., von Goetz, N., 2012. Titanium dioxide nanoparticles in food and personal care products. Environmental Science & Technology 46, 2242-2250. Westerhoff, P., Song, G., Hristovski, K., Kiser, M.A., 2011. Occurrence and removal of titanium at full scale wastewater treatment plants: implications for TiO2 nanomaterials. Journal of Environmental Monitoring 13, 1195-1203. Windler, L., Lorenz, C., von Goetz, N., Hungerbühler, K., Amberg, M., Heuberger, M., Nowack, B., 2012. Release of titanium dioxide from textiles during washing. Environmental Science & Technology 46, 8181-8188. Yang, Y., Doudrick, K., Bi, X., Hristovski, K., Herckes, P., Westerhoff, P., Kaegi, R., 2014. Characterization of food-grade titanium dioxide: The presence of nanosized particles. Environmental Science & Technology 48, 6391-6400. Yeo, M.-K., Nam, D.-H., 2013. Influence of different types of nanomaterials on their bioaccumulation in a paddy microcosm: A comparison of TiO2 nanoparticles and nanotubes. Environmental Pollution 178, 166-172. Zheng, X., Chen, Y., Wu, R., 2011. Long-term effects of titanium dioxide nanoparticles on nitrogen and phosphorus removal from wastewater and bacterial community shift in activated sludge. Environmental Science & Technology 45, 7284-7290.
229
10.7 Tables and figures Table 1: Estimated average Hydrodynamic Diameter (dH) of E171 TiO2 over time. SD refers to standard deviation from 6 auto-repeated scans by the Malvern ZetaNano ZS. TiO2 25 μg L-1 TiO2 25 μg L-1 TiO2 250 μg L-1 TiO2 250 μg L-1 Time Lake Water Deionized Water Lake Water Deionized Water dH (nm) dH (nm) dH (nm) dH (nm) (mean ± SD)
(mean ± SD)
(mean ± SD)
(mean ± SD)
0 min
12550 ± 2
2494 ± 5
7110 ± 2
5540 ± 4
5 min
8488 ± 2
1796 ± 6
4414 ± 1
3622 ± 3
10 min
4199 ± 2
1635 ± 15
3266 ± 1
2991 ± 8
15 min
6489 ± 2
1513 ± 17
2033 ± 6
1744 ± 11
20 min
3915 ± 2
1441 ± 11
1411 ± 10
3058 ± 2
25 min
3740 ± 1
1150 ± 19
1532 ± 12
2791 ± 3
30 min
3532 ± 1
1320 ± 20
1421 ± 1
3974 ± 4
35 min
-
1545 ± 11
1261 ± 11
4168± 4
40 min
5980 ± 2
1457 ± 21
2655 ± 6
1943 ± 10
45 min
3920 ± 1
1112 ± 15
4271 ± 1
2135 ± 9
50 min
4261 ± 3
-
1154 ± 15
3817 ± 2
55 min
4895 ± 3
1282 ± 22
3195 ± 7
-
1h
3319 ± 1
1296 ± 10
1636 ± 7
-
24 h
2415 ± 17
437 ± 54
433 ± 19
1148 ± 63
230 Table 2. Summary of all the measurements Before the start of the experiment (Day 0) Control TiO2 25 µg L-1 TiO2 250 µg L-1 Mean SEM Mean SEM Mean SEM TN mg L-1
Throughout the experiment (Average of all samplings: Days 8-78) Control TiO2 25 µg L-1 TiO2 250 µg L-1 Mean SEM Mean SEM Mean SEM
0.68
0.08
0.69
0.06
0.60
0.02
0.55
0.05
0.62
0.06
0.55
0.05
0.01
0.00
0.01
0.00
0.01
0.00
0.01
0.00
0.02
0.00
0.01
0.00
NH4 -N mg L
0.11
0.01
0.10
0.01
0.12
0.01
0.05
0.02
0.05
0.01
0.05
0.02
DIN mg L-1
0.12
0.01
0.11
0.01
0.13
0.01
0.06
0.01
0.07
0.01
0.06
0.02
31.78
2.33
32.88
2.80
29.41
2.69
45.59
4.38
46.97
3.34
41.36
4.21
6.22
0.14
6.34
0.34
5.69
0.23
7.96
1.13
6.82
0.80
6.14
1.03
Water temperature °C
16.95
0.03
16.89
0.01
16.91
0.01
21.35
0.35
21.38
0.35
21.19
0.34
-1
0.41
0.01
0.40
0.00
0.41
0.00
0.37
0.01
0.38
0.01
0.37
0.01
˗
˗
˗
˗
˗
˗
35.74
1.47
36.57
1.58
40.45
1.72
25.75
2.72
25.35
3.52
41.45
22.67
32.26
6.13
30.91
5.50
28.11
6.10
0.27
0.00
0.26
0.00
0.27
0.00
0.24
0.01
0.25
0.01
0.24
0.01
0.20
0.01
0.19
0.00
0.20
0.00
0.18
0.01
0.18
0.01
0.18
0.01
10.79
0.24
11.52
0.11
11.31
0.37
14.26
0.57
13.14
0.35
13.90
0.42
8.40
0.01
8.39
0.06
8.35
0.08
8.68
0.12
8.55
0.10
8.65
0.11
Water column depth cm
89.33
0.66
88.67
1.33
88.67
1.33
80.24
1.41
82.67
1.31
82.38
1.26
Secchi depth cm
89.33
0.66
88.67
1.33
88.67
1.33
73.81
3.28
73.43
3.19
74.52
2.70
0.39
0.14
0.22
0.05
0.48
0.11
2.44
0.35
2.78
0.39
2.10
0.34
˗
˗
˗
˗
˗
˗
2.19
0.72
1.61
0.48
3.06
1.99
-1
NO2+NO3 mg L +
-1
-1
TP µg L
SRP µg L-1 Conductivity mS cm PAR light %* -1
Total suspended solids mg L Total dissolved solids g L-1 -1
Salinity g L -1
O2 mg L pH
-1
Chl-a µg L
Periphyton wet biomass mg cm-2 PVI % Cladocera/Copepoda µg L-1 Rotifera µg L-1
˗
˗
˗
˗
˗
˗
47.91
10.11
46.12
9.61
45.21
8.58
153.72
42.38
69.13
10.06
83.07
39.78
137.52
41.37
157.59
34.96
141.18
32.69
0.32
3.37
1.63
1.79
0.41
5.16
1.18
3.52
0.67
2.19
0.25
2.12
Before the start of the experiment (Day 0)
At the end of the experiment (Day 78)
˗
˗
˗
˗
˗
˗
1.18
0.10
1.94
0.83
0.76
0.29
≈9-10
˗
≈9-10
˗
≈9-10
˗
10.79
1.25
9.74
0.83
8.80
0.09
P. pectinatus dry mass g
˗
˗
˗
˗
˗
˗
75.41
52.82
47.34
32.72
11.74
7.09
P. perfoliatus dry mass g
˗
˗
˗
˗
˗
˗
328.93
144.43
281.67
16.93
371.69
122.51
Chara sp. dry mass g
˗
˗
˗
˗
˗
˗
210.63
88.79
207.75
57.71
399.02
9.18
Najas sp. dry mass g
˗
˗
˗
˗
˗
˗
49.55
5.49
60.38
16.07
46.45
45.72
All macrophytes dry mass g
˗
˗
˗
˗
˗
˗
664.54
110.44
597.14
25.24
828.90
82.25
Chironomid biomass mg cm-2 Fish biomass g m3
*These are average results for all measurements at the various water column depth
231 Figure captions Figure 1 Characteristics of E171 TiO2 particles. A: XRD patterns of the crystal structure, B: XPS spectra survey scan, C: XPS spectra of the Ti2p peak, D: XPS spectra of the O1s peak, E: TEM images of E171 TiO2 particles. Figure 2 Effect of TiO2 on intensity of PAR light in the water column. Data were averaged over multiple sampling times. * indicates that the effect is statistically significant at a level of P < 0.01. Figure 3 Effect of TiO2 on SRP levels. A-B: time series; C: combined data over multiple sampling times and expressed as % of the average control from the corresponding control in time. Dashed lines represent point in time when 30% of the nutrients were added to the system based on average nutrient concentration from day minus 10. Boxes refer to standard error of the mean and whiskers to standard deviation. Figure 4 A: time series of Chl-a concentration, B: carotenoids concentration, and C: 480/663 and 430/410 ratios across TiO2 treatments and control group. Dashed lines represent point in time when 30% of the nutrients were added to the system based on average nutrient concentration from day minus 10. Figure 5 Effect of TiO2 on zooplankton biomass. A: Cladocera + Copepoda time series, B: Rotifera time series, C: Rotifera combined data over multiple sampling times and expressed as % of average control from corresponding control in time. Dashed lines represent point in time when 30% of the nutrients were added to the system based on average nutrient concentration from day minus 10. Boxes refer to standard error of the mean and whiskers to standard deviation.
232
A
C
Figure 1
B
D
E
233
100
% of PAR light penetration
90 80 70 60
TiO2 25 ug/L
50
*
30 20 10 0 0
10
20
30 Depth (cm)
Figure 2
TiO2 250 ug/L Control
40
40
50
60
234
120
% of control
100 80 TiO2 25 ug/L TiO2 250 ug/L
60
Control
40 20 0 8
0
A
36
22
16
51
77
65
Days of exposure 130
18
120
16
110
14
SRP ug/L
12 TiO2 25 ug/L 10 TiO2 250 ug/L Control
8 6
90
80
70
50
2 0
40
0
Figure 3
P < 0.01 100
60
4
B
% of average control
P = 0.1
8
16
22 36 51 Days of exposure
65
77
C
TiO2 25 µg/L
TiO2 250 µg/L
Control
235
6 5
Chl-a ug/L
4 TiO2 25 ug/L TiO2 250 ug/L
3
Control
2 1 0 0
8
16
A
22
36
51
65
77
Days of exposure 9 8
Carotenoids ug/L
7 6 TiO2 25 ug/L
5
TiO2 250 ug/L
4
Control
3 2 1 0 0
B
8
16
22
36
Days of exposure
Figure 4
51
65
77
236
200
350
Cladocera/Copepoda ug/L
250 TiO2 25 ug/L
200
TiO2 250 ug/L
150
Control
100 50
Rotifera biomass % of average control
180
300
0 8
16
22
36
51
C
12 10 8
Rotifera ug/L
120
P < 0.01 P < 0.01
100 80 60 40
65
Days of exposure
TiO2 25 ug/L
6
TiO2 250 ug/L Control
4 2 0 0
Figure 5
140
20
0
A
B
160
8
16
22 Days of exposure
36
51
65
0
TiO2 25 µg/L
TiO2 250 µg/L
Control
237 10.8 Supporting information Supporting Figure S1 Image of pontoon platform and mesocosms used in the study. All tanks are equally spaced and have the same environmental conditions.
238 Supporting Figure S2 Estimated change of TiO2 concentration in the test system over time at different water column depths. Concentrations were measured with ICP-MS (N=3 for each data point). Initial concentration of TiO2 added to the system was 250 µg L-1. Bars represent standard error of the mean. 350.0 300.0
TiO2 µg L-1
250.0
1h
200.0
4h
150.0
8h 24 h
100.0 50.0 0.0 10 cm
50 cm Water column depth
90 cm
239 Supporting table 1. Statistical output of investigated parameters with rANOVA.
Partial eta Observed squared power* 26.71 0.004853 0.930339 0.988408 Rotifera biomass 12.661 0.007029 0.808445 0.934759 SRP 4.796 0.014238 0.210386 0.761581 PAR light 1.387 0.319786 0.316162 0.197972 TN 2.6571 0.149133 0.469697 0.342883 NO2+NO3 0.5776 0.589622 0.161458 0.108313 NH4+-N 0.5776 0.589622 0.161458 0.108313 DIN 2.24 0.254502 0.598399 0.201072 TP 0.21 0.810172 0.027678 0.077421 Water temperature 0.488 0.636515 0.139793 0.098806 Conductivity 0.2513 0.785606 0.077283 0.074544 Total suspended solids 0.381 0.698324 0.112805 0.087785 Total dissolved solids 0.434 0.666929 0.126305 0.093188 Salinity 0.905 0.435088 0.153328 0.164604 O2 0.71 0.528417 0.191540 0.122580 pH 1.20 0.363585 0.286268 0.177130 Water column depth 0.056 0.945687 0.018443 0.055379 Secchi depth 0.5916 0.582769 0.164720 0.109798 Chl-a 1.0534 0.415189 0.296444 0.150146 Carotenoids 0.52547 0.616185 0.149051 0.102793 Periphyton wet biomass 0.6524 0.560080 0.206951 0.110442 PVI 0.6984 0.533718 0.188845 0.121249 Cladocera/Copepoda biomass 0.2298 0.801367 0.071154 0.072394 Zooplankton to phytoplankton dry biomass ratio 1.15490 0.386957 0.315986 0.160397 Chironomid biomass 1.3055 0.338300 0.303212 0.188701 Fish biomass 0.780962 0.499525 0.206551 0.130201 P. pectinatus dry mass 0.16823 0.849013 0.053099 0.066276 P. perfoliatus dry mass 3.19010 0.113834 0.515355 0.401577 Chara sp. dry mass 0.06743 0.935491 0.021983 0.056444 Najas sp. dry mass 2.1754 0.194778 0.420332 0.288299 All macrophytes dry mass *Observed power is based on the post hoc power analysis utilizing the effect size and as such is inversely related to the observed p value. F statistics
p value
240 CHAPTER 11. GENERAL CONCLUSIONS
11.1. Conclusions Based on the results of this thesis TiO2 nanoparticles appear to be toxic to variety of tested species. However, concentrations which are needed to cause toxic threshold may vary both between the species as well as exposures routes. This dissertation provided essential information about fish immune responses toTiO2 nanoparticles and the ability to fight bacterial pathogens in the presence of nanoparticles; evaluated the effect of TiO2 nanoparticles on hatching of both fish and insects; evaluated the stress response of corals exposed to TiO2 nanoparticles; and evaluated realistic impact scenarios of environmentally relevant concentration of TiO2 nanoparticles in freshwater ecosystem. The main results of this thesis are: 1) There is a disagreement with the 1969 decision to approve the use of TiO2 as an inactive ingredient in human food without an established acceptable daily intake, stating that neither significant absorption nor tissue storage following ingestion of TiO2 was possible; 2) TiO2 exposure is causing premature hatching in freshwater fish, is delaying pupation and hatching in fruit flies, and is causing a stress to marine corals, however these effects occur at concentrations higher than environmentally relevant concentrations; 3) Exposure to environmental estimated concentration of nano-TiO2 significantly increased fish mortality during Aeromonas hydrophila and Edwardsiella ictaluri challenge by modulating fish immune responses and interfering with resistance to bacterial pathogens, thus having the potential to affect fish survival in a disease outbreak; 4) The first semi-quantitative histopathology scoring system of fish exposed to nanoparticles was presented and tested; 5) It was concluded that TiO2 is phototoxic and that especially order Cladocera appeared to be very sensitive and prone to TiO2 phototoxicity; 6) Environmentally relevant concentration of TiO2 can affect up to 39 % of the macroinvertebrate community structure; and finally 7) Environmentally relevant concentrations of TiO2 nanoparticles may negatively affect certain parameters and taxa of the freshwater lentic aquatic ecosystem, however, these negative effects are not big enough to affect the overall function of the ecosystem, as there were no cascade effects leading to a major change in its trophic state or primary production.
241 11.2. Recommendations for future research
The results and conclusions of this dissertation can be used as a starting point for studying different research problems such as food nanotoxicology; nanoimmunotoxicology; or ecological risk assessment of engineered nanoparticles in aquatic ecosystems. For example results from the Chapter 2 can lead to future investigations of TiO2 nanoparticles occurrence in human food, absorption by intestinal system and bioaccumulation, and health risk reassessment. Future studies can be directed in investigating the specific characteristic of TiO2 nanoparticles in human food such as size, grade, crystal structure, etc... Chapters 4 and 5 have established the models and basis for investigating the effect of TiO2 nanoparticles on hatching and development, while chapters 3, 9, and 10 indicated benthic organisms as the likely target of toxicity in aquatic ecosystem. Thus, future research should likely deploy OECD218 standard toxicity test - "Sediment-Water Chironomid Toxicity Using Spiked Sediment" in order to investigate effects of TiO2 nanoparticles on the complete life cycle (egg to egg) of chironomids in order to provide answers from the ecological risk assessment perspective. Finally chapter 7 provided the first insight into the interplay between TiO2 nanoparticles, immune system, and bacterial infection in a fish model. In order to exploit the immune model of P. promelas fully, future studies should investigate the response of pro-inflammatory and antiinflammatory cytokines in this species exposed to TiO2 nanoparticles through diet, to complement the existing cellular innate immune function toolbox.
