Triticum aestivum L.

Download PDF
2 downloads 0 Views 642KB Size Report
Comment
Jun 30, 2011 - tent cells of the yeast train Y187 via LiAc-mediated transformation .... genes, WEREWOLF (WER) and GLABROUS1 (GL1), which are involved ...
Gene 485 (2011) 146–152

Contents lists available at ScienceDirect

Gene j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / g e n e

Identification of a MYB3R gene involved in drought, salt and cold stress in wheat (Triticum aestivum L.) Hongsheng Cai, Shan Tian, Changlai Liu, Hansong Dong ⁎ Ministry of Agriculture of R. P. China Key Laboratory of Monitoring and Management of Crop Pathogens and Insect Pests, Nanjing Agricultural University, Nanjing, 210095, China

a r t i c l e

i n f o

Article history: Accepted 18 June 2011 Available online 30 June 2011 Received by A.J. van Wijnen Keywords: Abiotic stress MYB transcription activator Wheat Triticum aestivum L TaMYB3R1 ABA-inducible

a b s t r a c t Abiotic stress seriously affects crop growth and productivity. To better understand the mechanisms plant uses to cope with drought, cold and salt stress, it is necessary to isolate and characterize important regulators response to these stresses. In this study, we cloned a MYB gene from wheat (Triticum aestivum L.) and designated it as TaMYB3R1 based on its conserved three repeats in MYB domain. The sequence of TaMYB3R1 protein shares high identity to other plant MYB3R proteins. Subcellular localization experiment in onion epidermal cells proved that TaMYB3R1 localized in the nucleus. Trans–activation essays in yeast cells confirmed that TaMYB3R1 was a transcriptional activator, and only C-terminal region was able to activate the expression of β-galactosidase. DNA-binding test showed the MSA cis element-binding activity of TaMYB3R1. After exogenous application of phytohormone ABA, the expression of TaMYB3R1 was induced, and its transcripts accumulated up to 24 h; this is also the case for MeJA treatment, but after it peaked at 4 h, it decreased to low levels. However, either SA or ET had no obvious effect on the expression of TaMYB3R1. Furthermore, the TaMYB3R1 was initially expressed at low levels and was gradually induced following treatment with salt, and continued to increase up to 72 h. This was similar for the cold treatment. In contrast, the peak appeared at 6 h of the PEG treatment, and then gradually decreased to low levels. Our results suggest that TaMYB3R1 is potentially involved in wheat response to drought, salt and cold stress. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Drought, salt and low temperature are major environmental factors determining plant growth and productivity (Mittler and Blumwald, 2010; Yamaguchi-Shinozaki and Shinozaki, 2006). Upon exposure to abiotic stress conditions, plants adopt appropriate strategies with altered metabolism, growth and development. This is conducted by an elaborate and complicated regulatory circuit including stress sensors, signaling pathways and output proteins or metabolites (Knight and Knight, 2001). Among these processes, regulation at transcriptional level plays a very important role for plants to adapt to the environment changes (Singh et al., 2002). Many members of ethylene-responsiveelement-binding factors (ERF), basic-domain leucine-zipper (bZIP) and MYB transcription factor families are involved in regulating the stress responses (Jin and Martin, 1999; Singh et al., 2002; Stracke et al., 2001). The MYB transcription factors constitute one of the largest plant transcription factor families, and are characterized by conserved DNA-

Abbreviations: ABA, abscisic acid; EMSA, electrophoretic mobility shift assays; ET, ethylene; GFP, Green fluorescent protein; JA, jasmonate acid; ONPG, o-nitrophenyl-β-Dgalactopyranoside; ORF, open reading frame; RACE, rapid amplification of cDNA ends; SA, salicylic acid; X-gal, 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside. ⁎ Corresponding author. Tel.: + 86 25 84399006, + 86 25 13813928425; fax: + 86 25 84396246. E-mail address: [email protected] (H. Dong). 0378-1119/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2011.06.026

binding domain (referred as MYB domain) of about 53 amino acids (Riechmann et al., 2000; Stracke et al., 2001). MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain: MYB3R (three repeats), R2R3-type MYB (two repeats), and MYB1R (one repeat) which is also referred as “MYBrelated” (Jin and Martin, 1999; Rosinski and Atchley, 1998). The MYB4R proteins which contain four MYB repeats were also found, but little is known about their functions in plants (Dubos et al., 2010). R2R3-type MYB genes constitute the largest MYB gene subfamily in plants and play multifunctional roles in the regulation of gene expression. For instance, control of cell shape and morphogenesis (Herman and Marks, 1989; Lin and Schiefelbein, 2001; Oppenheimer et al., 1991); involvement in abiotic and biotic stress (Abe et al., 2003; Agarwal et al., 2006; Cominelli et al., 2005; Hermandez et al., 2007; Maeda et al., 2005; Mengiste et al., 2003; Miyake et al., 2003; Seo et al., 2009; Vannini et al., 2004); responses to salicylic acid (SA) ( Raffaele et al., 2006), abscisic acid (ABA) (Abe et al., 2003), gibberellic acid (GA) (Gocal et al., 1999; Murray et al., 2003) and jasmonate acid (JA) (Lee et al., 2001). MYB1R proteins which contain a single or partial repeat are fairly divergent and their functions were reported in the circadian clock (Schaffer et al., 2001), cellular morphogenesis (Simon et al., 2007) and also in secondary metabolism (Matsui et al., 2008). In contrast, MYB3R proteins constitute a rather small subfamily in plants. So far, only a few plant MYB3R genes have been identified. In Arabidopsis, five MYB3R genes have been reported and two structurally related genes MYB3R1 and MYB3R4 positively regulate

H. Cai et al. / Gene 485 (2011) 146–152

cytokinesis through activating G2/M phase-specific genes transcription (Braun and Grotewold, 1999; Haga et al., 2007). One MYB3R protein was identified in rice with a potential role in abiotic stresses (Dai et al., 2007). In tobacco, three MYB3R proteins have been reported to play roles in mediating G2/M phase transition (Ito et al., 2001). Wheat (Triticum aestivum L.) is one of the major crops as a stable food. The loss of production of wheat is seriously caused by abiotic stress such as drought and salt. Some of the genes involved in drought and salt stress have been previously isolated and characterized in wheat, including transcription factor TaERF3 (Zhang et al., 2007), TaAIDFa (Xu et al., 2008), SNF1-type serine/threonine protein kinase (Mao et al., 2009), Na+/H+ antiporter TNHX1 and H+-pyrophosphates TVP1 (Brini et al., 2005). However, none of MYB3R proteins functions in abiotic stress have yet been cloned in wheat. In order to better understand the mechanisms wheat uses to cope with drought, cold and salt stresses, it is necessary to isolate, characterize and functionally analyze the wheat regulators related to abiotic stress responses. In the present study, an ABA-inducible gene encoding for a novel member of the MYB proteins (TaMYB3R1) was isolated from T. aestivum. Bioinformatics analyses including sequence alignments and construction of phylogenetic trees were conducted. To investigate subcellular localization of TaMYB3R1, transient expression assay was done in onion epidermal cells. We further evaluated trans-activation ability using a yeast two-hybrid system and DNA-binding activity of TaMYB3R1. In addition, the expression patterns of the TaMYB3R1 gene in responses to phytohormones, also under drought, salt and cold abiotic stress were investigated.

2. Materials and methods

147

cold, under 4 °C conditions; drought and salt, seedlings were transferred to containers containing polyethylene glycol (PEG) 6000 solution with osmotic potential −0.50 MPa and 250 mM NaCl respectively. Seedlings were harvested after treatments with 0, 1, 3, 6, 12, 24, 48 and 72 h. Then quickly frozen in liquid nitrogen and stored at −70 °C. Control plants were harvested at the same time as the treated plants. 2.2. RNA extraction and first strand cDNA synthesis Total RNA from each treated sample was extracted using Trizol reagent (Invitrogen, USA) according to the manufacturer's instruction, and treated with RNase-free DNaseI (Promega, USA). First strand cDNA was synthesized with 2.5 μg of RNA per sample using the SuperscriptII First-Strand Synthesis Kit for Reverse transcription (RT)-PCR (Invitrogen, USA). 2.3. Cloning of the TaMYB3R1 gene from T. aestivum Total RNA was isolated from young seedlings as described above, a partial sequence of the MYB cDNA from wheat was used as a starting sequence to get full length cDNA. A pair of primers was designed, used for amplifying partial sequence of MYB gene in wheat, based on which genespecific primers were designed for 3′-rapid amplification of cDNA ends (3′-RACE) and 5′-RACE by using BD SMART™ RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer's instructions. Table 1 lists all the primers used in this study. The full length cDNA of TaMYB3R1 was obtained by PCR amplification using the forward and reverse primers. The PCR products were ligated into pMD19-T simple vector (Takara, Japan) and transformed into Escherichia coli competent cells strain DH5α and sequenced (Invitrogen, Shanghai, China).

2.1. Plant materials, growth conditions and treatments 2.4. Sequence and phylogenetic analysis of TaMYB3R1 gene Wheat (T. aestivum. L) cultivar Yangmai12 was used in this study. Wheat seeds were sterilized for 5 min with ethanol (70% v/v) and 15 min with NaOCI (30% v/v), followed by rinsing several times with sterile water. Germination was carried out by immersing in sterile water for 24 h. Geminated seeds were then transferred to sterile Murashige and Skoog (MS) medium, and grown at a 14/10 h day/night photoperiod, 25/18 °C day/night temperature, and 60% humidity. Seedlings at the two-leaf stage underwent different treatments with hormones and abiotic stress. For treatments with hormones: 1 mM SA, 0.1 mM MeJA, 0.1 mM ABA were used by spraying onto the aerial parts of seedlings, and ET released from 0.2 mM Ethephon, following the protocols described by Zhang et al. (2004). Seedlings were harvested after treatments with 0, 1, 2, 4, 12 and 24 h. For treatments with abiotic stress:

Alignments with amino acid sequences were performed by ClustalW program of software BioEdit. The phylogenetic trees were generated by MEGA software version 4.0 via the neighbor-joining (N-J) method with p-distance under the standard parameters. Bootstrap analysis was done with 1000 replicates. 2.5. Subcellular localization of TaMYB3R1-GFP fusion proteins The ORF of TaMYB3R1 gene without the termination codon was amplified by the PCR method using the forward and reverse primers. The confirmed sequence was then fused in frame to the expression vector pBI121 (Wang et al., 2009) at the 5′-terminal of the green fluorescent

Table 1 Primers used in this study. Gene

Primers

Use for

Actin

5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′

Real-time PCR

TaMYB3R1 GSP1 GSP2 TaMYB3R1 TaMYB3R1 Full ORF N-terminal C-terminal TaMYB3R1

CCTTCGTTTGGACCTTGCTG 3′ AGCTGCTCCTAGCCGTTTCC 3′ ACGAGAAAGACCGACACCTGC 3′ AACCCAGTGACAGAAAGGAAGCA 3′ ACGGAAAGATGCTTGGACTGCC 3′ GGTTCCTATCCATTTCTTTTTTACC 3′ CAGGTGTCGGTCTTTCTCGTTT 3′ GTGGTCAATGGCTCTGCTGTTA 3′ GCTCTAGAATGGGGGCCATGGCG 3′ CGGGATCCGGCTACATCCATGTTTGTCGTATAC 3′ GGCATATGGGGGCCATGGCG 3′ CGGGATCCTTAGGCTACATCCATGTTTGTCGTA 3′ GGCATATGGGGGCCATGGCG 3′ GGGATCCTTATAACTTCTTTCTCAAAGAACTATTCCAA 3′ GGCATATGAGCCTTGGTCCTCTTTGTTACC 3′ CGGGATCCTTAGGCTACATCCATGTTTGTCGTA 3′ CCGAGCTCATGGGGGCCATGGCG 3′ CCAAGCTTGGCTACATCCATGTTTGTCGTATAC 3′

Real-time PCR 3′RACE 5′RACE RT-PCR Subcellular localization Trans-activity assay Trans-activity assay Trans-activity assay Prokaryote expression

148

H. Cai et al. / Gene 485 (2011) 146–152

protein (GFP) under the drive of 35S promoter of Cauliflower mosaic virus (CaMV). The recombinant construction of 35S::TaMYB3R1-GFP was transformed into competent cells of Agrobacterium tumefaciens strain EHA105. Agrobacterium-mediated transient expression of 35S:: TaMYB3R1-GFP and 35S::GFP as a control in onion epidermal cells were performed according to the method described by Sun et al. (2010). The GFP fluorescent image was observed under an Olympus DH2-REL-T3 microscope (Leica, Germany) using 365-nm excitation, a 396-nm chromatic beam splitter and a 420-nm barrier filter. 2.6. Transcription activation activity analysis in yeast Trans-activation activity test was performed using the MATCHMAKER GAL4 Two-Hybrid System. Full length ORF of TaMYB3R1, N-terminal region with MYB domains and C-terminal region without MYB domains were separately cloned into pGBKT7 vector by NdeI and BamHI restriction sites downstream of the gene encoding GAL4 DNA-binding domain. The recombinant vectors were each transformed into competent cells of the yeast train Y187 via LiAc-mediated transformation method (Clontech, Japan). Y187 harbors the LacZ reporter gene (encoding β-galactosidase) under the control of the GAL4 upstream activation sequence and TATA boxes. The β-galactosidase activity was tested using 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Clontech, Japan) as a substrate for the colony-lift filter assay. Also, onitrophenyl-β-D-galactopyranoside (ONPG, Clontech, Japan) was used as a substrate for quantitative assay using liquid cultures of Y187 cells according to the manufacturer's instruction (Clontech, Japan). 2.7. In vitro MSA cis-element-binding assay The coding sequence of TaMYB3R1 was amplified by PCR and subcloned in frame to 3′-terminus of the coding region of His tag in the pET30a(+) vector (Novagen, Germany). The primers used were list in Table 1. The His-TaMYB3R1 fusion protein was induced in strain BL21 (DE3) of E. coli and purified by using His Trap HP (Amersham Biosciences). Electrophoretic mobility shift assays (EMSA) were conducted by the protocol of Huang and Wu (2004). Binding reactions (15 μl) containing 800 ng of probe and 5 μg of the purified protein, mixed with binding buffer. The sequences of MSA (core: AACGG) and mutant MSA (mMSA) probes were 5′-AATACCAGTCCCCAACGGCTAGTTTCAACC-3′, 5′-GGTTGAAACTAGCCGTTGGGGACTGGTATT-3′ and 5′-AATACCAGTCCCCAAttGCTAGTTTCAACC-3′, 5'-GGTTGAAACTAGCAATTGGGGACTGGTATT-5' respectively.

sequence, reverse transcription (RT)-PCR and RACE strategies were used to get the full length cDNA of the MYB gene. We designated the confirmed wheat MYB gene TaMYB3R1 and its sequence has been deposited in the National Centre for Biotechnology Information (NCBI) database with the accession number HQ236494. ScanProsite program (www.expasy.org) and sequence analysis indicate that the gene belongs to MYB3R subfamily of MYB gene family. It encodes a 604 amino acid protein. Multiple sequence alignments of TaMYB3R1 with other MYB3R proteins in some plant species showed that it had the conserved R1, R2 and R3 repeats which were the typical characteristic of the MYB3R proteins (Fig. S1A). In order to understand the evolutionary relationship between plant MYB3R, plant R2R3-type MYB and animal MYB3R proteins, phylogenetic trees based on the conserved MYB repeats were constructed (Fig. S1B). As presented in the tree, TaMYB3R1 and other plant MYB3R proteins shared more identities with each other than with other MYB proteins and therefore were grouped as a branch. In addition, plant MYB3R and animal MYB proteins had a closer relationship than plant R2R3-type MYB proteins, which indicated that MYB3R proteins had conserved functions and were universal in both animals and plants. Moreover, we tested TaMYB3R1 expression pattern in various tissues by semi-quantitative reverse transcription (RT)-PCR and quantitative realtime PCR (Q-RT-PCR) methods. The results indicated that TaMYB3R1 expressed in all organs, but the highest level was in stem and lowest level in root (Fig. 1). 3.2. Nuclei localization of TaMYB3R1 protein To investigate the subcellular localization of TaMYB3R1, transient expression vector was constructed. Compared with the 35S::GFP construct, which was detected both in the nucleus and cytoplasm, the 35S::TaMYB3R1-GFP fusion protein was localized exclusively in the nucleus in onion epidermal cells (Fig. 2). This observation indicated that TaMYB3R1 was a putative nuclei-localized transcription factor. 3.3. Trans-activation activity of TaMYB3R1 protein To examine whether TaMYB3R1 has trans-activation activity, a yeast two-hybrid system was used. In the colony-lift filter assay, the yeast strain transformed with the full length ORF of TaMYB3R1 had higher β-

2.8. Expression analysis of TaMYB3R1 gene by quantitative real-time PCR Wheat gene expression was determined by quantitative real-time PCR protocols (Q-RT-PCR) (Wu et al., 2010) as described previously. QRT-PCR was conducted using the ABI PRISM 7500 sequence detection system. An established quantitative method (Livak and Schmittgen, 2001) was adopted in Q-RT-PCR. The actin gene which expressed constitutively in wheat (Okubara et al., 2002) was used as an internal control to normalize all data. Primers used for transcript analysis of TaMYB3R1 were listed in Table 1. In PCR reaction, the 20 μl reaction mixture was composed of 10 ng cDNA per sample, 0.2 μM of each primer and 1× SYBR Premix Ex Taq (Takara, Japan) and 1× Rox Reference DyeII. The two step thermal cycling used was: 95 °C for 1 min, followed by 40 cycles of 5 s at 95 °C, 30 s at 60 °C. All reactions were performed in triplicate. 3. Results 3.1. Isolation and sequence analysis of a MYB gene from T. aestivum In a previous study (unpublished), we identified a fragment of a MYB3R gene from wheat EST database. Based on the 608 bp fragment

Fig. 1. TaMYB3R1 expression pattern in various tissues. A. Detection of TaMYB3R1 transcripts by Q-RT-PCR methods. The wheat β-actin gene was used as an internal control. Data represent means and bar indicates standard error. B. Detection of TaMYB3R1 transcripts by semi-quantitative PCR.

H. Cai et al. / Gene 485 (2011) 146–152

149

Fig. 2. Localization of the TaMYB3R1 protein. Only green fluorescent protein (GFP) and TaMYB3R1-GFP fusion protein were observed with onion peels after transformation by the Agrobacterium tumefaciens.

galactosidase activity compared with the negative control (Fig. 3A). This result was also observed at the C-terminal region of TaMYB3R1, whereas the N-terminal region of TaMYB3R1 (which is a DNA-binding domain) showed no β-galactosidase activity. This was further confirmed by the quantitative assay of β-galactosidase activity (Fig. 3B).

3.4. MSA cis-element-binding activity of TaMYB3R1 protein Previous reports suggest that both animal and plant MYB3R proteins bind to the MSA cis-elements. To verify DNA-binding characteristic of TaMYB3R1, we conducted the EMSA experiment. TaMYB3R1 showed the ability to bind to MSA cis-element, but not to the mMSA (mutated in the core sequence) (Fig. 4). This result demonstrates that TaMYB3R1 is capable of binding to MSA cis-element. 3.5. Expression pattern of TaMYB3R1 response to phytohormones To examine the roles of TaMYB3R1 in regulating plant growth and development, we tested the transcript expression using Q-RT-PCR after exogenous application of phytohormones (Fig. 5). ABA modulates numerous physiological processes in plants especially for its regulatory

Fig. 3. Trans-activation activity assay of TaMYB3R1 protein. Full length ORF TaMYB3R1 (1–604), N-terminal region TaMYB3R1(1–220) with MYB domains and C-terminal region (221–604) without MYB domains were separately cloned into pGBKT7 vector under downstream of the gene encoding GAL4 DNA-binding domain. Murine-53 (T7 + 53) was used as a positive control and yeast cells contain only pGBKT7 vector as a negative control. β-galactosidase activity was tested using colony-lift filter assay (A) and liquid culture assay (B).

Fig. 4. Using MSA, mMSA as probes and purified His-TaMYB3R1 protein, EMSA showing the specific binding of TaMYB3R1 to MSA cis-element. Arrows on the left indicate the retarded band and free probe.

150

H. Cai et al. / Gene 485 (2011) 146–152

Fig. 5. Expression pattern of the TaMYB3R1 gene under treatments with different phytohormones. phytohormones salicylic acid (SA) 1 mM, methyl jasmonate (MeJA) 0.1 mM, ABA 0.1 mM and ethylene released from 0.2 mM ethephon were used for the analysis. The TaMYB3R1 transcript expression was determined after treatments for 0, 1, 2, 4, 12, 24 h. The wheat β-actin gene was used as an internal control. Data represent means and bar indicates standard error.

roles in abiotic stress tolerance (Pastori and Foyer, 2002). Salicylic acid (SA) acts as a central regulator for plants to defense the biotrophic or hemibiotrophic pathogens, whereas jasmonic acid (JA) and ethylene (ET) cooperate as signal molecules in defence of necrotrophic pathogens and insect attack (Thomma et al., 1998). We found that the TaMYB3R1 transcript expression was induced following treatment with ABA. The TaMYB3R1 transcripts slowly accumulated up to 4 h, then rapidly reached a high level at 12 h and continued to accumulate up to 24 h. A similar induced expression pattern was also observed under the MeJA treatment, but after peaked at 4 h, it decreased to low levels. However, it seemed that either SA or ET had no obvious effect on the expression of TaMYB3R1. Our results indicated that the TaMYB3R1 might participate in the functional processes of phytohormones ABA and MeJA. 3.6. Expression pattern of TaMYB3R1 response to abiotic stress As the TaMYB3R1 is a new member of wheat MYB gene family, we searched the NCBI non-redundant protein database using the blastp program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The results showed it had a 71% identity to the rice OsMYB3R2. This gene has been reported to play important roles in regulating responses to cold, salt and drought stress (Dai et al., 2007). So we further examined the cold, drought and salt stress on the expression of TaMYB3R1 gene (Fig. 6). The TaMYB3R1 was initially expressed at low levels and was gradually induced following treatment with salt, and continued to increase up to 72 h. This was similar for the cold treatment. In contrast, the peak appeared at 6 h of the PEG treatment, and then gradually decreased to low levels. This may be because the seedlings under persistent PEG conditions cannot survive very long. Our results, therefore, suggested that the TaMYB3R1 gene was probably involved in responding to drought, salt and cold stress. 4. Discussion Transcription factors are of importance for plants to adapt to the environmental changes (Chen and Zhu, 2004). The MYB gene superfamily has versatile functions in plants (Dubos et al., 2010). In this study, a novel MYB gene was isolated from wheat by RT-PCR and RACE strategies. Bioinformatics analyses revealed that it contained R1, R2 and R3 MYB domain repeats and was a typical MYB3R protein. The first MYB gene was v-Myb oncogene identified from the avian myeloblastosis virus (Klempnauer et al., 1982). We searched the NCBI public database using the blastp program with the whole deduced protein TaMYB3R1 sequence, the results showed that it had a 71% identity to OsMYB3R2 from rice (Oryza sativa Japonica) and a 67% identity to NP_001151448 from maize (Zea mays). We further aligned

Fig. 6. Expression pattern of the TaMYB3R1 gene under different abiotic stress. The TaMYB3R1 transcript expression under drought (0.5 MPa PEG6000), salt (250 mM NaCl) and cold (4 °C) stress conditions were analyzed after treatments for 0, 1, 3, 6, 12, 24, 48, 72 h. The wheat β-actin gene was used as an internal control. Data represent means and bar indicates standard error.

the plant MYB3R domain repeats using the ClustalW program, it showed high identities among plant species. MYB proteins are characterized by the presence of one, two or three MYB motifs, each of which contains three α-helices, they play roles in binding to a short DNA sequence (Rabinowicz et al., 1999). However, despite the close relationship between the MYB domains, they can be extremely divergent outside of the MYB domains (Rosinski and Atchley, 1998), which influence the functions of MYB proteins. Many MYB proteins share a great deal of sequence similarities especially in conserved MYB domains, an interesting question has been put forward whether this sequence similarities can account for their functional redundancy. A reverse genetic approach was adopted to further investigate the functions of MYB proteins in Arabidopsis. A total of 47 insertions among 36 members of R2R3-type MYB gene family were isolated, none of the insertions give rise to visible morphological phenotype in soil-grown conditions (Meissner et al., 1999). Phylogenetic trees were constructed with whole amino acids sequences, except for the conserved MYB domains, there are also other specific domains were detected in each subgroup based on bioinformatics analysis (Jiang et al., 2004b), this may give hints to functional similarities. Two MYB genes, WEREWOLF (WER) and GLABROUS1 (GL1), which are involved in the regulation of trichome and root hair development respectively in Arabidopsis, are functionally equivalent proteins confirmed by reciprocal complementation experiments despite their distinct expression pattern (Lee and Schiefelbein, 2001). AtMYB11, AtMYB12 and AtMYB111

H. Cai et al. / Gene 485 (2011) 146–152

belong to R2R3-type MYB subgroup 7 factors, they have same target genes for flavonol biosynthesis (Stracke et al., 2007). AtMYB68 and AtMYB84 have close sequence similarities, they exhibit an overlapping expression pattern in pericycle cells, suggesting that their functions may be partly redundant. However, further evidences need to be provided (Feng et al., 2004). Transcription factors can be either activators or repressors. Our transcription activation assays in yeast cells confirmed that TaMYB3R1 was a MYB transcription activator. Only the C-terminal region was capable of activating the expression of β-galactosidase. Further subcellular localization assays demonstrated that it was a nuclei-targeting MYB transcription activator. In Arabidopsis, the expression profiles of 163 MYB genes were tested for their responses to the phytohormones and stress conditions (Chen et al., 2006). In order to understand the potential roles of TaMYB3R1 gene in wheat, we studied the expression pattern of TaMYB3R1 in response to phytohormones. An increase of transcript expression of TaMYB3R1 was found after either ABA or MeJA application, therefore we also tested expression pattern of TaMYB3R1 in response to abiotic stress. Our results showed that under cold, drought and salt stress, the TaMYB3R1 gene was up-regulated, and its expression remained high for both cold and salt stress. This and the high similarity index with the OsMYB3R2 gene in rice, suggests that TaMYB3R1 may participate in abiotic stress regulation in wheat. Most plant MYB proteins belong to R2R3-type subfamily, which have diverse roles in plant growth and development compared to the conserved roles of MYB3R proteins both in animals and plants. A hypothesis was proposed that R2R3-type genes have evolved from an MYB3R ancestor gene by loss of R1 repeat sequence and subsequently expansion of the gene family (Rosinski and Atchley, 1998). However, a gain model that MYB3R genes were derived from R2R3-type genes by gain of the R1 repeat through an ancient intragenic duplication was supported by a comprehensive phylogenetic analysis of MYB proteins (Jiang et al., 2004a). MYB3R proteins occur in different plant evolutionary lineages including mosses, ferns and monocots (Kranz et al., 2000). The conserved domains of MYB3R proteins found in plants are more closely related to the vertebrate MYB domains than to the domains from plant R2R3-MYB proteins (Ito, 2005). Therefore, MYB proteins with three MYB domains seem to play a conserved evolutionary role. Our phylogenic trees confirm that TaMYB3R1 belongs to the plant MYB3R group, and is more closely related to MYB proteins from animals than R2R3-MYB proteins from plants. This indicates a conserved role of TaMYB3R1 in wheat. MYB3R proteins are found in animals, plants and fungus. Most of which identified yet have been suggested involved in mediating the cell cycle process. Mammalian MYB proteins were believed in the roles not only at the G1/S transition (Lipsick, 1996) but also in the transcription of the cyclin B gene (Okada et al., 2002; Zhu et al., 2004). Tobacco NtmybA1 and NtmybA2 regulate transcription of G2/M phase-specific genes CYCB1 and NACK1 by binding the MSA elements which located in the promoter regions of these genes (Ito et al., 2001). In Arabidopsis, two homologs of NtmybA1 and NtmybA2, MYB3R1 and MYB3R4 play partially redundant roles in positively regulating cytokinesis through activating the KN gene, which contains the MSA elements (Haga et al., 2007). Rice OsMYB3R2 targets MSA elements containing gene CYCB1;1 and regulate the cell cycle process during chilling stress (Ma et al., 2009). Our DNA-binding test also confirmed the MSA-binding activity of wheat TaMYB3R1. Most cyclin genes containing MSA elements in their promoters, thus the MSA elementbinding R1R2R3-MYB proteins play the universal roles in regulating the genes in cell cycle control. Regulators of cell cycle affect both cell cycle duration and cell division numbers and the latter is the major determinant of overall plant growth rate (West et al., 2004). As the sessile nature, plants have developed intricate mechanisms to modulate their development with the environmental conditions. MYB3R proteins likely function as environmental responses modulators through regulation of cell cycle

151

process, and further study need to be conducted to illustrate the roles of TaMYB3R1 in plant development and also under environmental stresses. Supplementary materials related to this article can be found online at doi:10.1016/j.gene.2011.06.026. Acknowledgments This study was supported by grants from the National Science Foundation (30771441 and 30525008), the National Development Plan of Key Basic Scientific Studies (973 Plan 2006CB101902), and the Novel Transgenic Organisms Breeding Project (2009ZX08002-004B and 2008ZX08002-001) in China. References Abe, H., Urao, T., Ito, T., Seki, M., Shinazaki, K., Yamaguchi-Shinozaki, K., 2003. Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15, 63–78. Agarwal, M., et al., 2006. A R2R3 type MYB transcription factor is involved in the cold regulation of CBF genes and in acquired freezing tolerance. J. Biol. Chem. 281, 37636–37645. Braun, E.L., Grotewold, E., 1999. Newly discovered plant c-myb-like genes rewrite the evolution of the plant myb gene family. Plant Physiol. 121, 21–24. Brini, F., Gaxiola, R.A., Berkowitz, G.A., Masmoudi, K., 2005. Cloning and characterization of a wheat vacuolar cation/proton antiporter and pyrophosphatase proton pump. Plant Physiol. Biochem. 43, 347–354. Chen, W.J., Zhu, T., 2004. Networks of transcription factors with roles in environmental stress response. Trends Plant Sci. 9, 591–596. Chen, Y.H., et al., 2006. The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol. Biol. 60, 107–124. Cominelli, E., et al., 2005. A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. Curr. Biol. 15, 1196–1200. Dai, X., et al., 2007. Overexpression of an R1R2R3 MYB gene, OsMYB3R-2, increases tolerance to freezing, drought, and salt stress in transgenic Arabidopsis. Plant Physiol. 143, 1739–1751. Dubos, C., Stracke, R., Grotewold, E., Weisshaar, B., Martin, C., Lepiniec, L., 2010. MYB transcription factors in Arabidopsis. Trends Plant Sci. 15, 573–581. Feng, C.P., Andreasson, E., Maslak, A., Mock, H.P., Mattsson, O., Mundy, J., 2004. Arabidopsis MYB68 in development and responses to environmental cues. Plant Sci. 167, 1099–1107. Gocal, G.F., Poole, A.T., Gubler, F., Watts, R.J., Blundell, C., King, R.W., 1999. Long-day upregulation of a GAMYB gene during Lolium temulentum inflorescence formation. Plant Physiol. 119, 1271–1278. Haga, N., et al., 2007. R1R2R3-Myb proteins positively regulate cytokinesis through activation of KNOLLE transcription in Arabidopsis thaliana. Development 134, 1101–1110. Herman, P.L., Marks, M.D., 1989. Trichome development in Arabidopsis thaliana.II. Isolation and complementation of the GLABROUS1 Gene. Plant Cell 1, 1051–1055. Hermandez, G., et al., 2007. Phosphorus stress in common bean: root transcript and metabolic responses. Plant Physiol. 144, 752–767. Huang, W., Wu, Q., 2004. The ManR specifically binds to the promoter of a Nramp transporter gene in Anabaena sp. PCC 7120: a novel regulatory DNA motif in cyanobacteria. Biochem. Biophys. Res. Commun. 317, 578–585. Ito, M., 2005. Conservation and diversification of three-repeat Myb transcription factors in plants. J. Plant Res. 118, 61–69. Ito, M., et al., 2001. G2/M-phase-specific transcription during the plant cell cycle is mediated by c-Myb-like transcription factors. Plant Cell 13, 1891–1905. Jiang, C., Gu, J., Chopra, S., Gu, X., Peterson, T., 2004a. Ordered origin of the typical twoand three-repeat Myb genes. Gene 326, 13–22. Jiang, C., Gu, X., Peterson, T., 2004b. Identification of conserved gene structures and carboxy-terminal motifs in the Myb gene family of Arabidopsis and Oryza sativa L. ssp. Indica. Genome Biol. 5, R46. Jin, H., Martin, C., 1999. Multifunctionality and diversity within the plant MYB-gene family. Plant Mol. Biol. 41, 577–585. Klempnauer, K.H., Gonda, T.J., Bishop, J.M., 1982. Nucleotide sequence of the retroviral leukemia gene v-myb and its cellular progenitor c-myb: the architecture of a transduced oncogene. Cell 31, 453–463. Knight, H., Knight, M.R., 2001. Abiotic stress signalling pathways: specificity and crosstalk. Trends Plant Sci. 6, 262–267. Kranz, H., Scholz, K., Weisshaar, B., 2000. c-MYB oncogene-like genes encoding three MYB repeats occur in all major plant lineages. Plant J. 21, 231–235. Lee, M.M., Schiefelbein, J., 2001. Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis. Development 128, 1539–1546. Lee, M.W., Qi, M., Yang, Y., 2001. A novel jasmonic acid-inducible rice myb gene associates with fungal infection and host cell death. Mol. Plant Microbe Interact. 14, 527–535. Lin, Y., Schiefelbein, J., 2001. Embryonic control of epidermal cell patterning in the root and hypocotyls of Arabidopsis. Development 128, 3697–3705. Lipsick, J.S., 1996. One billion years of Myb. Oncogene 13, 223–235.

152

H. Cai et al. / Gene 485 (2011) 146–152

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402–408. Ma, Q., et al., 2009. Enhanced tolerance to chilling stress in OsMYB3R-2 transgenic rice is mediated by alteration in cell cycle and ectopic expression of stress genes. Plant Physiol. 150, 244–256. Maeda, K., Kimura, S., Demura, T., Takeda, J., Ozeki, Y., 2005. DcMYB1 acts as a transcriptional activator of the carrot phenylalanine ammonia-lyase gene (DcPAL1) in response to elicitor treatment, UV-B irradiation and the dilution effect. Plant Mol. Biol. 59, 739–752. Mao, X., Zhang, H., Tian, S., Chang, X., Jing, R., 2009. TaSnRK2.4, an SNF1-type serine/ threonine protein kinase of wheat (Triticum aestivum L.), confers enhanced multistress tolerance in Arabidopsis. J. Exp. Bot. 61, 683–696. Matsui, K., Umemura, Y., Ohme-Takagi, M., 2008. AtMYBL2, a protein with a single MYB domain, acts as a negative regulator of anthocyanin biosynthesis in Arabidopsis. Plant J. 55, 954–967. Meissner, R.C., et al., 1999. Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes. Plant Cell 11, 1827–1840. Mengiste, T., Chen, X., Salmeron, J., Dietrich, R., 2003. The BOTRYTIS SUSCEPTIBLE1 gene encodes an R2R3MYB transcription factor protein that is required for biotic and abiotic stress responses in Arabidopsis. Plant Cell 15, 2551–2565. Mittler, R., Blumwald, E., 2010. Genetic engineering for modern agriculture: challenges and perspectives. Annu. Rev. Plant Biol. 61, 443–462. Miyake, K., et al., 2003. Isolation of a subfamily of genes for R2R3-MYB transcription factors showing up-regulated expression under nitrogen nutrient-limited conditions. Plant Mol. Biol. 53, 237–245. Murray, F., Kalla, R., Jacobsen, J., Gubler, F., 2003. A role for HvGAMYB in anther development. Plant J. 33, 481–491. Okada, M., Akimaru, H., Hou, D.X., Takahashi, T., Ishii, S., 2002. Myb controls G(2)/M progression by inducing cyclin B expression in the Drosophila eye imaginal disc. EMBO J. 21, 675–684. Okubara, P.A., Blechl, A.E., McCormick, S.P., Alexander, N.J., Dill-Macky, R., Hohn, T.M., 2002. Engineering deoxynivalenol metabolism in wheat through the expression of a fungal trichothecene acetyltransferase gene. Theor. Appl. Genet. 106, 74–83. Oppenheimer, D.G., Herman, P.L., Sivakumaran, S., Esch, J., Marks, M.D., 1991. A myb gene required for leaf trichome differentiation in Arabidopsis is expressed in stipules. Cell 67, 483–493. Pastori, G.M., Foyer, C.H., 2002. Common components, networks, and pathways of cross-tolerance to stress. The central role of "redox" and abscisic acid-mediated controls. Plant Physiol. 129, 460–468. Rabinowicz, P.D., Braun, E.L., Wolfe, A.D., Bowen, B., Grotewold, E., 1999. Maize R2R3 Myb genes: sequence analysis reveals amplification in the higher plants. Genetics 153, 427–444. Raffaele, S., Rivas, S., Roby, D., 2006. An essential role for salicylic acid in AtMYB30mediated control of the hyposensitive cell death program in Arabidopsis. FEBS Lett. 580, 3498–3504.

Riechmann, J.L., et al., 2000. Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290, 2105–2110. Rosinski, J.A., Atchley, W.R., 1998. Molecular evolution of the Myb family of transcription factors: evidence for polyphyletic origin. J. Mol. Evol. 46, 74–83. Schaffer, R., Landgraf, J., Accerbi, M., Simon, V., Larson, M., Wisman, E., 2001. Microarray analysis of diurnal and circadian-regulated genes in Arabidopsis. Plant Cell 13, 113–123. Seo, P.J., et al., 2009. The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in Arabidopsis. Plant Physiol. 151, 275–289. Simon, M., Lee, M.M., Lin, Y., Gish, L., Schiefelbein, J., 2007. Distinct and overlapping roles of single-repeat MYB genes in root epidermal patterning. Dev. Biol. 311, 566–578. Singh, K., Foley, R.C., Onate-Sanchez, L., 2002. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 5, 430–436. Stracke, R., Werber, M., Weisshaar, B., 2001. The R2R3-MYB gene family in Arabidopsis thaliana. Curr. Opin. Plant Biol. 4, 447–456. Stracke, R., et al., 2007. Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling. Plant J. 50, 660–677. Sun, F., Liu, P.Q., Xu, J., Dong, H.S., 2010. Mutation in RAP2.6L, a transactivator of the ERF transcription factor family, enhances Arabidopsis resistance to Pseudomonas syringae. Physiol. Mol. Plant. P. 74, 295–302. Thomma, B.P., et al., 1998. Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc. Natl. Acad. Sci. U. S. A. 95, 15107–15111. Vannini, C., et al., 2004. Overexpression of the rice Osmyb4 gene increases chilling and freezing tolerance of Arabidopsis thaliana plants. Plant J. 37, 115–127. Wang, Y., Liu, R., Chen, L., Liang, Y., Wu, X., Li, B., Wu, J., Wang, X., Zhang, C., Wang, Q., Hong, X., Dong, H., 2009. Nicotiana tabacum TTG1 contributes to ParA1-induced signalling and cell death in leaf trichomes. J. Cell Sci. 122, 2673–2685. West, G., Inze, D., Beemster, G.T., 2004. Cell cycle modulation in the response of the primary root of Arabidopsis to salt stress. Plant Physiol. 135, 1050–1058. Wu, T., et al., 2010. Ectopic expression of the rice lumazine synthase gene contributes to defense responses in transgenic tobacco. Phytopathology 100, 573–581. Xu, Z.S., et al., 2008. Characterization of the TaAIDFa gene encoding a CRT/DRE-binding factor responsive to drought, high-salt, and cold stress in wheat. Mol. Genet. Genomics 280, 497–508. Yamaguchi-Shinozaki, K., Shinozaki, K., 2006. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biol. 57, 781–803. Zhang, H., et al., 2004. Tomato stress-responsive factor TSRF1 interacts with ethylene responsive element GCC box and regulates pathogen resistance to Ralstonia solanacearum. Plant Mol. Biol. 55, 825–834. Zhang, Z., Yao, W., Dong, N., Liang, H., Liu, H., Huang, R., 2007. A novel ERF transcription activator in wheat and its induction kinetics after pathogen and hormone treatments. J. Exp. Bot. 58, 2993–3003. Zhu, W., Giangrande, P.H., Nevins, J.R., 2004. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, 4615–4626.