Transcriptional regulation of the CRLR gene in ... - The FASEB Journal

Download PDF
4 downloads 0 Views 1MB Size Report
Comment
Jun 17, 2003 - Leonid L. Nikitenko†, ‡, David M. Smith §, Roy Bicknell ‡, and Margaret ... *The University of Oxford, John Radcliffe Hospital, Oxford, OX3 9DU, ...
The FASEB Journal express article 10.1096/fj.02-0993fje. Published online June 17, 2003.

Transcriptional regulation of the CRLR gene in human microvascular endothelial cells by hypoxia Leonid L. Nikitenko†, ‡, David M. Smith §, Roy Bicknell ‡, and Margaret C. P. Rees† *The University of Oxford, John Radcliffe Hospital, Oxford, OX3 9DU, United Kingdom; † Nuffield Department of Obstetrics and Gynaecology; ‡Molecular Angiogenesis Laboratory, Cancer Research UK, Weatherall Institute of Molecular Medicine; and §AstraZeneca, CVGI, Alderley Park, Macclesfield, Cheshire, SK10 4TG, United Kingdom Corresponding author: Leonid L. Nikitenko NDOG, University of Oxford, John Radcliffe Hospital, Oxford, OX3 9DU, United Kingdom. E-mail: [email protected] ABSTRACT Adrenomedullin is a 52 amino acid peptide that shows a remarkable range of effects on the vasculature that include inter alia, vasodilatation, regulation of permeability, inhibition of endothelial cell apoptosis, and promotion of angiogenesis. Recently the G-protein coupled receptor (GPCR) calcitonin receptor-like receptor (CRLR), and receptor activity modifying proteins (RAMPs) have become recognized as integral components of the adrenomedullin signaling system. However, mechanisms of regulation of CRLR expression are still largely unknown. This is in part due to lack of information on the gene promoter. In this study we have determined the transcriptional start of human CRLR cDNA by 5′-RACE and cloned the proximal 5′-flanking region of the gene by PCR. The 2318 bp genomic fragment contains the basal promoter of human CRLR, including potential TATA-boxes and several GC boxes. Regulatory elements binding known transcription factors, such as Sp-1, Pit-1, glucocorticoid receptor, and hypoxia-inducible factor-1 α (HIF-1α) were also identified. When cloned into reporter gene vectors, the genomic fragment showed significant promoter activity, indicating that the 5′flanking region isolated by PCR contains the gene promoter of human CRLR. Of significance is that the cloned promoter fragments were activated by hypoxia when transfected in primary microvascular endothelial cells. Site-directed mutagenesis of the consensus hypoxia-response element (HRE) in the 5′-flanking region abolished such a response. We also demonstrated by semi-quantitative RT-PCR that transcription of the gene is activated by hypoxia in microvascular endothelial cells. In contrast, expression of RAMPs 1, 2, and 3 was unaffected by low oxygen tension. We conclude that simultaneous transcriptional up-regulation of CRLR and its ligand adrenomedullin in endothelial cells could lead to a potent survival loop and therefore might play a significant role in vascular responses to hypoxia and ischemia. Key words: G-protein coupled receptor • CRLR • 5′-flanking region • promoter • HRE • hypoxia • adrenomedullin • RAMP • microvascular endothelial cells

T

he 52-amino acid peptide adrenomedullin appears to play a significant role in vasculature (1–3). Adrenomedullin expression is increased in cardiovascular disease, septic shock, and hypertension where the peptide is thought to be involved in compensatory

mechanisms that induce vasodilatation in order to reduce the tissue damage found in these pathologies (2). It is also becoming clear that either activation or disruption of adrenomedullin signaling in the microvasculature may contribute to other pathologies, including atherosclerosis, renal failure, neoplastic growth, and disorders of the reproductive tract (3). The effects of adrenomedullin on endothelial cells (EC) and vascular smooth muscle cells (VSMC) are thought to be mediated via the G-protein coupled receptor (GPCR) calcitonin receptor like receptor (CRLR). Further, receptor activity modifying proteins (RAMPs) have been recognized as integral components of the adrenomedullin receptor system (4). Their expression dictates the cell-surface expression and the unique pharmacologies of CRLR (5, 6). Adrenomedullin and its related peptide, calcitonin gene-related peptide (CGRP), bind with highest affinities to the heterodimers CRLR–RAMP2 and CRLR–RAMP1, respectively. Therefore RAMPs are now thought to induce conformational changes of CRLR to facilitate differential binding of the two peptides. CRLR cDNA was initially isolated from lung (7) and brain (8). The expression pattern of CRLR has been investigated in rat and human tissues (8–10). The predominant localization of CRLR in vivo in blood vessels of various organs by in situ hybridization (9, 11) and immunocytochemistry (12, 13) suggests that the microvasculature is one of the main targets for adrenomedullin and CGRP. Despite these observations, investigation of the regulation of expression of the adrenomedullin/CGRP receptor CRLR gene has been hindered, partially due to lack of information on the gene promoter. Here we provide new data on cell and tissue-specific expression of human GPCR CRLR and its genomic organization and analyze regulatory regions in its promoter. Our data on the transcriptional profiling of the gene and identification of the critical regulatory elements of the human CRLR gene promoter provide the basis for investigation of the gene regulation of this GPCR and therefore facilitate further the understanding of the role of adrenomedullin signaling in the vascular responses to hypoxia, ischemia, and other pathophysiological stimuli. MATERIALS AND METHODS Transcriptional profiling by RT-PCR For transcriptional profiling of the human CRLR, specific primers (11) were used to perform RT-PCR reactions by using mRNA isolated from endothelial and non-endothelial cell lines and human tissues as a template. Endothelial cell lines used in the present study included human dermal microvascular endothelial cells (HDMVEC), lung microvascular endothelial cells (LMVEC), endometrial microvascular endothelial cells (EMVEC), myometrial microvascular endothelial cells (MMVEC); and human umbilical vein endothelial cells (HUVEC). Nonendothelial cell lines used in the present study included human normal endometrial stromal cells (NES’s), human normal myometrial smooth muscle cells (NMCs), human monocyte-derived cell line (U 973), human breast carcinoma cell line (MDA 231), human breast carcinoma cell line (MCF-7), human melanoma-derived cell line (SK 23), ovarian adenocarcinoma-derived cell line (OVCAR-3), liver hepatocellular carcinoma cell line (HepG2), human urinary bladder-derived cell line (HT 1376), human breast carcinoma cell line (ZR-75-1), human embryonic lung cell line (HELF; fibroblastic), squamous cell lung cancer cell line (NCI M 520), peripheral blood

leukocyte-derived cell line (HL 6C); and human monocyte-derived cell line (acute monocyte leukemia; THP–1). Identification of transcriptional start of human CRLR cDNA by rapid amplification of cDNA ends (RACE) RACE is a PCR-based technique for isolation of full-length cDNA of specific genes (14). The gene-specific primer 5′ CCCACAAGCAAGGTGGGAAAGAGTG 3′ was designed for RACE based on the reported sequence of human CRLR cDNA (7). RACE was performed by using the Marathon cDNA amplification kit from Clontech (Palo Alto, CA), following the manufacturer’s instructions. Briefly, total RNA from microvascular endothelial cells (see below) was reversetranscribed with an oligo (dT) adaptor primer to generate the first-strand DNA. Then, secondstrand DNA was synthesized. Adaptor sequences were subsequently ligated to both ends of the prepared double-stranded cDNA. The ligated DNA was used as a template for PCR with genespecific and adaptor primer. The PCR reaction led to the amplification of a cDNA fragment covering the region to the 5′ end. The fragment was gel-purified and sequenced to obtain the 5′UTR sequence and to determine the transcriptional start of human CRLR cDNA. Isolation and analysis of 5′-flanking region of human CRLR GenBank Nucleotide Sequence Database (http://www.ncbi.nlm.nih.gov) was searched by BLASTN analysis of the 5′UTR sequence determined by 5′-RACE to identify the 5′flanking region of the gene by sequence overlap. The analysis resulted in the identification of a chromosome 2 sequence (GenBank genomic contig; Accession number NT_022161) and an individual BAC clone, both directly corresponding to the region of interest. The BAC clone was obtained from ResGene (Invitrogen, Buckingham, UK). Further, 2318 bp proximal 5′-flanking region of human CRLR was isolated by PCR using the forward primer 5′-CTTCATGGACTACAGCCATG-3′ and the reverse-primer 5′TCTGAGATTCCGCAGAAGAG-3′ designed by using the sequence of the GenBank genomic contig NT_022161 and DNA isolated from a BAC clone as a template. The Expand High Fidelity Kit with the PCR Super Mix of Taq and Pfu Polymerases (Roche, Mannheim, Germany) was used to minimize PCR errors. A PCR fragment was purified and cloned into the TOPO Cloning vector (Invitrogen) and designated TOPO-II-CRLR-2318. Further, TOPO-II-CRLR2318 was sequenced by “genomic walking,” using the designed primers. Bioinformatics tools We subsequently analyzed the 5′-flanking sequence of human CRLR by the database software SIGNAL SCAN (15). We have also performed manual analysis of the sequence to determine binding sites that were not identified by the SIGNAL SCAN software.

Analysis of promoter activity of the genomic sequence of human CRLR Construction of CRLR reporter plasmids and site-directed mutagenesis We determined the promoter activity of the isolated 5′-flanking region of the human CRLR by using the luciferase reporter-gene vector pGL3-Basic (Promega, Southampton, UK). With the sequence information and analysis of the 2318 bp 5′-flanking region of human CRLR, we first generated PCR constructs by using the cloned sequence of TOPO-II-CRLR-2318 as a template. Forward primers used for these PCRs are indicated in Table 1. Site-directed mutagenesis of the HRE in position –343 in the human CRLR promoter was performed by using a mutagenic (mutations underlined) primer (Table 1). All PCR fragments share the same reverse primer and therefore begin from the middle of the exon I, spanning fragments of various lengths of the 5′ flanking region. PCR products were phenol-chloroform-isoamylalcohol (25:24:1) purified, precipitated and re-amplified by using primers with Bgl II and Mlu I adaptors (Table 1). DNA fragments amplified by PCR were digested with Bgl II and Mlu I to prepare cohesive ends. Finally, the digested fragments were cloned into pGL3-Basic by standard procedures and designated pGL3-CRLR-1147, pGL3-CRLR-516, pGL3-CRLR-516mut accordingly (Table 1). The identity of cloned fragments was confirmed by sequence analysis prior to transient transfection into primary human dermal microvascular endothelial cells to determine their promoter activity. Transient expression assay The promoter activity of the cloned sequences was determined by the expression of luciferase activity in transient transfection assay. Fugene TM (Invitrogen Ltd., Paisley, UK) was used for transfection according to the manufacturer’s instructions. Briefly, primary human dermal microvascular endothelial cells were seeded at 100,000 cells/well into sixwell plates coated with Attachment Factor (TCS Cellwork, Buckingham, UK) and transfected with pGL3-Basic harboring various lengths of human CRLR or mutant constructs. As an internal control, the ph RG-TK vector (Promega, UK) was co-transfected and led to constitutive expression of Renilla luciferase. For hypoxic experiments, pGL3-Promoter- PGK HRE vector, containing three contiguous copies of the same 18bp HRE sequence derived from the 5′-flanking region of the murine phosphoglycerophosphate kinase (PGK1) gene (16), was used to monitor the hypoxia response of the novel constructs. The pGL-3 control vector (containing the 400 bp SV40 promoter; and therefore showing strong promoter activity) was used to monitor the promoter activity of novel constructs and does not contain hypoxia-response elements. The transfection was carried for 4 h. The cells were lysed after another 16 h of incubation, and activities of firefly and Renilla luciferases were measured independently with the Dual-Luciferase Reporter assay system (Promega, UK). The activity of firefly luciferase was normalized by the activity of Renilla luciferase to indicate promoter activity of cloned sequences. All data were analyzed by computer (Prism, ver.2.0 GraphPad Software, Inc., San Diego, CA).

Cell culture Endothelial cell lines Human dermal and lung microvascular endothelial cells were obtained from TCS Cellworks (Buckingham, UK). Microvascular endothelial cells from endometrium and myometrium were isolated as described previously (17). The cells were seeded onto plastic culture dishes (Falcon; ≈ 5×105 cells/cm2) precoated with Attachment Factor (TCS Cellwork, Buckingham, UK) according to the manufacturers instructions, and supplemented with EGM-2MV Bullet Kit medium (Bio Whittaker, Wokingham, UK). Cultures were incubated at 37°C in a 5% CO2 humidified atmosphere, and the medium was replaced every 1–2 days. Cells were passaged 1:3 at confluence by release with trypsin/EDTA (Sigma, UK). Non-endothelial cell lines Endometrial stromal cells (fibroblasts) and myometrial smooth muscle cells were isolated by collagenase digestion from uteri obtained at hysterectomies. Epithelial cell lines MDA 231 and MCF-7 are breast carcinoma cell lines and were obtained from American Type Culture, Collection (Manassas, VA). All non-endothelial cell lines were grown in DMEM medium supplemented with 10% FCS to confluence and passaged 1:3 at confluence. Exposure of cells to hypoxia Hypoxic conditions were generated in a Napco 7001 incubator (Precision Scientific, Winchester VA) with 0.1% O2, 5% CO2, and balance N2. Semi-quantitative RT-PCR After exposure to hypoxia/normoxia, the cells were rinsed immediately in ice-cold PBS. Total RNA was isolated from cells by using TRIzol Reagent (Invitrogen), according to the manufacturer’s instructions. RNA pellets were dissolved in sterile distilled water, and its quality was assessed by gel visualization and spectrophotometric analysis (OD260/280). RT-PCR was performed as described before (11). In brief, cDNAs were synthesized from 1 µg of total RNA by using the Reverse-iTcDNA synthesis kit (Advanced Biotechnologies Ltd, Surrey, UK). Then semi-quantitative PCR was performed on an aliquot (1 µl) of this mixture (neat) or 1:10 and 1:100 dilutions by using Expand High Fidelity PCR system (Roche, Mannheim, Germany). Amplifications were performed routinely by using 30 cycles in the Perkin Elmer gene Amp PCR System 2400 for β-actin (control), adrenomedullin, CRLR, RAMP1, RAMP2, and RAMP3 by using specific described previously primers (11). All primers were intron spanning, therefore enabling to differentiate mRNA- and genomic DNA-derived PCR products. No genomic DNA contamination was detected in RNA samples analyzed. RESULTS AND DISCUSSION Transcriptional profiling of human CRLR in human cell lines and tissues Transcriptional profiling of CRLR in various cell lines demonstrated the predominant expression of the transcript in microvascular endothelial cell lines (Fig. 1A) isolated from lung,

endometrium, myometrium, and skin, and low expression in a few of the 16 non-endothelial cell lines analyzed. This finding supports the view of vascular endothelial cells as being one of the main targets for adrenomedullin in vivo. Tissue-specific distribution of CRLR confirmed previous findings of high level of its mRNA in lung, pancreas, heart, endometrium, and placenta and also demonstrated up-regulated levels of transcript in breast and head and neck tumor samples, as compared with matched samples of the normal tissue from the same organ in the same patient (Fig. 1B). Identification of the transcriptional start of the human CRLR gene Initially, we designed a gene-specific primer corresponding to exon I of the published cDNA sequence of human CRLR (7, 8). 5′-RACE led to the amplification of a major PCR product of ~200 bp (Fig. 2A). The PCR product was gel-purified, sequenced, and aligned to the known cDNA sequence. We could extend the known 5′-untranslated region by one base with the transcription start site corresponding to an adenosine nucleotide (Fig. 2B). Sequence and analysis of 5′-flanking region of human CRLR We performed a GenBank Nucleotide Sequence Database search by BLASTN analysis by using the 5′UTR of human CRLR cDNA to identify the 5′flanking region of the gene by sequence overlap. The analysis resulted in confirmation of the identity of the CRLR cDNA (Accession numbers L76380, U17473) and also of the expected location in the region of interest on chromosome 2q31 (18, 19) (Fig. 3). Recent data on the sequence of human chromosome 2 show that CRLR gene (designated CALCRL by HGP; GenBank Accession number NT_022161) is located at 2p31 and spans ~100 000 base pairs. The gene apparently contains fifteen exons (Fig. 3). BLASTN analysis led to the identification of an individual BAC clone that corresponds to the cDNA sequence and has 100% homology with the genomic DNA sequence. The proximal 5′flanking region of human CRLR spanning 2318 bp was isolated by PCR from BAC clone DNA, cloned into the TOPO-II Cloning Vector, and sequenced by genomic walking by using the designed primers (Fig. 4, bottom panel; underlined). We subsequently analyzed the sequence of the 5′-flanking of human CRLR by using the database software SIGNAL SCAN (24; Fig. 4, top panel). This genomic fragment was shown to contain potential TATA-boxes, located further upstream from the transcription start than expected. However, several GC-boxes and putative Sp-1 binding elements were identified in the close proximity to the transcriptional start. The Sp-1 site is an important element of many cellular and viral promoters that do not contain TATAA boxes (20). Because relatively few promoter regions of GPCRs have been sequenced, it is not known whether the presence or absence of a TATAA box will be significant in terms of the regulation of this type of receptor. Potential binding sites for transcription factors, such as nuclear factor-1 (NF-1), Pit-1, and glucocorticoid receptor (GR) were also identified in the 5′flanking region of human CRLR gene. Few consensus sequences for C/EBP (CCAAT; 21) binding complex, which regulates more than 200 genes (22), were found on both sense and antisense strands. It is of interest that the promoter region of human CRLR includes some structural features that could be found in some other GPCRs, such as 18 CA repeats (CACA box). A CACA-box was identified in rat vasopressin V1b receptor gene (23) and rat oxytocin receptor gene (24). CA

repeats, found in large number of eukaryotic genes have been shown to confer DNA flexibility (25) and to be required for efficient transcription of genes such as human fetal gammaglobin gene (26). Furthermore, several signal transduction and activators of transcription (STATs) and GATA factors, which were reported to have a role in the regulation of other GPCR (27), were also found in the 5′-flanking region of human CRLR. Promoter activity of the 5′-flanking region of human CRLR To determine whether the 5′-flanking region of CRLR isolated by PCR contains the gene promoter, we measured the promoter activity of fragments of 5′ regulatory CRLR gene region by luciferase reporter assay. We first generated constructs of this genomic fragment by PCR. Primers for these PCR reactions were designed (Table 1) based on the sequence of the TOPO-IICRLR-2318 cloned fragment (Fig. 4). Amplified DNA fragments from these PCR reactions of lengths 1147 and 516 bp were subsequently cloned into the reporter gene vector pGL3-Basic containing the cDNA of firefly luciferase and designated pGL3-CRLR-1147 and pGL-3-CRLR516 accordingly (Fig. 5A). pGL3-Basic vectors, either empty or containing fragments of human CRLR 5′-flanking region or SV-40 promoter (pGL-3-Control vector) or PGK promoter (pGL-3 PGK-HRE vector) were transfected into primary microvascular endothelial cells. Firefly luciferase activity in these cells was determined 16 h later. The results are shown in Fig. 5B. Insertion of the 516 bp fragment (including 157 bp of the exon I sequence and 359 bp immediately upstream of the human CRLR cDNA, i.e., spanning from position –359 to +157), led to ~24-fold increase in luciferase expression, indicating significant promoter activity of this region. With an increase in DNA length, promoter activity diminished (Fig. 5B), with pGL-3CRLR-1147 sequence demonstrating only ~10-fold increase. This is in accordance with findings by others (28) demonstrating the high promoter activity of first 200–400 bp of the 5′-flanking region and lower activity of constructs containing longer fragments of the 5′-flanking region of other genes. Both the pGL3-PGK-HRE and pGL3-CRLR-516 constructs showed an increased activity under conditions of low oxygen tension (hypoxia) (Fig. 5B). However, the activity of the pGL3-PGK HRE was noticeably higher (approximately three times), probably due to the fact that three HREs are present in this construct (16). We compared our results demonstrating the highest promoter activity for the 516 bp genomic fragment (containing 359 bp of the 5′-flanking region) with results from theoretical analysis by using SIGNAL SCAN software (15). The sequence of this region, although it does not have a TATA box, is characterized by a high GC content and the presence of a GC box and a putative Sp-1 binding element (Fig. 4, top panel). Recent studies have shown that many gene promoters are indeed ‘TATA-less’ (29). Whereas transcriptional regulation of these genes is enigmatic, the interaction between initiator elements, functional TATA-box analogs, and other transcriptional factors, including Sp-1, may play an important role (30, 31). Interestingly, there are a few potential TATA boxes further upstream in the 5′-flanking region of the human CRLR gene. However, the decreased promoter activity of the genomic fragment, containing these ‘TATA’sequences (pGL-3-CRLR-1147; Fig. 5B), indicates that their activity is low in the 5′-flanking region of the human CRLR gene or that there are additional inhibiting sequences.

Identification of hypoxia-response element in CRLR promoter A core binding site for hypoxia-inducible factor-1 (HIF-1; 32) was found by sequence analysis of the 5′-flanking region of human CRLR in very close proximity to the transcriptional start (Fig. 4, top panel). The candidate HIF-1 site, 5′-GGCGTGTG-3′, was identified on the antisense strand between –343 and –347 (Fig. 4, top panel), which contained the core sequence 5′-RCGTG-3′ recognized by HIF-1 in the promoter of VEGF, erythropoietin, aldolase, enolase, lactate dehydrogenase, and phosphoglycerophosphate kinase (32). Comparison of the human CRLR promoter sequence with the corresponding 5′flanking sequences of rat and mouse CRLR genes revealed high level of homology (data not shown) and the presence of only one nucleotide substitution (C/G – rat; C/A – mouse) within the core sequence of this potential HRE. This might be a reason for an absence of the response of a rat CRLR to hypoxia as shown by others (37). To determine whether this sequence mediates the hypoxia response of human CRLR gene, a 3bp substitution within this sequence was introduced into pGL3-CRLR-516 (Fig. 6A). Basal promoter activity of the resulting construct pGL3-CRLR-516 mut was similar to that of pGL3CRLR-516 at 20% O2, but no induction under hypoxia was observed (Fig. 6B). Induction of CRLR, but not RAMPs, mRNA expression in hypoxic microvascular endothelial cells Adrenomedullin expression in endothelial cells is up-regulated in hypoxia (33). To identify whether expression of any of the components of adrenomedullin receptor system (i.e., CRLR and RAMPs) is influenced by low oxygen tension in microvascular endothelial cells, we performed semi-quantitative RT-PCR. This showed up-regulation of both adrenomedullin and CRLR transcripts in microvascular cells in response to hypoxia (Fig. 7). However, the level of RAMP 2 mRNA remained virtually unchanged. Trace expression of RAMP3 mRNA and no RAMP1 mRNAs was detected in microvascular endothelial cells even when a large number of PCR cycles was performed. These results confirm the predictions by 5′-flanking region analysis likelihood of up-regulation of human CRLR by hypoxia. This also indicates that only ligand and its receptor, not receptor activity modifying protein transcripts, are influenced by hypoxia. CONCLUSIONS The genetic, regulatory, and tissue-specific characterization of G-protein coupled receptors is essential since it contributes to the identification of the mechanisms that may influence basic physiological processes and cell function (34). The seven transmembrane GPCR CRLR transfers extra cellular signals delivered by the peptides adrenomedullin and CGRP (4) to intracellular signals by coupling to heterotrimeric GTP binding proteins (G-proteins). Adrenomedullin signaling is of particular significance in endothelial cell biology since the peptide protects cells from apoptosis, promotes angiogenesis, and affects vascular tone and permeability (3, 35). Therefore the identification of mechanisms of transcriptional regulation of the G-protein coupled receptor CRLR, as well as other integral parts of the adrenomedullin/CGRP signaling system, in microvascular endothelial cells would contribute to the fundamental understanding of how these

cells function in many pathologies, including cardiovascular disease, pulmonary hypertension, atherosclerosis, inflammatory disease, disorders of the reproductive tract, and neoplastic growth. In the present study we have shown by transcriptional profiling that CRLR mRNA is predominantly expressed in endothelial cells. Our data are in accordance with previous findings on CRLR mRNA localization in blood vessels (9, 11), further supporting the view of endothelial cells to be one of the main targets for the peptide in vivo (3). Recent immunohistochemical studies also demonstrate the predominant localization of CRLR-immunoreactivity in blood vessels in human tissues (12, 13). In the present study CRLR mRNA was found in primary microvascular endothelial cells obtained from lung, skin, endometrium, and myometrium, indicating that the mechanisms investigated here could be of relevance to individual microvascular beds of various tissues. This finding also supports the view that CRLR is potentially a major mediator of effects of adrenomedullin on the vasculature (3, 12, 36). Whether other proposed adrenomedullin receptors (i.e., human homologues of RDC-1 and L1 receptors) (37, 38) are responsible for mediating vascular responses to the peptide is to be elucidated. In this study we have determined the transcriptional start of human CRLR cDNA. Furthermore, we have isolated and analyzed for the first time the promoter region for the human CRLR gene and identified its regulatory elements. Analysis using reporter-gene assay has demonstrated the promoter activity of isolated genomic fragments. Of significance is the demonstration for the first time that the human CRLR promoter region has a functional HRE that can be activated by hypoxia in microvascular endothelial cells. The HRE in the human CRLR promoter is located in close proximity to the transcriptional start (-343 bp). However, distance from the transcription initiation site is unlikely to determine whether the HIF-1 site is functional (32). The induction/repression of the CRLR promoter activity in hypoxic conditions could also be regulated by trans-acting factors (full-length and dominant-negative forms of HIF-1α; 32). Comparison of the EPO, VEGF, and ALDA HREs (39) reveals the presence of a sequence located 4 to 6 nucleotide 3′ of the HIF-1 site with similarity to the EPO sequence 5′-CACAG-3′ which, when mutated, results in loss of HRE function (40). In the human CRLR promoter, a similar sequence 5′-CACAC-3′/5′ACACA-3′ is present on the sense strand in the same proximity. Whether this binding site contributes to human CRLR HRE activity is to be further elucidated. Recently, others have reported the presence of HREs in the promoter region of another human GPCR (38) that was described as a homologue of the rat 7TM receptor (L1 orphan receptor; 41). This has been controversially proposed to be another adrenomedullin receptor (42). However, even though the mRNA for this GPCR is elevated after exposure of pulmonary epithelial cells to hypoxia, it is still not clear whether the 7TM receptor described by Hanze et al. (38) mediates adrenomedullin-induced signals. The expression of another proposed putative receptor for adrenomedullin - RDC1 -is shown to be up-regulated by hypoxia in rat astrocytes, whereas CRLR and RAMP expression remain unaffected in these cells (37). Moreover, in view of the International Union of Pharmacology CGRP/Adrenomedullin nomenclature committee, L1 and RDC1 should no longer be considered as adrenomedullin receptors (43). Therefore, our study is the first to demonstrate the induction of the CRLR promoter activity and mRNA expression under hypoxic conditions in human microvascular endothelial cells.

Because previous studies have showed induction of adrenomedullin gene expression via cisacting DNA sequences containing putative HIF-1 binding sites (44), resulting in its up-regulation by hypoxia (33, 45), we investigated whether CRLR and RAMPs mRNA expression was also affected by low oxygen tension. In the present study, we show for the first time that both adrenomedullin and CRLR are up-regulated by hypoxia in microvascular endothelial cells. This observation indicates that the response of microvascular endothelial cells to elevated levels of exogenous adrenomedullin and CGRP in hypoxic conditions (46, 47) could be enhanced further by increased expression of CRLR. In favor of this hypothesis, it is of interest to note that autocrine/paracrine effectors and their receptors are often regulated in coordinated fashion. For instance, hypoxia up-regulates expressions of the components of VEGF signaling system (VEGF and its receptor flt1; 48). The simultaneous transcriptional up-regulation of CRLR and its ligand adrenomedullin in endothelial cells might play a significant role in vascular responses to hypoxia and ischemia by creating a potent survival loop. In cardiovascular disease, septic shock, and hypertension, where adrenomedullin expression is increased, any factors that alter CRLR expression would directly affect the compensatory mechanisms that induce vasodilatation and decrease permeability in order to reduce the tissue damage found in these pathologies (2). Hypoxic induction of CRLR mRNA could be a reason for its elevated levels found in tumor samples in the present study. Tumors become hypoxic because the new blood vessels they develop are aberrant and have poor blood flow (49). Both cancer cells and microvascular endothelial cells in tumors are exposed to chronic or intermittent low oxygen tension (50). In tumors cells, up-regulation of adrenomedullin expression (51) is thought to be involved in cancer cell survival. We speculate that up-regulation of CRLR mRNA expression may also contribute to this process as well as affecting vascular development and function within the tumor. However, whether the transcript is up-regulated in cancer cells or in the tumor vasculature is to be further elucidated. The regulation of CRLR expression by hypoxia in other organs can also contribute to mediation of the effects of adrenomedullin both in normal and pathophysiological conditions. In the present study, expression of RAMPs was not activated by hypoxia in microvascular cells. The presence of basal levels of RAMP2 mRNA indicates that all components of the adrenomedullin signaling system are present in microvascular endothelial cells in both normoxic and hypoxic conditions. It is possible that RAMP proteins are available in excess in the endothelial cells to facilitate the transport of the increased amount of the CRLR to plasma membrane in hypoxic conditions. Moreover, the low levels of basal R1 and R3 expression found in microvascular endothelial cells do not allow us to comment whether hypoxia significantly activates the transcription of these genes in other cells. The low abundance of RAMPs transcripts in endothelial cells in culture in our study further supports the view that other factors play a more significant role in their expression, or alternatively this could be due to loss of their expression in culture (52). The factors that regulate RAMP expression (52, 53) will affect the formation of CRLR/RAMP heterodimers and therefore the transport of the CRLR to the plasma membrane. In pathological conditions, these factors by acting in combination with hypoxia (54), could further contribute to the control (increase or decrease) of the expression of functional receptors, resulting in modulation of growth/apoptosis of vascular cells and magnitude of the effects of adrenomedullin and CGRP on blood vessel permeability and vasodilatation.

In this sense, of particular interest, is the presence of the numerous glucocorticoid receptor binding sites in the CRLR promoter. This is in agreement with the previous finding that levels of CRLR mRNA are elevated after exposure to dexamethasone (52). Therefore, elevated levels of CRLR mRNA in glucocorticoid-exposed endothelial cells might potentially contribute to the responses of the vasculature to glucocorticoid therapy (55). Whether excess or prolonged treatment with glucocorticoids contributes to hypertension (56) via regulation of CRLR gene transcription and therefore modulation of vasodilator effects of adrenomedullin is to be further investigated (37). Furthermore, regulation of human CRLR expression might depend not only on the 5′-flanking region of its mRNA, a region that has often been experimentally demonstrated to contain sequence elements crucial for many aspects of gene regulation and expression, but also on other regulatory elements that are embedded in the and 5′-UTR sequence and non-coding part of its genomic sequence (29). With CRLR gene spanning more than 100 kb of the genome, further analysis of these non-coding sequences might be required to better understand the transcriptional regulation of the human CRLR. In summary, the present study reveals the genomic organization, regulatory components, and organ and cell specific expression pattern of a 7TM GPCR human CRLR. Our findings indicate that simultaneous up-regulation of expression of adrenomedullin and CRLR transcripts may play a significant role in vascular responses to hypoxia and ischemia, and in tumor biology. Furthermore, the mechanisms of transcriptional regulation of the G-protein coupled receptor CRLR, as an integral part of the adrenomedullin signaling system, in microvascular endothelial cells might contribute to many pathologies, including pulmonary hypertension, atherosclerosis, inflammatory disease, disorders of the reproductive tract, and cardiovascular disease. ACKNOWLEDGMENTS We are grateful to Ulrike Knies-Bamforth (Cancer Research UK, Oxford, UK), Jose Braganca (Wellcome Trust Centre for Human Genetics, Oxford, UK), and Giannoulis Fakis and Laurence Choulier (NDOG, John Radcliffe Hospital, Oxford, UK) for general advice and very useful discussions, and Robin Roberts-Gant (Medical Informatics Unit, Nuffield Department of Clinical Laboratory Sciences, University of Oxford, UK) for assistance with formatting figures. We thank Naomi Robertson, Heidi Sowter, and Ed Streeter, Stephen Lui, and Laura Armstrong (all from Cancer Research UK) for their technical help. Our special thanks to Ulrike Knies-Bamforth and Veronica Carroll (Cancer Research UK) for critical reading of the manuscript. This work was supported by grants from the Wellcome Trust and Cancer Research UK. REFERENCES 1.

Hinson, J. P., Kapas, S., and Smith, D. M. (2000) Adrenomedullin, a multifunctional regulatory peptide. Endocr. Rev. 21, 138–167

2.

Minamino, N., Kangawa, K., and Matsuo, H. (2000) Adrenomedullin: a new peptidergic regulator of the vascular function. Clin. Hemorheol. Microcirc. 23, 95–102

3.

Nikitenko, L. L., Smith, D. M., Hague, S., Wilson, C. R., Bicknell, R., and Rees, M. C. P. (2002) Adrenomedullin and the Microvasculature. Trends in Pharm. Sci. 23, 101–103

4.

McLatchie, L. M., Fraser, N. J., Main, M. J., Wise, A., Brown, J., Thompson, N., Solari, R., Lee, M. G., and Foord, S. M. (1998) RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature 393, 333–339

5.

Sexton, P. M., Albiston, A., Morfis, M., and Tilakaratne, N. (2001) Receptor activity modifying proteins. Cell. Signal. 13, 73–83

6

Poyner, D. R., Sexton, P. M., Marshall, I., Smith, D. M., Quirion, R., Born, W., Muff, R., Fischer, J. A., and Foord, S. M. (2002) International Union of Pharmacology. XXXII. The mammalian calcitonin gene-related peptides, adrenomedullin, amylin, and calcitonin receptors. Pharmacol. Rev. 54(2), 233–246

7.

Fluhmann, B., Muff, R., Hunziker, W., Fischer, J. A., and Born, W. (1995) A human orphan calcitonin receptor-like structure. Biochem. Biophys. Res. Commun. 206, 341–347

8.

Aiyar, N., Rand, K., Elshourbagy, N. A., Zeng, Z., Adamou, J. E., Bergsma, D. J., and Li, Y. (1996) A cDNA encoding the calcitonin gene-related peptide type 1 receptor. J. Biol. Chem. 271, 11325–11329

9.

Njuki, F., Nicholl, C. G., Howard, A., Mak, J. C., Barnes, P. J., Girgis, S. I., and Legon, S. (1993) A new calcitonin-receptor-like sequence in rat pulmonary blood vessels. Clin. Sci. (Colch) 85, 385–388

10. Chakravarty, P., Suthar, T. P., Coppock, H. A., Nicholl, C. G., Bloom, S. R., Legon, S., and Smith, D. M. (2000) CGRP and adrenomedullin binding correlates with transcript levels for calcitonin receptor-like receptor (CRLR) and receptor activity modifying proteins (RAMPs) in rat tissues. Br. J. Pharmacol. 130, 189–195 11. Nikitenko, L. L., Brown, N. S., Smith, D. M., MacKenzie, I., Bicknell, R., and Rees, M. C. P. (2001) Differential and cell-specific expression of calcitonin-receptor-like receptor and receptor activity modifying proteins in the human uterus. Mol. Hum. Reprod. 7, 655–664 12. Oliver, K. R., Wainwright, A., Edvinsson, L., Pickard, J. D., and Hill, R. G. (2002) Immunohistochemical localization of calcitonin receptor-like receptor and receptor activitymodifying proteins in the human cerebral vasculature. J. Cereb. Blood Flow Metab. 22, 620–629 13. Hagner, S., Stahl, U., Knoblauch, B., McGregor, G. P., and Lang, R. E. (2002) Calcitonin receptor-like receptor: identification and distribution in human peripheral tissues. Cell Tissue Res. 310, 41–50 14 Chenchik, A., Diachenko L., Moqadam F. F., Tarabykin, V., Lukianov, S. A., and Siebert, P. D. (1996) Full length cDNA cloning and determination of mRNA 5′ and 3′ ends by amplification of adaptor-ligated cDNA. Biotechniques 21, 526–534

15. Prestridge, D. S. (2000) Computer software for eukariotic promoter analysis. Methods Mol. Biol. 130, 265–295 16. Ameri, K., Burke, B., Lewis, C. E., and Harris, A. L. (2002) regulation of a rat VL30 element in human breast cancer cells in hypoxia and anoxia: role of HIF-1. Br. J. Cancer 87, 1173–1181 17. Nikitenko, L. L., MacKenzie, I. Z., Rees, M. C., and Bicknell, R. (2000) Adrenomedullin is an autocrine regulator of endothelial growth in human endometrium. Mol. Hum. Reprod. 6, 811–819 18. Nakazawa, I., Nakajima, T., Harada, H., Ishigami, T., Umemura, S., and Emi, M. (2001) Human calcitonin receptor-like receptor for adrenomedullin: genomic structure, eight singlenucleotide polymorphisms, and haplotype analysis. J. Hum. Genet. 46, 132–136 19. Conner, A., and Poyner, D. (2001) The perils of using the human genome sequence: lessons from CALCRL. Trends in Pharm. Sci. 22, 272 20. Pugh, B. F., and Tjian, R. (1991) Transcription from a TATA-less promoter requires a multisubunit TFIID complex. Genes Dev. 5, 1935–1945 21. Bucher, P. (1990) Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J. Mol. Biol. 212, 563– 578 22. Brakhage, A. A. (1998) Molecular regulation of beta-lactam biosynthesis in filamentous fungi. Microbiol. Mol. Biol. Rev. 62, 547–585 23. Rabadan-Diehl, C., Lolait, S., and Aguilera, G. (2000) Isolation and characterization of the promoter region of the rat vasopressin V1b receptor gene. J. Neuroendocrinol. 12, 437–444 24. Rozen, F., Russo, C., Banville, D., and Zingg, H. H. (1995) Structure, characterization, and expression of the rat oxytocin receptor gene. Proc. Natl. Acad. Sci. USA 92, 200–204 25. Lyubchenko, Y. L., Shlyakhtenko, L. S., Appella, E., and Harrington, R. E. (1993) CA runs increase DNA flexibility in the complex of lambda Cro protein with the OR3 site. Biochemistry 32, 4121–4127 26. Anagnou, N. P., Moulton, A. D., Keller, G., Karlsson, S., Papayannopoulou, T., Stamatoyannopoulos, G., and Nienhuis, A. W. (1985) Cis-acting sequences that affect the expression of the human fetal gamma-globin genes. Prog. Clin. Biol. Res. 191, 163–182 27. He, B., Tong, T. K., Hiou-Tim, F. F., Al-Akad, B., Kronenberg, H. M., and Karaplis, A. C. (2002) The murine gene encoding parathyroid hormone: genomic organization, nucleotide sequence and transcriptional regulation. J. Mol. Endocrinol. 29, 193–203 28. Nishiyama, J., Yi, X., Venkatachalam, M. A., and Dong, Z. (2001) cDNA cloning and promoter analysis of rat caspase-9. Biochem. J. 360, 49–56

29. Ogbourne, S., and Autalis, T. M. (1998) Transcriptional control and the role of silencers in transcriptional regulation in eukaryotes. Biochem. J. 331, 1–14 30. Smale, S. T., and Baltimore, D. (1989) The "initiator" as a transcription control element. Cell 57, 103–113 31 Smale, S.T. (1997) Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim. Biophys. Acta 1351(1-2), 73–88 32. Semenza, G. L. (1999) Regulation of mammalian O2 homeostasis by hypoxia-inducible factor-1. Annu. Rev. Cell Dev. Biol. 15, 551–578 33. Ogita, T., Hashimoto, E., Yamasaki, M., Nakaoka, T., Matsuoka, R., Kira, Y., and Fujita, T. (2001) Hypoxic induction of adrenomedullin in cultured human umbilical vein endothelial cells. J. Hypertens. 19, 603–608 34. Gether, U. (2000) Uncovering molecular mechanisms involved in activation of G proteincoupled receptors. Endocr. Rev. 21, 90–113 35. Hippenstiel, S., Witzenrath, M., Schmeck, B., Hocke, A., Krisp, M., Krull, M., Seybold, J., Seeger, W., Rascher, W., Schutte, H., et al. (2002) Adrenomedullin reduces endothelial hyperpermeability. Circ. Res. 91, 618–625 36. Kamitani, S., Asakawa, M., Shimekake, Y., Kuwasako, K., Nakahara, K., and Sakata, T. (1999) The RAMP2/CRLR complex is a functional adrenomedullin receptor in human endothelial and vascular smooth muscle cells. FEBS Lett. 448, 111–114 37. Ladoux, A., and Frelin, C. (2000) Coordinated Up-regulation by hypoxia of adrenomedullin and one of its putative receptors (RDC-1) in cells of the rat blood-brain barrier. J. Biol. Chem. 275, 39914–39919 38. Hanze, J., Groneberg, D. A., Rose, F., Hanisch, A., Dotsch, J., Peiser, C., Seeger, W., Rascher, W., Fischer, A., and Grimminger, F. (2002) Genomic organization and regulation of a human 7-helix transmembrane receptor which is expressed in pulmonary epithelial cells and induced in hypoxia. Biochem. Biophys. Res. Commun. 291, 1160–1165 39. Semenza, G. L., Jiang, B. H., Leung, S. W., Passantino, R., Concordet, J. P., Maire, P., and Giallongo, A. (1996) Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J. Biol. Chem. 271, 32529–32537 40. Semenza, G., and Wang, G. L. (1992) A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol. Cell. Biol. 12, 5447–5454 41. Kapas, S., Catt, K. J., and Clark, A. J. (1995) Cloning and expression of cDNA encoding a rat adrenomedullin receptor. J. Biol. Chem. 270, 25344–25347

42. Kennedy, S. P., Sun, D., Oleynek, J. J., Hoth, C. F., Kong, J., and Hill, R. J. (1998) Expression of the rat adrenomedullin receptor or a putative human adrenomedullin receptor does not correlate with adrenomedullin binding or functional response. Biochem. Biophys. Res. Commun. 244, 832–837 43. Poyner, D. R., Sexton, P. M., Marshall, I., Smith, D. M., Quirion, R., Born, W., Muff, R., Fischer, J. A., and Foord, S. M. (2002) International Union of Pharmacology. XXXII. The mammalian calcitonin gene-related peptides, adrenomedullin, amylin, and calcitonin receptors. Pharmacol. Rev. 54, 233–246 44. Garayoa, M., Martinez, A., Lee, S., Pio, R., An, W. G., Neckers, L., Trepel, J., Montuenga, L. M., Ryan, H., Johnson, R., et al. (2000) Hypoxia-inducible factor-1 (HIF-1) up-regulates adrenomedullin expression in human tumor cell lines during oxygen deprivation: a possible promotion mechanism of carcinogenesis. Mol. Endocrinol. 14, 848–862 45. Nagata, D., Hirata, Y., Suzuki, E., Kakoki, M., Hayakawa, H., Goto, A., Ishimitsu, T., Minamino, N., Ono, Y., Kangawa, K., et al. (1999) Hypoxia-induced adrenomedullin production in the kidney. Kidney Int. 55, 1259–1267 46. Nakayama, M., Takahashi, K., Murakami, O., Shirato, K., and Shibahara, S. (1999) Induction of adrenomedullin by hypoxia in cultured human coronary artery endothelial cells. Peptides 20, 769–772 47. Champion, H. C., Bivalacqua, T. J., Toyoda, K., Heistad, D. D., Hyman, A. L., and Kadowitz, P. J. (2000) In vivo gene transfer of prepro-calcitonin gene-related peptide to the lung attenuates chronic hypoxia-induced pulmonary hypertension in the mouse. Circulation 101, 923–930 48. Gerber, H. P., Condorelli, F., Park, J., and Ferrara, N. (1997) Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes. Flt-1, but not Flk1/KDR, is up-regulated by hypoxia. J. Biol. Chem. 272, 23659–23667 49. Harris, A. L. (2002) Hypoxia–a key regulatory factor in tumour growth. Nat. Rev. Cancer 2, 38–47 50. Helmlinger, G., Yuan, F., Dellian, M., and Jain, R. K. (1997) Interstitial pH and pO2 gradients in solid tumours in vivo: High–resolution measurements reveal a lack of correlation. Nat. Med. 3, 177–182 51. Oehler, M. K., Norbury, C., Hague, S., Rees, M. C. P., and Bicknell, R. (2001) Adrenomedullin inhibits hypoxic cell death by upregulation of Bcl-2 in endometrial cancer cells: a possible promotion mechanism for tumour growth. Oncogene 20, 2937–2945 52. Frayon, S., Cueille, C., Gnidehou, S., de Vernejoul, M. C., and Garel, J. M. (2000) Dexamethasone increases RAMP1 and CRLR mRNA expressions in human vascular smooth muscle cells. Biochem. Biophys. Res. Commun. 270, 1063–1067

53. Robert-Nicoud, M., Flahaut, M., Elalouf, J. M., Nicod, M., Salinas, M., Bens, M., Doucet, A., Wincker, P., Artiguenave, F., Horisberger, J. D., et al. (2001) Transcriptome of a mouse kidney cortical collecting duct cell line: effects of aldosterone and vasopressin. Proc. Natl. Acad. Sci. USA 98, 2712–2716 54. Mandriota, S. J., Pyke, C., Di Sanza, C., Quinodoz, P., Pittet, B., and Pepper, M. S. (2000) Hypoxia-inducible angiopoietin-2 expression is mimicked by iodonium compounds and occurs in the rat brain and skin in response to systemic hypoxia and tissue ischemia. Am. J. Pathol. 156, 2077–2089 55. Hafezi-Moghadam, A., Simoncini, T., Yang, E., Limbourg, F. P., Plumier, J. C., Rebsamen, M. C., Hsieh, C. M., Chui, D. S., Thomas, K. L., Prorock, A. J., et al. (2002) Acute cardiovascular protective effects of corticosteroids are mediated by non-transcriptional activation of endothelial nitric oxide synthase. Nat. Med. 8, 473–479 56. Whitworth, J. A., Schyvens, C. G., Zhang, Y., Mangos, G. J., and Kelly, J. J. (2001) Glucocorticoid-induced hypertension: from mouse to man. Clin. Exp. Pharmacol. Physiol. 28, 993–996 Received December 6, 2002; accepted May 5, 2003.

Table 1 Primers for the amplification of constructs of the 5′-flanking region of human CRLR.

Forward primers

Reverse primer

Total

for the 1st round amplification

for the 1st round amplification

PCR fragment

(shared by all fragments)

length, bp

5'-TCCCCTGATCATATCCAATG-3'

Reporter plasmid

5'-TCTGAGATTCCGCAGAAGAG-3'

5'-CACACACACACACACGCCTA-3' 5'-CACACACACACAGAATCCTA-3'

Forward primers

Reverse primer

with MluI adaptor

with BglII adaptor

for the 2nd round amplification

for the 2nd round amplification

5'-cttacgcgtgTCCCCTGATCATATCCAATG-3' 5'-cttacgcgtgCACACACACACACACGCCTA-3' 5'-cttacgcgtgCACACACACACAGAATCCTA-3'

5'-cgcagatctcTCTGAGATTCCGCAGAAGAG-3'

1147 516 516

Sequence corresponding to the 5′-flanking region sequence is in capitals. 3-bp substitutions within the HIF-1 binding site are underlined. Adaptor sequences are in small letters, with restriction sites underlined.

pGL3-CRLR-1147 pGL3-CRLR-516 pGL3-CRLR-516mut

Fig. 1

Figure 1. Transcriptional profiling of human CRLR gene in cell lines and tissues. Predominant expression of CRLR mRNA is demonstrated in endothelial cells isolated from various organs. Expression is much lower in non-endothelial cells lines (A). In tissues a high expression of CRLR transcripts was found in lung, pancreas, heart, endometrium, and placenta. In tumor samples from breast and head and neck cancers, the CRLR level was higher than in matched normal tissue samples from the same organ in the same patient (B). High levels were also detected in colon and lung tumors. Beta-actin control PCR demonstrates even loading of the template mRNA obtained from various cell lines and tissues.

Fig. 2

Figure 2. Identification of transcriptional start of human CRLR cDNA from endothelial cells by rapid amplification of cDNA ends (RACE). Human CRLR gene-specific primer (GSP-1) was designed for 5′-RACE reaction. A) The reaction amplified major product of ≈200 bp for human CRLR (lane 1) and ≈2.5kb for the human transferin receptor (TFR) (lane 2; control) in 5′-RACE. GSP-1 (lane 3), TFR (lane 4), or universal primer mix (UPM) (lane 5) alone did not produce a PCR fragments. DNA markers 50 bp ladder (lane 6) and 1 kb ladder (lane 7) were used to identify the size of PCR products. The 200 bp cDNA fragment was gel-purified and sequenced to obtain the sequence of the 5′UTR of the human CRLR cDNA. B) Sequence of the Exon I of the human CRLR cDNA (boxed) was therefore extended by one base with the transcription start site corresponding to an adenosine nucleotide.

Fig. 3

Figure 3. Genomic organization and schematic diagram of the 5′ flanking region of the human CRLR gene. GenBank Nucleotide Sequence Database (http://www.ncbi.nlm.nih.gov) was searched by BLASTN analysis of the 5′UTR sequence determined by 5′-RACE to identify the 5′flanking region of the gene by sequence overlap. The analysis resulted in the identification of a chromosome 2 sequence and an individual BAC clone, both directly corresponding to the region of interest. Recent data on the sequence of human chromosome 2 identifies the gene of CRLR (designated CALCRL by HGP; GenBank Accession number NT_022161) that is located at 2p31 and spans ~100,000 base pairs. The gene apparently contains 15 exons (numbered I–XV). Two cDNA clones of human CRLR (accession numbers L76380 and U17473) were also identified by 100% sequence overlap with 5′-RACE sequence.

Fig. 4

-2318 -2300 -2250 -2200 -2150 -2100 -2050 -2000 -1950 -1900 -1850 -1800 -1750 -1700 -1650 -1600 -1550 -1500 -1450 -1400 -1350 -1300 -1250 -1200 -1150 -1100 -1050 -1000 -950 -900 -850 -800 -750 -700 -650 -600 -550 -500

…………………………………………………….CTTCATGGACTACAGCCA TGGGCCCATGTGTACGTCAACTTAAATATAAATGATACAACTTCTACTAG TATA-box ACACCCCATAAAGTATAGCACTTGATAGAGAGTAGAAGAGAAAGAGCATT GGATTAAGGGTCTTATGACATGAGCTCAAAACATGAATTTTTTTCCTTCA GTAGACCTTACTAGTATTGGGCAAATGAAATCAATGAATCTCACCAGGCG CAGGGGCTCATGTCTGTAATCCCAGCACTTTGGGAGACCAAGGTGGGCGGG GC-box TCACCTTAGGTCAGGAGTTTCAGACCAGTCTGGCCAACATAGTGAAACC CTGTCTCTACAAAAAAATACAAAATGTTAGCTGGGTGTGGTGGCGGGCGC GC-box CTGTAATCCCAGCTACTTGGGAGGTTGAGGCAGGAGAATTGCTTGAACCC GGGAGGTGGAGGTTGCAGTGAGCTGAGATTGCGTCATTGCACTCCAGCCT GTGCAACAAGAGCAAAAACTCCATCAAGAAAGAAAGAAGGAAGGAAGGAA GGAAGGAAAGAAAGAAAAATGAATCTTTGGAAAGACGAAAATATCAATGC TTTTATAAACATATTGGGAAAAGTTTTAGTTTTCCATGATTTAATTAAAT TCAAAAACTATATATTAATCTCTTTATAGGATTCATATATTACACTTAGC ATGGAAGATGAGAAGACATGACCCATTATTACTTTCATATTAAATCTAGT ATTTGTTTTTCTCTGAATTTCAAGATGGGAACATGAAGCCTAAAAAGCTT TGTCAAGATCACACCAGACAGTATCAGAACCGGTTCACCAGTGTAACTCA GTTTCTTACAAGTCTTTTCTATTAACCATAATTATAGAGATGAAAGTATA TCTATTTTTTATATGTCTGTATTTTGTAATCAATATTGATCTCACTGGTC TTAAAATCAAAGATTGTATAAACATTTTCTTCCACTAATTCAGACAATAA AAATGTCAACATGAGCACCCTGCTTTAAAAACATGATATTCCTGAATTTA TTTTGCCTTTACCTCCTTTGTCTGCCTACAAGGTGTATGGCACCTCATTT TATCCTGGAATTGCACTAACAATTTACTAAGAGTTGAATGATCCTCACCG TATCTTATCTATTTCAAAATGTTATGAAATTTGTCGATTCAAAGCCTTAG ACATAAAATCTATCTCTTCTAGTTTATAGATGAGAAAATTTATGCCCTGA TAAATTAAGTGACTTTTAGTGCTGTTTAGGTTATAGGGATTATAATTATT GCTTCATATCGAACATTTACCAAATTATAAAAATGATAAAAGCATTTTAA ATTTACATTTTCCCCTGATCATATCCAATGATGTATTAAACATATTCAGG AAAAACTATGCTTTGAGATGAAATTTTGTCTAAGAAATAAAGTATCCTTT GTATTTATATTATTTTATAATATTATGTTTACAACATCTATATTTTCTTT AAGATTATATTGACTTACAAATATTGTGGTATAAATTATTTTATATTATA TATA-box TATA-box AATAACATAATTATACCAAATATTTTTAAATGTGTGCAATAATTTTAAAA TTATGAATTATTCAAAAGGCTATTTTGTCAAATATATATACTTATATATT TATA-box ATAAAAGAAACACTCTATACACACACATACACAACCTGAATTTATAACAC ATACACTCATGTTCTTATGAAGAAGGTAAAGGAAAAAATAAAAGATTTAA AAACTGCAGGATAAAGTTTCTTGATCTAATTAACTGATTAGGAACTGCAC TTAGGAACTGATGGAGGAACAGCACCCAATTAGCAGAGCTCCAAATTAAG AAGAGCCAAATCACAAAACCAGTTATGATGAATACAGTTAATTTTTTTTT

-450 -400 -350 -300 -250 -200 -150 -100 -50 +1

CTAGTGTTGTGCTATGAACACAGATTTGTTAGATTTTTTTTCCTGGATAC TTTGTAAGCTATAATTCAACACACACACACACACACACACACACACACAC ACACACGCCTAACTCCTTTGATTCTTTGAGCAGAATACTATATTCAGATT HRE TCCTTCAAATCACAAGTAGCTTGTTTGGCAAGTTCTAACAGAACTCAGTC AAGGTGAAAGCCAGCCAGCTTTTTACTGGTAACAATGTATTCACACAGCC TATGATCTCTCTCTGTTCAGGCTGCTTCTTGCTCTTGTCTCACAATAAGA AAGGAGTGCTGCTTTCCTGGGGTATGCTATTTGAGAAAGAAAGTAACCTA ACACTAACTGCAGGCGGGGTCAGAGTGATGTAACAGGAAGCTCTGATGTT Sp-1 GC-box TCCCTTCTGCTGCTGATCACTTACAATCTGACAACACTTACAATCTACTC AGAACAACCTCTCTCTCTCCAGCAGAGAGTGTCACCTCCTGCTTTAGGAC transcriptional start (exon I) CATCAAGCTCTGCTAACTGAATCTCATCCTAATTGCAGGATCACATTGCA AAGCTTTCACTCTTTCCCACCTTGCTTGTGGGTAAATCTCTTCTGCGGAA reverse primer TCTCAGAAAGTAAAGTTCCATCCTGAGAATATTTCACAAAGAATTTCCTT AAGAGCTGGACTGGGTAAGTGCACATTCAAAATAAATATATTTATTCTAAG

Figure 4. Sequence and organization of the 5′flanking region of human CRLR. (Top panel) Analysis of the sequence of 5′-flanking region of human CRLR by the database software SIGNAL SCAN. (Bottom panel) Sequence of the 2318 bp 5′flanking region of human CRLR. Boxed sequences in the 850 bp immediately upstream of the cDNA indicate TATAboxes, GC boxes, and Sp-1 binding elements of potential significance for basal promoter activity. Underlined sequences were used to sequence the cloned 5′-flanking region fragment by genomic walking. NF-1, nuclear factor-1; GR, glucocorticoid receptor; GATA-1, GATA binding transcription factor-1; HRE, hypoxia-response element.

Fig. 5

Figure 5. Functional analysis of the human CRLR gene promoter. A) CRLR sequences were cloned 5′ to pGL3 coding sequences. All sequences contain 152 bp of the exon I sequence; arrow, 5′-most transcription initiation site. B) pGL3-CRLR reporters were transfected into primary human dermal microvascular endothelial cells with ph PG-TK, incubated at 20% O2 for 4 h, and then triplicate plates were incubated at 20 or 0.1% O2 for 16 h. The pGL3/ph PG-TK ratio was determined for each plate and normalized to the results for pGL3-CRLR-516 in cells at 20% O2 (Relative promoter activity) (mean± SEM; P