Transcript profiling suggests transcriptional repression ... - Springer Link

Genet Resour Crop Evol (2009) 56:895–903 DOI 10.1007/s10722-009-9487-2

SHORT COMMUNICATION

Transcript profiling suggests transcriptional repression of the flavonoid pathway in the white-fruited Chilean strawberry, Fragaria chiloensis (L.) Mill. Guillermo Saud • Fabrizio Carbone • Gaetano Perrotta • Carlos R. Figueroa Mario Moya • Rau´l Herrera • Jorge B. Retamales • Basilio Carrasco • Jose Cheel • Guillermo Schmeda-Hirschmann • Peter D. S. Caligari

•

Received: 6 February 2009 / Accepted: 7 September 2009 / Published online: 14 October 2009 Ó Springer Science+Business Media B.V. 2009

Abstract Beyond their participation in fruit pigmentation and because of their high antioxidant activity, flavonoids are considered important constituents of fruits and vegetables. We have previously reported that in the ripe receptacles of Fragaria chiloensis only traces of flavonoids can be found, while cinnamic acid derivatives are highly accumulated. In order to characterize the molecular background of this uncommon phenotype we analyzed the transcriptional profile of different biosynthetic genes, with special regard to the gene encoding Cinnamate 4-Hydroxylase (C4H), the enzyme transforming cinnamic acid into the next intermediary of the phenylpropanoid pathway. Northern blot and quantitative RT-PCR showed low transcript abundance for the gene encoding C4H and also for a series of structural genes responsible for flavonoid

biosynthesis. Together with this, high transcript levels were found for a repressive transcription factor, suggesting that the pathway would be inhibited at the transcriptional level, thus correlating to our previous findings on the chemical phenotype. Our results contribute to the comprehension of the pigmentation phenotype in strawberries, allowing the utilization of Fragaria chiloensis as a model system for the study of antioxidant pigment biosynthesis.

G. Saud C. R. Figueroa M. Moya R. Herrera B. Carrasco P. D. S. Caligari Instituto de Biologıá Vegetal y Biotecnologıá, Universidad de Talca, Talca, Chile

G. Saud (&) Facultad de Ciencias Agrarias y Forestales, Universidad Cato´lica del Maule, Casilla 7D, Curico´, Chile e-mail: [email protected]

F. Carbone G. Perrotta Ente per le Nuove Tecnologie, l’Energia e l’Ambiente (ENEA), Rotondella-Matera, Italy

Present Address: B. Carrasco Facultad de Agronomıá e Ingenierıá Forestal, Pontificia Universidad Cato´lica de Chile, Santiago, Chile

J. B. Retamales Facultad de Ciencias Agrarias, Universidad de Talca, Talca, Chile J. Cheel G. Schmeda-Hirschmann Instituto de Quı´mica de Recursos Naturales, Universidad de Talca, Talca, Chile

Keywords Anthocyanin Fragaria chiloense Fruit color Gene expression Introduction Strawberries encompass a small group of soft-fruited species that belong to the genus Fragaria, in the

Present Address: J. Cheel Department of Pharmacognosy, Faculty of Pharmacy, Charles University, Prague, Czech Republic

123

896

Rosaceae family. Ploidy level amongst them ranges from diploidy in Fragaria vesca L., to the colchicineinduced hybrid decaploid, Fragaria 9 vescana Rud. Bauer et A. Bauer (Bauer 1993). At the octoploid level, three interesting species are found. The relevance of the most economically important one, Fragaria 9 ananassa Duch., resides in its extensive cultivation around the world. This species originated in Europe in the early 1700s, when plants of the other two octoploid species, Fragaria virginiana Mill. from North America and Fragaria chiloensis (L.) Mill. from Chile, spontaneously hybridized in the gardens of the Versailles Palace in France (Darrow 1966). The latter is known to be the maternal progenitor and it is the one from which the large fruit size of Fragaria 9 ananassa is supposed to have been inherited (Darrow 1966). However, what is nowadays known as the commercial strawberry is the result of a large amount of subsequent breeding effort. Many important traits, such as day neutrality (Bringhurst and Voth 1984), have been introgressed from wild relatives into commercial cultivars. In this sense, the strategic reconstruction of Fragaria 9 ananassa, through the use of elite clones of the parental species, is something that has been proposed (Hancock et al. 1993). Therefore, research on the parental species is essential to accelerate the reconstruction process. Among the different subspecies, F. chiloensis spp. chiloensis is the one that is naturally distributed in Chile (Staudt 1999). Within this subspecies, two botanical forms are found; one is f. patagonica Staudt, which is a small, red-fruited strawberry that is frequently found in beaches and forests of southern Chile and in the Chilean and Argentinean northern Patagonia (Latitudes 36°–47° S); the other one is f. chiloensis, which is a large, white-fruited strawberry, only known in cultivation mainly in the coastal range of southern Chile, between latitudes 36° S and 42° S. The latter has been traditionally cultivated in a very small scale. In this sense, research on the Chilean strawberry can be directly applied in its own benefit, supporting its potential development as a new and exotic commercial crop (Retamales et al. 2005). Recently, nutritional and functional attributes, primarily related to antioxidant content, have become an important focus of interest in strawberries (D’Amico and Perrotta 2005; Almeida et al. 2007). Among these compounds, flavonoids play a key role in the functional

123

Genet Resour Crop Evol (2009) 56:895–903

quality of fruits and vegetables, because of their participation in the prevention of degenerative diseases like cancer (Liu 2003). As phenolic compounds, flavonoids originate in the phenylpropanoid pathway and they are the main compounds responsible of the antioxidant activity in strawberry (Zhang et al. 2008). We have previously characterized the phenolic content in a white-fruited genotype of F. chiloensis, reporting that very low amounts of anthocyanin are present in the receptacles (Cheel et al. 2005, 2007). The main phenolic compounds correspond to glycosylated derivatives of cinnamic acid, which is normally metabolized by the enzyme cinnamate 4-hydroxylase (C4H) to produce phenolic precursors for anthocyanin biosynthesis. Molecular genetics of the flavonoid pathway has been extensively investigated in different model systems (Winkel-Shirley 2001). A number of genes implicated in the regulation of anthocyanin related pathways encode proteins belonging to the Myb family of transcription factors (Jin and Martin 1999). Aharoni et al. (2001) cloned and characterized a strawberry cDNA encoding a Myb protein expressed during fruit ripening. Over-expression of the FaMyb1 transgene in tobacco plants blocked the accumulation of flavonoids in the flowers, suggesting a repressive role for this transcription factor. In order to provide an approach for the characterization of the molecular background of the whitefruited phenotype, we focused our attention on the transcriptional profile of flavonoid biosynthetic pathway in different ripening stages, with special regard to C4H and the F. chiloensis ortholog of FaMyb1.

Materials and methods Plant material Three parallel ripening stages were defined in both species, namely: immature, turning and ripe (Fig. 1). The procedure to assign the fruit to the corresponding ripening categories is thoroughly described by Figueroa et al. (2008). Fruits were obtained from a white-fruited genotype of F. chiloensis and from F. 9 ananassa cv. Chandler, both cultivated in the same commercial plot, located in Contulmo, Province of Arauco, VIII Region, Chile (S 38° 040 8.600 , W 73° 140 2.96, 605 m above sea level). Roots, leaves,


897

Fragaria chiloensis Immature

Turning

Ripe

Fragaria × ananassa Immature

Turning

Ripe

runners and flowers), 10 lg of total RNA was electrophoresed in a formaldehyde denaturing gel and blot onto a ZetaProbe nylon membrane (Bio-Rad, USA). Gene fragments were radioactively labelled through PCR amplification in the presence of the Alpha 32P-dCTP EasyTide radioactive nucleotide (Perkin-Elmer, USA). The membrane was first hybridized with the C4H probe, washed and then hybridized with 18S rRNA, in order to show satisfactory hybridization and equal loading of total RNA. Radioisotopic data acquisition was performed with a FLA-5100 Imaging System (Fujifilm, Japan). Quantitative real time RT–PCR

Fig. 1 Stages of development of fruit samples as defined in this research

runners and flowers, as well as live individuals of the Chilean strawberry were also collected. Plants were included in the Fragaria germplasm bank at Universidad de Talca. Experimental samples were stored at -80°C until RNA extraction. Nucleic acid manipulations Unless stated, all procedures were carried out according to standard protocols (Sambrook et al. 1989). RNA was extracted from whole fruits using the CTAB reagent according to the protocol described by Chang et al. (1993). For fragment cloning and transcript analysis, total RNA was previously treated with DNase I (Invitrogen) in order to prevent genomic contamination. Northern blot Northern blot probes were isolated from ripe fruits of F. chiloensis using the Super SMART cDNA PCR Synthesis Kit (Clontech, USA) and oligo dT priming. Fragments of C4H and 18SrRNA were cloned using the following primers: C4Hfwd (ACCGTCTACGG CGAGCACTGG), C4Hrev (GCCAACCACCAAGC ATTCACC), 18Sfwd (TGTCACTACCTCCCCGTG TCAGG), 18Srev (ACTCGACGGATCGCACGGCC ATCG). For each species and ripening stage and for the different tissues of F. chiloensis (roots, leaves,

For each species and ripening stage, two biological replicates (from two different RNA extractions) were prepared. Except for PAL and 4CL, for which primers were designed from Rubus sequences available in the GenBank, all others were designed from F. 9 ananassa sequences (Table 1). Identity was confirmed through BLASTX analysis of amplified fragment sequences (Altschul et al. 1997). For real time qPCR, 1 lg of DNase-treated total RNA for each sample was reverse-transcribed into single stranded cDNA using SuperScript III First-Strand cDNA Synthesis Kit (Invitrogen, USA). Prior to real time experiments, cDNA was purified with GFX PCR columns (Amersham-Pharmacia, UK). The RT product was diluted 1:9 and 3 ll were taken for qRTPCR, using an ABI Prism 7900 Sequence Detection System (Applied Biosystems, USA) and Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, USA) according to the manufacturer’s instructions. Thermocycler conditions were 2 min at 50°C, 10 min at 95°C and 45 cycles of 15 s at 95°C and 1 min at 58°C. q-RT-PCR experiments were performed in triplicate (three technical replicates for each of the two biological ones, in each species and ripening stage). A standard curve of 6-fold dilutions was considered for quantification of PCR amplification product. Confirmation of positive and specific amplification was performed with dissociation curves. Due to its constant expression throughout the ripening process, the gene coding for actin was used to standardize the amplification signal in the different tissues analyzed. After normalization, the mean and standard deviation among the six replicates were calculated for each gene, species and ripening stage.

123

898 Table 1 Primers used in the real time qRT–PCR analysis


Primer name

Primer sequence

GenBank accession of the sequence of origin

PAL for

CAAGTTCTCCTCCAAATG

AF237955

PAL rev

TTGAAGCTSATGTCTTCCAC

C4H for C4H rev

TGCCCTTGGCTTCATGACT GCTTGACACTACGGAGAAAGGT

CO380717

4CL for

GTAGCCAAATCATGAAAGG

AF239686

4CL rev

GTCAATGTACCCTATATCACC

CHS1 for

GGCTCACCGTCGAGACCG

CHS1 rev

GGAGAAGATCACTCGAATCA

CHS2 for

GGCTCACCGTCGAGACCG

CHS2 rev

GGTGAACCCAGATACCTTC

CHS3 for

GGCTCACCGTCGAGACCG

CHS3 rev

TCGAAACCCGGATGCCA

CHS5 for

GGCTCACCGTCGAGACCG

CHS5 rev

AGTGAACCCAGATACCTTT

CHI for

GCCGGAAATGGGAAAGTG

CHI rev

GCTCAGTTTCATGCCTTGAC

F3H for

ATCACCGTTCAACCTGTGGAAG

F3H rev

TCTGGAATGTGGCTATGGACAAC

DFR for DFR rev

CAGCTTGGAGGACATGTTTACTGG CTAACCAGCCCTGCGCTTTTC

AY695812

ANS for

GACTTGTCCATTTGGCCTC

AY695817

ANS rev

CCCCCTCAGTTCCTTAGCATACTC

FGT for

CAAGCAGTCCAACAGCTCAATC

FGT rev

GAAAACATACCCCTCCGGCAC

MYB1 for

GCAACTTGAGGATCAGCC

MYB1 rev

GGTGCCTGAGTTGAATCTC

ACT for

TCGTGTTGCCCCAGAAGAG

ACT rev

CACGATTAGCCTTGGGATTCA

Results Based on the accumulation of cinnamate derivatives in the pulp of the white-fruited strawberry (Cheel et al. 2005, 2007), attention was first focused on the gene encoding Cinnamate 4-hydroxylase, the enzyme responsible for the transformation of cinnamate into coumarate, the next intermediary in the phenylpropanoid pathway. Northern blotting was used as a first approach to assess transcript abundance of C4H. Results showed a weak hybridization signal in all ripening stages of F. chiloensis in comparison to F. 9 ananassa, in which transcript level for this gene peaked in the turning stage, to decay to an intermediate level at the fully ripe stage (Fig. 2A). In order to confirm these results and to have a more exhaustive

123

AY997297 AB201756 AB201757 AB201758 AB201755 AY691918

AY695815 AF401220 AB116565

analysis, a qRT-PCR analysis was performed. Although qRT-PCR primers amplified a different region to that of the hybridization probe, results were coincident and confirmed the findings obtained by Northern blotting. qRT-PCR revealed that in the immature stage transcript levels for this gene are similar in both species (Fig. 2B), but while in F. 9 ananassa the level peaks in the turning stage, low abundance was observed all throughout the process in F. chiloensis. Being a central enzyme of the phenylpropanoid pathway, cinnamate 4-hydroxylase catalyses a key step for lignin biosynthesis. Figure 2C shows higher hybridization signal in roots and runners of F. chiloensis, which are tissues with an active lignin biosynthesis. This, together with the normal


A

899

Fragaria × ananassa Immature

Turning

Ripe C4H 18S rRNA

Fragaria chiloensis Immature

Turning

Ripe C4H 18S rRNA

B

C

Fragaria chiloensis Roots

Leaves Runners Flowers C4H

18S rRNA

Fig. 2 Transcriptional activity of C4H in Fragaria species. A Northern blot analysis during fruit ripening. B Real time qPCR. Transcript abundance is expressed as percentage of the maximum level observed, in this case the turning stage of F. 9 ananassa. Error bars indicate standard deviations. C Northern blot analysis of C4H in different tissues of F. chiloensis. 18S rRNA fragment was used as hybridization control

phenotype displayed by F. chiloensis plants, suggests that repression would occur specifically in the ripening fruits. In order to broaden the analysis of the fruit pigmentation phenotype, transcript profiling of the genes encoding the other enzymes of the phenylpropanoid was performed. In doing so, comparative qRTPCR analyses were performed between both species at the ripening stages already defined. Transcriptional profiles exhibited by F. 9 ananassa in our study were

coincident to those observed by Almeida et al. (2007). However, our analysis revealed that C4H is not the only flavonoid related gene affected in the whitefruited genotype of F. chiloensis. The gene encoding phenylalanine ammonia-lyase (PAL; Fig. 3A) also showed a decreased transcript level in the whitefruited genotype of F. chiloensis, although this was not as severe as it was for C4H. In the case of 4-coumarate:CoA ligase (4CL; Fig. 3B), an erratic behaviour was observed; while a higher level was observed in the immature stage of F. chiloensis, it then decayed to a similar value to that of F. 9 ananassa. For the anthocyanin pathway, it was possible to detect a reduction of transcript abundance in four members of the gene family encoding chalcone synthase (CHS; Fig. 3C–F), being CHS2 and CHS3 the more affected ones in the white-fruited genotype. The genes coding for the next two enzymes downstream in the pathway, chalcone isomerase (CHI; Fig. 3G) and flavanone 3-hydroxylase (F3H; Fig. 3H), were also observed to be affected in the white-fruited genotype of F. chiloensis. The gene encoding the next enzyme, dihydroflavonol reductase (DFR; Fig. 3I), did not seem to be altered in F. chiloensis. A different pattern of expression was observed in the gene for anthocyanin synthase (ANS; Fig. 3J). In this case, a decrease was observed in the ripe stage with respect to the turning stage of F. chiloensis, while in F. 9 ananassa a rising trend was observed during ripening. The gene encoding for the last enzyme of the pathway, flavonoid glycosyl transferase (FGT; Fig. 3K), also showed a strong decrease in transcript abundance in F. chiloensis compared to F. 9 ananassa. Finally, for the gene encoding the transcriptional regulator of the pathway, higher transcript levels were observed in F. chiloensis respect to F. 9 ananassa (Myb1; Fig. 3L), suggesting an over-expression of the gene in the whitefruited strawberry.

Discussion Our previous studies on the phenolic composition (Cheel et al. 2005) showed that the main compounds accumulated in the receptacle of the white-fruited strawberry are cinnamoyl xylopyranoside, cinnamoyl rhamnopyranoside, and cinnamoyl xylofuranosylglucopyranose, which are all glycosylated derivatives of cinnamic acid. This phenotype would now be

123

900


Fig. 3 qRT-PCR analysis of the genes encoding flavonoid biosynthetic enzymes during fruit ripening of Fragaria species. A Phenylalanine ammonia-lyase (PAL). B Coumarate:CoA ligase (4CL). C–F Chalcone synthase (CHS). G Chalcone isomerase (CHI). H Flavanone 3-hydroxylase (F3H). I

Dihydroflavonol reductase (DFR). J Anthocyanin synthase (ANS). K Flavonoid glycosyl transferase (FGT). L Myb1 Transcription Factor (Myb1). Relative transcription level is shown as percentage of the maximum level observed. Error bars indicate standard deviations

explained by our current report on transcript profiling: since C4H transcripts are poorly available, cinnamate 4-hydroxylase would not be sufficiently expressed and cinnamate could not be transformed

into coumarate, giving the accumulation of cinnamic acid derivatives. Cinnamic acid is the first metabolite of the phenylpropanoid pathway and its synthesis is

123


catalyzed by the enzyme phenylalanine-ammonialyase. Downstream in the pathway, the conversion into coumarate is catalyzed by the enzyme cinnamate 4-hydroxylase. Being a central enzyme of the phenylpropanoid pathway, pharmacological and transgenic approaches have been used to investigate the implications of changes in the expression of the C4H gene on the general phenylpropanoid metabolism. Using transgenic tobacco plants, Blount et al. (2000) demonstrated that the activity of PAL and the level of some phenylpropanoid metabolites, like chlorogenic acid, were diminished when the activity of cinnamate 4-hydroxylase was genetically reduced in C4H antisense plants, suggesting a feedback regulation at the entry point of the phenylpropanoid pathway. This fact could explain the lower level of transcription observed in PAL that we are currently reporting in F. chiloensis. On the other hand, Schoch et al. (2002) reported that the use of specific inhibitors of C4H in tobacco cell cultures induced the enhancement of salicylic acid levels in response to elicitation. If a phenomenon like this occurred in F. chiloensis, it could have important implications for improved pathogen resistance related to salicylic acid signalling. Our current results imply the putative overexpression of a repressive transcription factor in F. chiloensis, suggesting the involvement of this F. 9 ananassa ortholog in the transcriptional regulation of the pathway. Aharoni et al. (2001) showed that the over-expression of this regulatory protein in tobacco plants repressed flower pigmentation. Although the genes affected in F. chiloensis do not completely match the transcript profile observed in transgenic tobacco, a yeast two hybrid assay showed protein to protein interactions of FaMyb1 with other transcriptional regulators of phenolic pigment biosynthesis (Aharoni et al. 2001), suggesting that repression would also follow an indirect regulatory cascade. On the other hand, Jin et al. (2000) identified an Arabidopsis mutant defective in the AtMYB4 gene. The mutant accumulates sinapate esters, which are phenylpropanoid metabolites that act as protective sunscreens. The accumulation of these metabolites is consistent with the up-regulation of C4H in the mutant, which seems to be the principal target of this repressive transcription factor. In Vitis, three kinds of berry skin color phenotypes can be distinguished: black, red and white. Boss et al.

901

(1996a, b) demonstrated that the FGT gene is expressed in all red cultivars, but not in the white ones. Other anthocyanin biosynthetic genes are expressed in the white-fruited genotypes, although at lower levels (Boss et al. 1996c). Kobayashi et al. (2001) reported that no differences could be detected in the sequence of the FGT gene between white and red cultivars (including promoter regions), suggesting a regulatory mechanism involved in the repression of this gene in white cultivars. The same authors (Kobayashi et al. 2002) later reported that the transient expression of Myb-related genes in Vitis somatic embryos induced the expression of FGT, as well as red-colored spots of anthocyanin accumulation. The same phenotype was also induced by transient overexpression of FGT, confirming the involvement of Myb transcription factors in the genetic control of anthocyanin biosynthesis in grapes. In the case of F. chiloensis, a number of hypotheses can be proposed to explain the molecular phenotype displayed by the white-fruited genotype. It could be possible that a transcriptional regulatory mechanism globally interferes with the normal expression of the genes affected in the receptacle. On the other hand, transcriptional regulation could be specific to C4H, impairing its normal expression. If this were the case, it could be possible that the lack of intermediaries in the pathway, or the accumulation of one of the precursors (in this case cinnamic acid), could affect the expression of the genes downstream in the pathway. The latter idea would be supported by the findings of Loake et al. (1991). They showed that the promoter of a bean CHS gene has diverse responses to different concentrations of exogenously applied cinnamic acid in alfalfa cell cultures. Whereas a low concentration slightly stimulated the activity of the promoter, high concentrations caused a reduction in transcriptional activity of the reporter gene to which it was fused.

Conclusions The current paper reports a preliminary approach for the molecular characterization of fruit color in strawberries. We have shown that different genes of the phenylpropanoid and flavonoid biosynthetic pathways exhibit low transcript abundance. In addition to this, the putative overexpression of a repressive

123

902

regulatory gene, also suggests transcriptional repression of flavonoid biosynthesis in the white-fruited Chilean strawberry. Together with other nutraceuticals present in this fruit, flavonoid pigments constitute a major target for research, since, as an unusually colored fruit, the Chilean strawberry can be used as model system for studying the biosynthesis of phenolic compounds and the molecular mechanisms involved. Attention should be focused on these candidate genes in order to provide a scientific basis for the development of biotechnological tools for exploiting fruit pigmentation and antioxidant compound biosynthesis. Acknowledgements Research partly financed by DPI Universidad de Talca, CIBS, FONDECYT (project 10509879) and Italian Ministry of Research (MIUR)—project GEPROT. G. S. acknowledges Mecesup, CIBS and Universidad Cato´lica del Maule for a doctoral scholarship. CIBS is also acknowledged for supporting the stay of G. S. in the ENEA laboratory.

References Aharoni A, de Vos CH, Wein M, Sun Z, Greco R, Kroon A, Mol JN, O’Connell AP (2001) The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco. Plant J 28:319–332 Almeida JRM, D’Amico E, Preuss A, Carbone F, Ric de Vos CH, Deiml B, Mourgues F, Perrotta G, Fisher TC, Bovy A, Martens S, Rosati C (2007) Characterization of major enzymes and genes involved in flavonoid and proanthocyanidin biosynthesis during fruit development in strawberry (Fragaria 9 ananassa). Arch Biochem Biophys 465:61–71 Altschul SF, Madden TL, Scha¨ffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucl Acids Res 25:3389–3402 Bauer A (1993) Progress in breeding decaploid Fragaria 9 vescana. Acta Hortic 348:60–64 Blount JW, Korth KL, Masoud SA, Rasmussen S, Lamb C, Dixon RA (2000) Altering expression of cinnamic acid 4hydroxylase in transgenic plants provides evidence for a feedback loop at the entry point into the phenylpropanoid pathway. Plant Physiol 122:107–116 Boss PK, Davis C, Robinson SP (1996a) Expression of anthocyanin biosynthesis pathway genes in red and white grapes. Plant Mol Biol 32:565–569 Boss PK, Davis C, Robinson SP (1996b) Anthocyanin composition and anthocyanin pathway gene expression in grapevine sports differing in berry skin colour. Aust J Grape Wine Res 2:163–170 Boss PK, Davis C, Robinson SP (1996c) Analysis of the expression of anthocyanin pathway genes in developing

123

Genet Resour Crop Evol (2009) 56:895–903 Vitis vinifera L. cv. Shiraz grape berries and the implication for pathway regulation. Plant Physiol 111:1059– 1066 Bringhurst RS, Voth V (1984) Breeding octoploid strawberries. Iowa State J Res 58:371–381 Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Rep 11:113–116 Cheel J, Theoduloz C, Rodrı´guez J, Saud G, Caligari PDS, Schmeda-Hirschmann G (2005) New phenolics from the Chilean strawberry fruits, Fragaria chiloensis ssp. chiloensis. J Agric Food Chem 53:8512–8518 Cheel J, Theoduloz C, Rodrı´guez J, Caligari PDS, SchmedaHirschmann G (2007) Free radical scavenging activity and phenolic content in achenes and thalamus from Fragaria chiloensis ssp. chiloensis, F. vesca and F. 9 ananassa cv. Chandler. Food Chem 102:36–44 D’Amico E, Perrotta G (2005) Genomics of berry fruits antioxidants components. BioFactors 23:179–187 Darrow GM (1966) The strawberry: history, breeding and physiology. Holt, Rinehart and Winston, New York Figueroa CR, Pimentel P, Gaete-Eastman C, Moya M, Herrera R, Caligari PDS, Moya-Leon MA (2008) Softening rate of the Chilean strawberry (Fragaria chiloensis) fruit reflects the expression of polygalacturonase and pectate lyase genes. Postharvest Biol Tech 49:210–220 Hancock JF, Dale A, Luby JJ (1993) Should we reconstitute the strawberry? Acta Hortic 348:86–93 Jin H, Martin C (1999) Multi-functionality and diversity within the plant MYB-gene family. Plant Mol Biol 41:577–585 Jin H, Cominelli E, Bailey P, Parr A, Mehrtens F, Jones J, Tonelli C, Weisshaar B, Martin C (2000) Transcriptional repression by AtMYB4 controls production of UV-protecting sunscreens in Arabidopsis. EMBO J 19:6150–6161 Kobayashi S, Ishimaru M, Ding CK, Yakushiji H, Goto N (2001) Comparison of UDP-glucose:flavonoid 3-Oglucosyltransferase (UFGT) gene sequences between white grapes (Vitis vinifera) and their sports with red skin. Plant Sci 160:543–550 Kobayashi S, Ishimaru M, Hiraoka K, Honda C (2002) Mybrelated genes of the Kyoho grape (Vitis labruscana) regulate anthocyanin biosynthesis. Planta 215:924–933 Liu RH (2003) Health benefits of fruits and vegetables are from additive and synergistic combination of phytochemicals. Am J Clin Nutr 78:517S–520S Loake GJ, Choudhary AD, Harrison MJ, Mavandad M, Lamb CJ, Dixon RA (1991) Phenylpropanoid pathway intermediates regulate transient expression of a chalcone synthase gene promoter. Plant Cell 3:829–840 Retamales JB, Caligari PDS, Carrasco B, Saud G (2005) Current status of the Chilean native strawberry (Fragaria chiloensis L. Duch.) and the research needs to convert the species into a commercial crop. Hortscience 40:1633– 1634 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York Schoch GA, Nikov GN, Alworth WL, Werck-Reichhart D (2002) Chemical inactivation of the cinnamate 4hydroxylase allows for the accumulation of salicylic acid in elicited cells. Plant Physiol 130:1022–1031

Genet Resour Crop Evol (2009) 56:895–903 Staudt G (1999) Systematics and geographic distribution of the American strawberry species: Taxonomic studies in the genus Fragaria (Rosaceae: Potentilleae). University of California Press, Berkeley Winkel-Shirley B (2001) Flavonoid biosynthesis: a colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol 126:485–493

903 Zhang Y, Seeram NP, Lee R, Feng L, Heber D (2008) Isolation and identification of strawberry phenolics with antioxidant and human cancer cell antiproliferative properties. J Agric Food Chem 56:670–675

123