Triglyceridelowering Effect of Respiratory ... - Wiley Online Library

Animal Physiology

Triglyceride-lowering Effect of Respiratory Uncoupling in White Adipose Tissue Martin Rossmeisl,* Jan Kovar,† Ivo Syrovy,* Pavel Flachs,* Dagmar Bobkova,† Frantisek Kolar,‡ Rudolf Poledne,† and Jan Kopecky*

Abstract ROSSMEISL, MARTIN, JAN KOVAR, IVO SYROVY, PAVEL FLACHS, DAGMAR BOBKOVA, FRANTISEK KOLAR, RUDOLF POLEDNE, AND JAN KOPECKY. Triglyceride-lowering effect of respiratory uncoupling in white adipose tissue. Obes Res. 2005;13:835– 844. Objective: Hypolipidemic drugs such as bezafibrate and thiazolidinediones are known to induce the expression of mitochondrial uncoupling proteins (UCPs) in white adipose tissue. To analyze the potential triglyceride (TG)-lowering effect of respiratory uncoupling in white fat, we evaluated systemic lipid metabolism in aP2-Ucp1 transgenic mice with ectopic expression of UCP1 in adipose tissue. Research Methods and Procedures: Hemizygous and homozygous transgenic mice and their nontransgenic littermates were fed chow or a high-fat diet for up to 3 months. Total TGs, nonesterified fatty acids, and the composition of plasma lipoproteins were analyzed. Hepatic TG production was measured in mice injected with Triton WR1339. Uptake and the use of fatty acids were estimated by measuring adipose tissue lipoprotein lipase activity and fatty acid oxidation, respectively. Adipose tissue gene expression was assessed by quantitative reverse transcriptase-polymerase chain reaction. Results: Transgene dosage and the high-fat diet interacted to markedly reduce plasma TGs. This was reflected by decreased concentrations of very-low-density lipoprotein particles in the transgenic mice. Despite normal hepatic TG

Received for review July 27, 2004. Accepted in final form February 22, 2005. The costs of publication of this article were defrayed, in part, by the payment of page charges. This article must, therefore, be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. *Department of Adipose Tissue Biology and Center for Applied Genomics, Academy of Sciences of the Czech Republic; ‡Department of Developmental Cardiology, Institute of Physiology, Academy of Sciences of the Czech Republic; and †Institute for Clinical and Experimental Medicine and Center for Experimental Cardiovascular Research, Prague, Czech Republic. Address correspondence to Jan Kopecky, Department of Adipose Tissue Biology, Institute of Physiology, Academy of Sciences of the Czech Republic, Videnska 1083, 142 20 Prague 4, Czech Republic. E-mail: [email protected] Copyright © 2005 NAASO

secretion, the activity of lipoprotein lipase in epididymal fat was enhanced by the high-fat diet in the transgenic mice in a setting of decreased re-esterification and increased in situ fatty acid oxidation. Discussion: Respiratory uncoupling in white fat may lower plasma lipids by enhancing their in situ clearance and catabolism. Key words: epididymal fat, lipoprotein lipase, fatty acid oxidation, transgenic mice, uncoupling protein

Introduction A growing body of evidence suggests that hypertriacylglycerolemia is a risk factor for cardiovascular disease, namely because of associated atherogenic factors, i.e., increased concentrations of triglyceride (TG)1-rich lipoproteins, small low-density lipoprotein (LDL) particles, and low high-density lipoprotein (HDL)-cholesterol (1,2). Various treatment strategies aimed at decreasing plasma TG concentration are known to affect the synthesis of lipoproteins in the liver and/or to increase clearance of TGs by peripheral tissues (3). For instance, the lipid-lowering effects of the widely used hypolipidemic drugs, fibrates, can be attributed to changes in the hepatic gene expression (4,5). As a result, both reduced secretion of very-low-density lipoprotein (VLDL) particles and enhanced catabolism of TG-rich particles contribute to the hypolipidemic effect of fibrates (6). In contrast, the antidiabetic agents thiazolidinediones (TZD) lower serum TG concentrations in rats, primarily by enhancing serum TG removal through the activation of lipoprotein lipase (LPL) in adipose tissue, without affecting TG production in vivo (3). Treatments with TZD and some fibrates such as bezafibrate also induce gene expression of mitochondrial uncou-

1 Nonstandard abbreviations: TG, triglyceride; LDL, low-density lipoprotein; HDL, highdensity lipoprotein; VLDL, very-low-density lipoprotein; TZD, insulin-sensitizing drugs thiazolidinediones; LPL, lipoprotein lipase; UCP, mitochondrial uncoupling protein; FA, fatty acid; PCR, polymerase chain reaction; NEFA, non-esterified fatty acid; IDL, intermediate-density lipoprotein; apo, apolipoprotein; PEPCK, phosphoenolpyruvate carboxykinase; AMP, adenosine 5⬘-monophosphate; AMPK, AMP-activated protein kinase; PPAR, peroxisome proliferator-activated receptor.

OBESITY RESEARCH Vol. 13 No. 5 May 2005

835

Respiratory Uncoupling and Plasma Triglycerides, Rossmeisl et al.

pling proteins (UCPs), including UCP1, UCP2, and UCP3, in adipose tissue of rats and mice (7–13). Because all UCPs may lower mitochondrial ATP production through respiratory uncoupling (14 –16), thus stimulating substrate oxidation in mitochondria, it is possible to speculate that the effect of these lipid-lowering compounds may be caused, in part, by an increased degradation of fatty acids (FAs) within adipose tissue depots. However, both fibrates and TZD have a rather complex pattern of action in vivo, and the role of respiratory uncoupling per se in adipose tissue in the regulation of plasma TGs could not be precisely defined. Transgenic aP2-Ucp1 mice (17), expressing the UCP1 gene from a highly fat-specific (18) aP2 gene promoter, represent an established model of respiratory uncoupling in adipose tissue (19 –21). These animals resist the development of obesity induced by genetic or dietary factors, reflecting a lower accumulation of TG in all fat depots except gonadal fat (17,22). Resistance to obesity results from respiratory uncoupling (20) in white fat but not in brown fat (19,23) and is conveyed by the stimulation of endogenous substrate oxidation (19) and the depression of in situ FA synthesis (24) in white fat. In our previous study (22), a mild but significant depression of plasma TG in hemizygous aP2-Ucp1 transgenic mice suggested an effect of adipose tissue respiratory uncoupling on lipid metabolism. The aim of this study was to analyze the mechanism of the lipid-lowering effect of respiratory uncoupling in white fat. Our results show that decreased efficiency of mitochondrial energy conversion in white fat may lower plasma TGs by enhancing their in situ clearance and catabolism.

Research Methods and Procedures Animals Transgenic aP2-Ucp1 mice (17) were originally obtained from the Jackson Laboratory (Bar Harbor, ME), and the mouse colony was established in the animal facility of the Institute of Physiology. Home-produced hemizygous and homozygous transgenic male mice, carrying low and high dosages of the aP2-Ucp1 transgene, respectively, together with their nontransgenic littermate controls, were identified by real-time quantitative polymerase chain reaction (PCR; LightCycler; Roche, Penzberg, Germany) using primers P1 (CCGCAGACGACAGGAAGGTGAAG) and P2 (CTGACGGAGCTGGGTTAGGTATGG) specific for the endogenous aP2 gene promoter (reaction A) and primers P3 (GGCCCCCATTGGTCACTCC) and P4 (CTGATGCGGGCACGAAACC) specific for the aP2-Ucp1 transgene construct (reaction B). Transgene dosage was assessed as a ratio between the products of reactions A and B. The mice were maintained on a 12:12-hour light-dark cycle (light starting at 6:00 AM) at 20 °C. After weaning at 4 weeks of age, the animals were single-caged and allowed unrestricted access to water and standard chow. At 3 months of age, some mice 836


Figure 1: Schematic illustration of the experimental protocol with respect to age and dietary treatment of animals at the time when particular experiments were performed. Age-matched mice of appropriate genotypes fed standard chow served as controls for the effect of a high-fat diet. 3-HB, 3-hydroxybutyrate.

were randomly assigned to a high-fat diet, whereas the rest were kept on regular chow and served as controls for the effect of the high-fat diet (22). The animals were fed a high-fat diet for variable periods of time. (See Figure 1 for schematic illustration of the experimental protocol with respect to age and dietary treatment of animals.) The highfat diet induced obesity in the control mice, whereas body weight was reduced in the aP2-Ucp1 mice proportionally to the transgene dosage (see Tables 1 and 2 in ref. 23). Animals were killed by cervical dislocation under diethyl ether anesthesia, and epididymal and subcutaneous dorsolumbar white fat depots (19) were dissected and stored at –70 °C for the estimation of LPL activity and RNA analysis. The experiments were conducted under the guidelines for the use and care of laboratory animals of the Institute of Physiology. Plasma Nonesterified Fatty Acids, Total TG, Cholesterol, and Lipoprotein Concentrations Plasma was obtained from the truncal blood of fasted animals (16 hours; 6:00 PM to 10:00 AM) and used for the estimation of non-esterified fatty acids (NEFAs; kit 994 – 75409 NEFA C; Wako Chemicals, Richmond, VA), total TG, and total cholesterol (Roche Diagnostics, Basel, Switzerland). For lipoprotein analysis, plasma was pooled from subgroups of five to eight nontransgenic and hemizygous transgenic mice. Aliquots of fresh plasma (0.75 to 3.1 mL) containing EDTA (1 mg/mL) and benzamidine (0.3 mg/mL) were subjected to sequential ultracentrifugation at densities of 1.006 and 1.063 g/mL (100,000 g, 18 hours, 12 °C) in a 40.3 rotor (Beckman Instruments, Palo Alto, CA) to separate VLDL (d ⬍ 1.006 g/mL), intermediate-density lipoprotein (IDL) and LDL fraction (IDL ⫹ LDL; d ⫽ 1.006 to 1.063 g/mL), and HDL (d ⬍ 1.063 to 1.21 g/mL). The IDL ⫹ LDL fraction was concentrated and desalted on Ultrafree-15 centrifugal filtration devices (Millipore, Bedford,


MA). Total TG and total cholesterol in lipoprotein fractions were measured using enzymatic tests (Roche Diagnostics). The VLDL and IDL ⫹ LDL fractions were delipidated, and concentrations of apolipoprotein (apo) B-100 and apo B-48 were determined using a 3% to 20% gradient sodium dodecyl sulfate-polyacrylamide gel electrophoresis (25). The corresponding bands on gels were quantified using GS-800 Calibrated Densitometer and Quantity One software. Prestained sodium dodecyl sulfate-polyacrylamide gel electrophoresis standards (Broad Range) were from BioRad Laboratories (161-0317; Hercules, CA). Hepatic TG Secretion and Ketogenesis A modification of the previously published procedures (3,26) was used. One day before the experiment, at 6:00 PM, the mouse diet was removed, and the animals were allowed free access to water and fat-free food (dry cereal). The experiment was performed between 9:00 AM and 1:00 PM in the control and hemizygous transgenic mice anesthetized by intraperitoneal injection of pentobarbital (50 ␮g/g body weight). The animals were kept at 37 °C. The jugular vein was surgically exposed, and mice were injected intravenously with 10% Tyloxapol (Triton WR-1339; T-8761; Sigma-Aldrich, St. Louis, MO; 500 mg/kg body weight). Under these conditions, the nonionic detergent blocks the lipolytic degradation of TG-rich lipoproteins in the peripheral tissues, and the rise in plasma TG is proportional to the production of VLDL in the liver (27). Blood was collected from the jugular vein before and 2 hours after the injection, and plasma TG levels were subsequently assessed to determine their absolute rise during the experiment. The values were also expressed relative to liver mass (26). Hepatic ketogenesis was assessed by measuring plasma levels of 3-hydroxybutyrate in fed animals using a kit Autokit 3-HB from Wako Chemicals. LPL Activity The enzyme activity was estimated in detergent extracts of adipose tissues dissected from fasted mice as described before (28). FA Oxidation Oxidation of oleic acid was measured by 3H2O release from fragments (⬃35 mg) of adipose tissue as described before (29). Because fasting itself increases FA oxidation in adipose tissue (30), the effect of aP2-Ucp1 transgene on FA oxidation was assessed in adipose tissue of mice in the fed state. The results are expressed either per milligram of protein or per milligram of tissue. Protein concentration was measured using a bicinchoninic acid procedure. Gene Expression in Adipose Tissue Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA). Gene expression was analyzed by re-

verse transcription followed by the real-time quantitative PCR (LightCycler Instrument; F. Hoffman-La Roche, Basel, Switzerland) with primers specific for mouse phosphoenolpyruvate carboxykinase (PEPCK; forward, CCAGCCAGTGCCCCATTATTGAC; reverse, TTTGCCGAAGTTGTAGCCGAAGAA). Expression levels of cyclophilin-␤ (forward, ACTACGGGCCTGGCTGGGTGAG; reverse, TGCCGGAGTCGACAATGATGA) mRNA were used to correct for inter-sample variations. The detailed protocol has been described before (31). Statistical Analysis Data were evaluated by ANOVA:single factor (Excel; Microsoft, Redmond, WA) and by ANOVA with NewmanKeuls posthoc multiple comparison method as described before (22), when indicated. All differences were judged to be significant at p ⬍ 0.05.

Results Plasma Lipids It was shown previously (22) that a mild but significant depression of plasma TG occurred in hemizygous aP2-Ucp1 transgenic mice, irrespective of the fat content in their diet. In this study, we used both hemizygous and homozygous transgenic mice, i.e., mice that carry various transgene dosages, to analyze in detail the effect of respiratory uncoupling in white fat on systemic lipid metabolism and its interaction with a high-fat diet. (See Figure 1 for details with regard to age and dietary treatment of animals.) Figure 2 shows plasma TGs in nontransgenic and transgenic mice. Plasma TG levels were reduced by the transgene in a dose-dependent manner (Figure 2). The high-fat diet elevated plasma TGs in the control nontransgenic mice compared with their chow diet-fed counterparts (p ⬍ 0.05); however TG levels did not change in the hemizygous transgenic mice and even decreased (p ⬍ 0.01) in the homozygotes in response to a high-fat diet. As a result, in the homozygous transgenics fed a high-fat diet, plasma TG levels were 2.5-fold lower compared with their counterparts fed a chow diet (Figure 2). This difference was observed in several independent experiments. Plasma NEFAs in the transgenic mice were also relatively low (Figure 2), although significant differences were found only between control nontransgenic and homozygous transgenic mice. On the other hand, cholesterol levels were much less affected by the transgene in mice that were on a high-fat diet for 2 months (see Figure 1 for experimental details), because plasma cholesterol concentrations were 2.89 ⫾ 0.08, 2.51 ⫾ 0.05, and 2.47 ⫾ 0.18 mM in the nontransgenic, hemizygous, and homozygous transgenics, respectively (p ⬍ 0.05, control versus transgene). Thus, the overexpression of transgenic UCP1 in white fat leads to profound effects at the level of systemic lipid metabolism. OBESITY RESEARCH Vol. 13 No. 5 May 2005

837


transgenic mice, which was less pronounced in animals fed a high-fat diet (Table 1). On the other hand, TG concentration in HDL particles was decreased by the transgene, whereas no differences between the genotypes were observed in HDL-cholesterol levels (Table 1). Similar differences between the genotypes were obtained also from lipoprotein analysis of 5-month-old mice, which had been on a high-fat diet for only 2 months (data not shown). Thus, the difference in total plasma TG levels between control and transgenic mice reflected the changes in TG content of both VLDL and HDL fractions but not of the IDL ⫹ LDL fraction.

Figure 2: Plasma levels of total TGs and NEFAs. Nontransgenic (⫹/⫹), hemizygous (tg/⫹), and homozygous (tg/tg) aP2-Ucp1 transgenic mice were fed laboratory chow (STD) until they were 3 months old, and then they were switched to a high-fat diet for additional 3 months. Total (A) TGs and (B) NEFAs were assessed in the plasma of overnight fasted mice. Values are means ⫾ SE for 5 to 10 mice. *Statistically significant differences between nontransgenic and transgenic mice fed the same diet.

Plasma Lipoproteins Detailed analysis of plasma lipoprotein composition (Table 1) was performed in nontransgenic and hemizygous transgenic mice fed a high-fat diet for 3 months (see Figure 1 for details). The content of all measured components of VLDL particles (i.e., TG, cholesterol, apo B-100, and apo B-48) was elevated in response to the high lipid content in the diet and was lowered by the transgene. Moreover, the effect of the transgene on VLDL-TG was more pronounced in mice fed a high-fat diet than in animals fed standard chow (Table 1). Transgene also affected the IDL ⫹ LDL fraction in a diet-dependent manner (32); however, its effect on TG content and especially cholesterol content in this fraction was relatively low (Table 1). There seemed to be a small increase in TG content in the IDL ⫹ LDL fraction from 838


Hepatic TG Secretion and Ketogenesis Because hepatic VLDL production is primarily substrate driven (33), the mechanism behind the TG-lowering effect of respiratory uncoupling in white adipose tissue might involve a reduction in the synthesis and production of TG in the liver because of a lower supply of FAs by adipose tissue. This possibility was tested in vivo by intravenous injection of Triton WR-1339 into fasted mice (see Research Methods and Procedures). Table 2 shows the absolute and relative (to liver mass) TG levels accumulated during the 2-hour period after Triton injection. The absolute rates were not significantly different between nontransgenic controls and hemizygous transgenics fed either diet. Moreover, respiratory uncoupling in white fat did not result in any changes in plasma ketone body concentration, because plasma 3-hydroxybutyrate levels were 127 ⫾ 29, 111 ⫾ 12, and 128 ⫾ 33 ␮M in the control, hemizygous, and homozygous transgenic mice, respectively, again arguing against reduced use of NEFAs by the liver of transgenic mice. Activity of LPL in Epididymal Adipose Tissue Increased peripheral clearance of TGs could be responsible for low plasma TGs in the aP2-Ucp1 transgenic mice. Because adipose tissue was the only tissue where transgenic UCP1 was detected (17), and epididymal fat is the major fat depot in both nontransgenic and transgenic mice (17,22), LPL activity in epididymal fat was examined. In animals fed a low-fat chow diet, the expression of transgenic UCP1 was associated with a significant increase in specific LPL activity (expressed per milligram tissue), especially in the homozygous mice (Table 3). The high-fat diet stimulated specific LPL activity, irrespective of the genotype, but it also potentiated the effect of the UCP1 transgene. Total LPL activity was similar in the nontransgenic and transgenic mice fed a chow diet, but it was increased proportionally to the transgene dosage by feeding a high-fat diet. As a result, total LPL activity in epididymal fat was 1.8-fold higher in the homozygous than in the nontransgenic mice. This suggests that epididymal fat LPL has a major role in the uptake of TGs in the transgenic mice.


Table 1. Effect of diet on lipoprotein composition in nontransgenic and aP2-Ucp1 transgenic mice STD

VLDL (d ⬍ 1.006) TG (mM) Cholesterol (mM) Apo B-100 (mg/liter) Apo B-48 (mg/liter) IDL ⫹ LDL (1.006 ⬍ d ⬍ 1.063) TG (mM) Cholesterol (mM) Apo B-100 (mg/liter) Apo B-48 (mg/liter) HDL (d ⬎ 1.063) TG (mM) Cholesterol (mM)

HF

ⴙ/ⴙ

tg/ⴙ

ⴙ/ⴙ

tg/ⴙ

0.22 0.06 3.3 1.3

0.22 0.06 0.9 0.7

0.69 0.11 7.5 5.7

0.37 0.05 3.9 2.8

0.10 0.14 81.4 3.7

0.23 0.13 79.4 3.1

0.13 0.59 74.3 3.4

0.16 0.51 120.0 4.4

0.57 1.80

0.25 1.94

0.76 3.16

0.52 2.96

Lipoprotein composition was characterized in pooled plasma samples (five to eight mice per group; see Research Methods and Procedures for details) from the control nontransgenic (⫹/⫹) and hemizygous (tg/⫹) aP2-Ucp1 transgenic mice fed either standard chow (STD) or a high-fat (HF) diet.

FA Oxidation in Epididymal Fat of Mice Fed a High-fat Diet Increased delivery of TGs to epididymal adipose tissue of transgenic mice fed a high-fat diet would also imply increased in situ oxidation of FA because of respiratory uncoupling induced by the transgenic UCP1. Therefore, oleate oxidation by epididymal fat was measured in the control, hemizygous, and homozygous transgenic mice fed a highfat diet for 1 month (Figure 3). Oleate oxidation, expressed either per milligram of protein (Figure 3A) or per milligram of tissue (Figure 3B), was elevated by the transgene in a dose-dependent manner. As a result, it was ⬃2-fold higher in the homozygous transgenic than in nontransgenic mice

when expressed per milligram of protein (Figure 3A), and the difference between the genotypes was even higher when FA oxidation was calculated per milligram of tissue (Figure 3B). Effect of Transgene and Diet on the Expression of PEPCK in Epididymal Fat Re-esterification of FA within adipocytes is an important mechanism participating in the regulation of adipose tissue mass (34 –36) and could be affected by the expression of the aP2-Ucp1 transgene. As a marker of glyceroneogenesis and FA re-esterification (36), the expression of the PEPCK gene was quantified in epididymal fat of overnight fasted mice

Table 2. Hepatic TG secretion in nontransgenic and aP2-Ucp1 transgenic mice STD

⫹/⫹ tg/⫹

HF

Absolute

Relative

Liver (g)

Absolute

Relative

Liver (g)

12.76 ⫾ 1.46 13.23 ⫾ 1.40

9.11 ⫾ 0.99 9.19 ⫾ 0.78

1.50 ⫾ 0.56 1.46 ⫾ 0.59

11.28 ⫾ 2.29 10.94 ⫾ 1.33

7.66 ⫾ 1.89 5.83 ⫾ 0.60

1.66 ⫾ 0.21 1.87 ⫾ 0.11

Mice (8 to 11 per group) were injected intravenously with Triton WR-1339, and TG levels were assessed 2 hours after injection. Data are given as means ⫾ SE. Plasma TG levels are expressed either as absolute values (mM) or relative to liver mass (mM/g tissue). Differences between genotypes within each type of diet were not statistically significant. STD, standard chow; HF, high fat.


839


Table 3. Effect of diet and genotype on weight and LPL activity in the epididymal fat depot

STD ⫹/⫹ tg/⫹ tg/tg HF ⫹/⫹ tg/⫹ tg/tg

LPL activity

Tissue weight (mg)

Specific

Total

843 ⫾ 217 897 ⫾ 160 477 ⫾ 40†‡

0.20 ⫾ 0.01 0.29 ⫾ 0.04* 0.48 ⫾ 0.08†‡

190 ⫾ 79 278 ⫾ 74 224 ⫾ 29

1884 ⫾ 134 1875 ⫾ 220 1075 ⫾ 133†‡

0.45 ⫾ 0.13 0.81 ⫾ 0.25 1.49 ⫾ 0.39†‡

820 ⫾ 194 1319 ⫾ 300 1487 ⫾ 339†

Specific LPL activity (nmol FA/min per milligram of tissue) and total LPL activity (nmol FA/min per fat depot) were assessed in detergent extracts of adipose tissue. Values are means ⫾ SE for four to six mice. Symbols indicate significant differences (by ANOVA with Newman-Keuls posthoc multiple comparison method): *⫹/⫹ vs. tg/⫹; †⫹/⫹ vs. tg/tg; ‡tg/⫹ vs. tg/tg. STD, standard chow; HF, high fat.

fed either standard chow or a high-fat diet for 2 months (Figure 4). Transgene markedly down-regulated PEPCK gene expression, irrespective of the diet or the dosage of the transgene (p ⬍ 0.01; Figure 4).

Discussion A major finding of this study was that respiratory uncoupling in white adipose tissue is capable of lowering plasma TGs while enhancing FA oxidation and the activity of LPL in the tissue. This effect was particularly enhanced by a high-fat diet. Thus, changes in energy conversion in white adipocytes affected the whole-body lipid metabolism and might contribute to lipid-lowering effects of some fibrates and TZD that increase the expression of UCP homologues in white adipose tissue (see the Introduction). Uptake of FA by white adipose tissue, mediated by LPL, is the main mechanism of plasma TG clearance during the postprandial period (37,38). Results of this study indicate significantly higher specific, as well as total, LPL activity in the epididymal fat depot of transgenic compared with wildtype mice, namely in the homozygous animals, and further stimulation of the LPL activity by a high-fat diet. These data suggest a major role for epididymal fat in FA catabolism and a TG-lowering effect in the aP2-Ucp1 mice fed a high-fat diet. It is unlikely that the subcutaneous adipose tissue, which was greatly reduced already in the hemizygous transgenic mice (17,22) and was 10-fold less in the homozy840


Figure 3: Oxidation of FA in epididymal adipose tissue. Fourmonth-old nontransgenic (⫹/⫹), hemizygous (tg/⫹), and homozygous (tg/tg) aP2-Ucp1 transgenic mice were fed a high-fat diet for 1 month. Oleate oxidation was measured by 3H2O release in fragments of adipose tissue and expressed either (A) per milligram of protein or (B) per milligram of tissue. Protein concentrations in the nontransgenic, hemizygous, and homozygous transgenic mice were 7.33 ⫾ 1.16, 8.41 ⫾ 0.49, and 9.63 ⫾ 0.85 mg protein/g tissue, respectively. Data are means ⫾ SE (n ⫽ 6 for nontransgenic and hemizygous transgenic mice; n ⫽ 4 for homozygous transgenics). *Statistically significant differences between nontransgenic and transgenic mice.

gous transgenics compared with the nontransgenic mice fed a high-fat diet (data not shown), contributes significantly to plasma TG clearance in these animals. Interscapular brown adipose tissue could not be involved either, because it is virtually absent in the homozygous and strongly reduced in the hemizygous transgenic mice (23). However, the stimu-


Figure 4: Gene expression of PEPCK in epididymal adipose tissue of 5-month-old nontransgenic (⫹/⫹), hemizygous (tg/⫹), and homozygous (tg/tg) aP2-Ucp1 transgenic mice that were fed a high-fat (HF) diet for 2 months. Nontransgenic and hemizygous transgenic mice of the same age fed standard chow (STD) served as a control for the effect of the HF diet. Overnight fasted mice were analyzed. Bars are means ⫾ SE (n ⫽ 6 except for hemizygous and homozygous transgenic mice fed HF diet with n ⫽ 4). *Statistically significant differences between nontransgenic and transgenic mice fed the same diet.

lation of LPL activity in other tissues, triggered by the low plasma levels of NEFAs, cannot be excluded (39,40). In the transgenic mice, LPL activity in adipose tissue is apparently stimulated in response to the activation of FA oxidation in adipocytes of animals fed a high-fat diet (Figure 3). The mechanistic link between intracellular FA oxidation and LPL activity is not clear. However, the adenosine 5⬘-monophosphate (AMP)-activated protein kinase (AMPK) that acts as a metabolic master switch activated by a depression in the intracellular energy charge (41) could be involved in the stimulation of FA oxidation by respiratory uncoupling. This kinase is activated and its content increased in white fat depots of the aP2-Ucp1 mice, including epididymal fat (29), where the transgenic UCP1 decreases mitochondrial membrane potential (20), lowers the ATP/ AMP ratio (29), increases mitochondrial biogenesis (21), and stimulates endogenous substrate oxidation (19). Similar to the changes seen in adipose tissue of the aP2-Ucp1 transgenic mice, TZD stimulates AMPK (42) and increases fat use in adipocytes by increasing mitochondrial biogenesis, FA oxidation, and oxygen consumption (8), while inducing the expression of various UCPs (9 –12), including UCP1 (7,8,13). In contrast to transgenic UCP1 that down-regulates PEPCK, TZD stimulate the expression of PEPCK (36), the rate-limiting enzyme in glyceroneogenesis and marker of FA re-esterification in adipocytes (36). By this mechanism, and by up-regulation of glycerol kinase (43), TZD stimu-

lates futile TG/FA cycling. Re-esterification of FAs in adipocytes plays an important role in intracellular fuel partitioning. For instance, in normal fed rats, 49.7% of endogenous FAs are reesterified, 50.1% are released, and only 0.2% are oxidized (30). Moreover, increased expression of PEPCK in adipose tissue of mice has been associated with obesity (34), and conversely, its down-regulation through a mutation in the promoter binding site for its regulatory factor peroxisome proliferator-activated receptor (PPAR)-␥ reduces adipose tissue size (35). Thus, the increase in re-esterification of FAs might be a part of the mechanism by which TZD support adipogenesis (8). On the other hand, the mechanism responsible for the reduction of adiposity and the low plasma TG in the aP2-Ucp1 transgenic mice most likely relies on the induction of fat use and inhibition of in situ lipogenesis (24) in adipocytes rather than on futile cycling of FA re-esterification. This conclusion is further supported by other findings, where increased AMPK activity in adipose tissue caused by exercise led to a down-regulation of lipogenesis and FA re-esterification through the inhibition of mitochondrial glycerol-3-phosphate acyltransferase (44). Reduced expression of PEPCK in epididymal adipose tissue of aP2-Ucp1 transgenic mice is most likely caused by a down-regulation of its upstream regulatory factor PPAR-␥ (29,35). However, reduced FA re-esterification in adipose tissue of transgenic mice could also be the result of metabolic adaptations that counteract increased FA use and reduce NEFA production by the UCP1-expressing adipocytes, similarly to a model of hormone-sensitive lipase-deficient mice (45). Because NEFAs are believed to be the main driving force for the production of VLDLs in the liver (33), it can be speculated that lower plasma NEFA concentrations in transgenic mice would result in lower VLDL production and, therefore, lower VLDL and TG concentrations. However, we did not observe any significant changes in TG secretion from the liver (Table 2). If there are no differences in VLDL production, the livers of transgenic mice must mobilize TG for VLDL-TG production from their intracellular sources to compensate for their lower circulating NEFA levels. Indeed, it was observed previously (see Figure 3 in ref. 22) that, in the hemizygous aP2-Ucp1 transgenic mice fed a high-fat diet, the relative TG content in the liver was ⬎2-fold higher than in control animals, suggesting increased hepatic de novo lipogenesis as a compensatory mechanism. The fact that there are no differences between control and transgenic mice in the use of NEFAs by the liver is further supported by the finding that plasma 3-hydroxybutyrate levels as a marker of hepatic ketogenesis were not different between the groups. Both transgenic mice overexpressing human LPL in multiple tissues including adipose (46) and mice deficient in hormone-sensitive lipase (39) have shown elevated LPL OBESITY RESEARCH Vol. 13 No. 5 May 2005

841


activity in white fat and improved lipoprotein profiles with reduced plasma TG and VLDL-TG in the fasted state, similar to our transgenic model. Increased activity of LPL associated with UCP1-mediated respiratory uncoupling is well documented during the activation of brown fat thermogenic function by cold exposure (47). Moreover, hyperleptinemia induced by adenovirus transfer in rats up-regulates LPL as well as UCP1, UCP2, and enzymes of FA oxidation in white fat (48,49), while lowering plasma TGs (50). Transgenic overexpression of both transcription factor PPAR-␦ (51) and winged helix/forkhead transcription factor FOXC2 (52) in adipose tissue of mice induces a marked expression of the UCP1 gene and a significant reduction in plasma TGs. In the first type of transgenic animals, similarly to aP2-Ucp1 mice, the hypotriglyceridemic effect of the transgene was augmented by the high-fat diet, whereas plasma cholesterol levels were normal (51). Importantly, compared with the other models (51,52), only in the aP2Ucp1 mice is it primarily the UCP1-induced respiratory uncoupling in white but not brown adipocytes (19,21,23) that exerts the hypolipidemic effect. A recent study (53) showing that human PPAR-␥ coactivator-1␣ is able to increase the expression of human UCP1 in human white adipocytes strengthens the view that induction of respiratory uncoupling in white adipose tissue could be a useful strategy for the treatment of obesity and disturbed lipid metabolism in metabolic disorders such as obesity and type 2 diabetes. In conclusion, the results of this study show that respiratory uncoupling in adipocytes of white fat leads to profound changes of systemic lipid metabolism. Overexpression of UCP1 in white fat was capable of protecting mice not only from dietary obesity but also from hyperlipidemia associated with a high-fat feeding. Thus, respiratory uncoupling in white fat could play a role in the way some fibrates and TZD exert their hypolipidemic effects.

Acknowledgments We thank Dr. Jaroslav Vorlicek for statistical analysis, Jaroslava Bemova and Sona Hornova for technical assistance, and A. Kotyk for critical reading of the manuscript. This work was supported by grants 303/02/1220 (to J.K.) and 303/03/P127 (to M.R.) from the Grant Agency of the Czech Republic and research project AVOZ 5011922.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15. References 1. Hokanson JE, Austin MA. Plasma triglyceride level is a risk factor for cardiovascular disease independent of high-density lipoprotein cholesterol level: a meta-analysis of populationbased prospective studies. J Cardiovasc Risk. 1996;3:213–9. 2. Grundy SM. Hypertriglyceridemia, atherogenic dyslipidemia, and the metabolic syndrome. Am J Cardiol. 1998;81: 18B–25B. 3. Lefebvre AM, Peinado-Onsurbe J, Leitersdorf I, et al. Regulation of lipoprotein metabolism by thiazolidinediones 842


16.

17.

occurs through a distinct but complementary mechanism relative to fibrates. Arterioscler Thromb Vasc Biol. 1997;17: 1756 – 64. Staels B, Vu-Dac N, Kosykh VA, et al. Fibrates downregulate apolipoprotein C-III expression independent of induction of peroxisomal acyl coenzyme A oxidase. A potential mechanism for the hypolipidemic action of fibrates. J Clin Invest. 1995;95:705–12. Andersson Y, Majd Z, Lefebvre AM, et al. Developmental and pharmacological regulation of apolipoprotein C-II gene expression. Comparison with apo C-I and apo C-III gene regulation. Arterioscler Thromb Vasc Biol. 1999;19:115–21. Schoonjans K, Staels B, Auwerx J. Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression. J Lipid Res. 1996;37:907–25. Digby JE, Montague CT, Sewter CP, et al. Thiazolidinedione exposure increases the expression of uncoupling protein 1 in cultured human preadipocytes. Diabetes. 1998;47:138 – 41. Wilson-Fritch L, Nicoloro S, Chouinard M, et al. Mitochondrial remodeling in adipose tissue associated with obesity and treatment with rosiglitazone. J Clin Invest. 2004;114: 1281–9. Cabrero A, Llaverias G, Roglans N, et al. Uncoupling protein-3 mRNA levels are increased in white adipose tissue and skeletal muscle of bezafibrate-treated rats. Biochem Biophys Res Commun. 1999;260:547–56. Cabrero A, Alegret M, Sanchez RM, Adzet T, Laguna JC, Vazquez M. Bezafibrate reduces mRNA levels of adipocyte markers and increases fatty acid oxidation in primary culture of adipocytes. Diabetes. 2001;50:1883–90. Matsuda J, Hosoda K, Itoh H, et al. Increased adipose expression of the uncoupling protein-3 gene by thiazolidinediones in Wistar fatty rats and in cultured adipocytes. Diabetes. 1998;47:1809 –14. Emilsson V, O’Dowd J, Wang S, et al. The effects of rexinoids and rosiglitazone on body weight and uncoupling protein isoform expression in the Zucker fa/fa rat. Metabolism. 2000;49:1610 –5. Fukui Y, Masui S, Osada S, Umesono K, Motojima K. A new thiazolidinedione, NC-2100, which is a weak PPARgamma activator, exhibits potent antidiabetic effects and induces uncoupling protein 1 in white adipose tissue of KKAy obese mice. Diabetes. 2000;49:759 – 67. Ricquier D, Bouillaud F. The uncoupling protein homologues: UCP1, UCP2, UCP3, StUCP and AtUCP. Biochem J. 2000;345:161–79. Echtay KS, Winkler E, Frischmuth K, Klingenberg M. Uncoupling proteins 2 and 3 are highly active H⫹ transporters and highly nucleotide sensitive when activated by coenzyme Q (ubiquinone). Proc Natl Acad Sci U S A. 2001;98:1416 –21. Fink BD, Hong YS, Mathahs MM, Scholz TD, Dillon JS, Sivitz WI. UCP2-dependent proton leak in isolated mammalian mitochondria. J Biol Chem. 2002;277:3918 –25. Kopecky J, Clarke G, Enerback S, Spiegelman B, Kozak LP. Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity. J Clin Invest. 1995;96:2914 –23.


18. Pelton PD, Zhou L, Demarest KT, Burris TP. PPARgamma activation induces the expression of the adipocyte fatty acid binding protein gene in human monocytes. Biochem Biophys Res Commun. 1999;261:456 – 8. 19. Kopecky J, Rossmeisl M, Hodny Z, Syrovy I, Horakova M, Kolarova P. Reduction of dietary obesity in the aP2-Ucp transgenic mice: mechanism and adipose tissue morphology. Am J Physiol. 1996;270:E776 – 86. 20. Baumruk F, Flachs P, Horakova M, Floryk D, Kopecky J. Transgenic UCP1 in white adipocytes modulates mitochondrial membrane potential. FEBS Lett. 1999;444:206 –10. 21. Rossmeisl M, Barbatelli G, Flachs P, et al. Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo. Eur J Biochem. 2002;269:1–10. 22. Kopecky J, Hodny Z, Rossmeisl M, Syrovy I, Kozak LP. Reduction of dietary obesity in the aP2-Ucp transgenic mice: physiology and adipose tissue distribution. Am J Physiol. 1996;270:E768 –75. 23. Stefl B, Janovska A, Hodny Z, et al. Brown fat is essential for cold-induced thermogenesis but not for obesity resistance in aP2-Ucp mice. Am J Physiol. 1998;274:E527–33. 24. Rossmeisl M, Syrovy I, Baumruk F, Flachs P, Janovska P, Kopecky J. Decreased fatty acid synthesis due to mitochondrial uncoupling in adipose tissue. FASEB J. 2000;14:1793– 800. 25. Kotite L, Bergeron N, Havel RJ. Quantification of apolipoproteins B-100, B-48, and E in human triglyceride-rich lipoproteins. J Lipid Res. 1995;36:890 –900. 26. Li X, Catalina F, Grundy SM, Patel S. Method to measure apolipoprotein B-48 and B-100 secretion rates in an individual mouse: evidence for a very rapid turnover of VLDL and preferential removal of B-48- relative to B-100-containing lipoproteins. J Lipid Res. 1996;37:210 –9. 27. Otway S, Robinson AM. The use of a non-ionic detergent (triton WR1339) to determine rates of triglyceride entry into the circulation of the rat under different physiological conditions. J Physiol. 1967;190:321–32. 28. Iverius P-H, Ostlund-Lindqvist A-M. Preparation, characterization, and measurement of lipoprotein lipase. In: Albers JJ, Segrest JP, eds. Methods in Enzymology, Plasma Lipoproteins, Part B. New York: Academic Press; 1986, pp. 691–704. 29. Matejkova O, Mustard KJ, Sponarova J, et al. Possible involvement of AMP-activated protein kinase in obesity resistance induced by respiratory uncoupling in white fat. FEBS Lett. 2004;569:245– 8. 30. Wang T, Zang Y, Ling W, Corkey BE, Guo W. Metabolic partitioning of endogenous fatty acid in adipocytes. Obes Res. 2003;11:880 –7. 31. Flachs P, Novotny J, Baumruk F, et al. Impaired noradrenaline-induced lipolysis in white fat of aP2-Ucp1 transgenic mice is associated with changes in G-protein levels. Biochem J. 2002;364:369 –76. 32. Nishina PM, Verstuyft J, Paigen B. Synthetic low and high fat diets for study of atherosclerosis in the mouse. J Lipid Res. 1990;31:859 – 69. 33. Lewis GF. Fatty acid regulation of very low density lipoprotein production. Curr Opin Lipidol. 1997;8:146 –53.

34. Franckhauser S, Munoz S, Pujol A, et al. Increased fatty acid re-esterification by PEPCK overexpression in adipose tissue leads to obesity without insulin resistance. Diabetes. 2002;51:624 –30. 35. Olswang Y, Cohen H, Papo O, et al. A mutation in the peroxisome proliferator-activated receptor gamma-binding site in the gene for the cytosolic form of phosphoenolpyruvate carboxykinase reduces adipose tissue size and fat content in mice. Proc Natl Acad Sci U S A. 2002;99:625–30. 36. Tordjman J, Chauvet G, Quette J, Beale EG, Forest C, Antoine B. Thiazolidinediones block fatty acid release by inducing glyceroneogenesis in fat cells. J Biol Chem. 2003; 278:18785–90. 37. Frayn KN, Summers LKM. Substrate fluxes in skeletal muscle and white adipose tissue and their importance in the development of obesity. In: Kopelman PG, Stock MJ, eds. Clinical Obesity. Oxford: Blackwell Science; 1998, pp. 129 – 157. 38. Fielding PE, Fielding CJ. Dynamics of lipoprotein transport in the human circulatory system. In: Vance DE, Vance J, eds. Biochemistry of Lipids, Lipoproteins and Membranes. Amsterdam: Elsevier; 1996, pp. 495–516. 39. Haemmerle G, Zimmermann R, Strauss JG, et al. Hormone-sensitive lipase deficiency in mice changes the plasma lipid profile by affecting the tissue-specific expression pattern of lipoprotein lipase in adipose tissue and muscle. J Biol Chem. 2002;277:12946 –52. 40. Levak-Frank S, Hofmann W, Weinstock PH, et al. Induced mutant mouse lines that express lipoprotein lipase in cardiac muscle, but not in skeletal muscle and adipose tissue, have normal plasma triglyceride and high-density lipoproteincholesterol levels. Proc Natl Acad Sci U S A. 1999;96:3165– 70. 41. Winder WW, Hardie DG. AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes. Am J Physiol. 1999;277:E1–10. 42. Saha AK, Avilucea PR, Ye JM, Assifi MM, Kraegen EW, Ruderman NB. Pioglitazone treatment activates AMPactivated protein kinase in rat liver and adipose tissue in vivo. Biochem Biophys Res Commun. 2004;314:580 –5. 43. Guan HP, Li Y, Jensen MV, Newgard CB, Steppan CM, Lazar MA. A futile metabolic cycle activated in adipocytes by antidiabetic agents. Nat Med. 2002;8:1122– 8. 44. Ruderman NB, Park H, Kaushik VK, et al. AMPK as a metabolic switch in rat muscle, liver and adipose tissue after exercise. Acta Physiol Scand. 2003;178:435– 42. 45. Zimmermann R, Haemmerle G, Wagner EM, Strauss JG, Kratky D, Zechner R. Decreased fatty acid esterification compensates for the reduced lipolytic activity in hormonesensitive lipase-deficient white adipose tissue. J Lipid Res. 2003;44:2089 –99. 46. Shimada M, Shimano H, Gotoda T, et al. Overexpression of human lipoprotein lipase in transgenic mice. Resistence to diet-induced hypertriglyceridemia and hypercholesterolemia. J Biol Chem. 1993;268:17924 –9. 47. Carneheim C, Nedergaard J, Cannon B. Beta-adrenergic stimulation of lipoprotein lipase in rat brown adipose tissue OBESITY RESEARCH Vol. 13 No. 5 May 2005

843


during acclimation to cold. Am J Physiol. 1984;246:E327–33. 48. Zhou Y-T, Shimabukuro M, Koyama K, et al. Induction by leptin of uncoupling protein-2 and enzymes of fatty acid oxidation. Proc Natl Acad Sci U S A. 1997;94:6386 –90. 49. Zhou Y-T, Wang Z-W, Higa M, Newgard CB, Unger RH. Reversing adipocyte differentiation: Implications for treatment of obesity. Proc Natl Acad Sci U S A. 1999;96:2391–5. 50. Chen G, Koyama K, Yuan X, et al. Disappearance of body fat in normal rats induced by adenovirus-mediated leptin gene therapy. Proc Natl Acad Sci U S A. 1996;93:14795–9.

844


51. Wang YX, Lee CH, Tiep S, et al. Peroxisome-proliferatoractivated receptor delta activates fat metabolism to prevent obesity. Cell. 2003;113:159 –70. 52. Cederberg A, Gronning LM, Ahren B, Tasken K, Carlsson P, Enerback S. FOXC2 is a winged helix gene that counteracts obesity, hypertriglyceridemia, and diet-induced insulin resistance. Cell. 2001;106:563–73. 53. Tiraby C, Tavernier G, Lefort C, et al. Acquirement of brown fat cell features by human white adipocytes. J Biol Chem. 2003;278:33370 – 6.