Mycologia, 104(2), 2012, pp. 477–487. DOI: 10.3852/11-162 # 2012 by The Mycological Society of America, Lawrence, KS 66044-8897
Two new species of Pythium, P. schmitthenneri and P. selbyi pathogens of corn and soybean in Ohio Margaret L. Ellis Pierce A. Paul Anne E. Dorrance1
Lipps 1996, Rao et al. 1978, Yanar et al. 1997) as well as seed and seedling pathogens of both corn and soybean (Broders et al. 2007, 2009, Dorrance et al. 2004). In a series of studies 24 described species of Pythium were isolated from diseased seed and seedlings of corn and soybean in Ohio (Broders et al. 2007, 2009; Dorrance et al. 2004). During a recent survey of agronomic soils from 88 locations in Ohio an unidentified group of Pythium, designated Group 7 (G7), was recovered from 30% of the locations sampled with a high-throughput system of soil baiting, direct-colony polymerase chain reaction and single-strand conformational polymorphism (Broders et al. 2009). In this survey G7 was recovered from four major soil regions in the state where grain production predominates. These four soil regions were covered by ice during one or more glaciations, making the soils deep to bedrock. The bedrock is commonly limestone, dolomite and limy shales, which gives the soils in these regions relatively high amounts of lime (Ohio Department of Natural Resources: http://www.dnr.state.oh.us). Isolates within the G7 complex were identified in clay to clay-loam soils within each of these four regions but occasionally were found in fields with either high sand or high silt content (Broders 2008). In further analysis of G7 Koch’s postulates were established and a diverse set of isolates belonging to G7 were found to be moderately aggressive pathogens to both soybean and corn (Dorrance et al. unpubl data). The frequency and diverse distribution of this moderately pathogenic group of isolates throughout Ohio makes the characterization of this group a priority for the management of the Pythium complex affecting corn and soybeans. Isolates of Pythium designated as G7 were separated into two distinct subgroups based on morphology and sequence analysis of the ITS1-5.8S-ITS2 region of the ribosomal DNA, both belonging to clade E1 according to Levesque and de Cock (2004). The first group (G7-1) was most similar to P. acrogynum, P. hypogynum and P. rostratum based on morphology and in sequence analysis to P. acrogynum and P. hypogynum. The second group (G7-2) was most similar to P. longandrum and P. longisporangium based on both morphology and sequence analysis. The ITS1-5.8S-ITS2 region of G7-1 was 99.9% similar to P. acrogynum and 99.8% similar to P. hypogynum while only 82% similar to P. rostratum.
Department of Plant Pathology, Ohio State University, OARDC, Wooster, Ohio 44691
Kirk D. Broders Department of Biological Sciences, University of New Hampshire, Durham, New Hampshire 03824
Abstract: Two new species of Pythium, pathogens of corn and soybean in Ohio, are described. Pythium schmitthenneri sp. nov. and Pythium selbyi sp. nov. both have morphological and sequence characteristics that place them in clade E1 of the genus Pythium. Morphology and sequence analysis of the ITS1-5.8SITS2 regions of these species were different from previously described species. The ITS region of Pythium schmitthenneri was 99.9% similar to P. acrogynum and 99.8% similar to P. hypogynum. All three species are characterized by globose to limoniform sporangia and plerotic oospores. Pythium schmitthenneri has mostly diclinous antheridia, compared to the strictly hypogynous antheridia of P. acrogynum and P. hypogynum. The temperature for growth of P. schmitthenneri is below 4 C to 32 C, and optimum growth is 18–25 C compared to 31–34 C for P. hypogynum. The ITS region of P. selbyi was 97.1% similar to P. longandrum and 97.5% similar to P. longisporangium. All three species are characterized by globose sporangia, mostly plerotic oospores, with one to two oospores per oogonium, and hypogynous or monoclinous antheridia. The temperature for growth of P. selbyi is below 4 to 32 C, with an optimum 18–25 C. These new species were widely dispersed throughout the soybean- and corn-producing regions in Ohio, making their characterization critical for managing the Pythium complex that causes seedling and root-rot disease in Ohio soybean and corn fields. Key words: damping-off, globose sporangia, Glycine max, root rot, seedling disease, soilborne pathogen, Zea mays INTRODUCTION In Ohio Pythium species have been reported to be important root-rot pathogens of corn (Deep and Submitted 18 May 2011; accepted 21 Sep 2011. 1 Corresponding author. E-mail:
[email protected]
477
478
MYCOLOGIA
TABLE I. DNA sequence differences for the ITS region for Pythium schmitthenneri and Pythium selbyi with members within clade E1
Specifically G7-1 differs by one nucleotide from P. acrogynum and two nucleotides from P. hypogynum within the ITS2 region (TABLE I). All these species have mostly (sub)globose, non-proliferating sporangia and plerotic or nearly plerotic oospores. They differ on several key morphological characters. The discharge tubes for P. hypogynum are approximately twice the diameter of the sporangia (Middleton 1943, van der Plaats-Niterink 1981), while G7-1 has longer, narrower discharge tubes, which are two times greater than the length of the sporangia. Pythium acrogynum has ornamented oogonia (van der Plaats-Niterink 1981), while G7-1, P. hypogynum and P. rostratum, has smooth oogonial walls (Middleton 1943, van der Plaats-Niterink 1981). Both P. hypogynum and P. acrogynum have strictly hypogynous antheridial cells (Middleton 1943, van der Plaats-Niterink 1981) and G7-1 does not. Pythium rostratum has monoclinous and occasionally hypogynous antheridia (Middleton 1943, van der Plaats-Niterink 1981), while G7-1 has mostly diclinous, occasionally monoclinous and rarely hypogynous antheridia. In culture the mycelium of P. hypogynum has a radiate pattern on cornmeal agar. P. rostratum is submerged with a rosette pattern (Middleton 1943,
van der Plaats-Niterink 1981), and G7-1 is submerged on cornmeal agar with no distinct pattern. G7-1 mycelium also has a rosette to chrysanthemum pattern on potato-carrot agar (PCA) and P. rostratum has a chrysanthemum pattern (Middleton 1943, van der Plaats-Niterink 1981). G7-1 has relatively low maximum temperature (32 C) for growth compared to P. hypogynum, which reportedly has a maximum temperature of 37 C with traces of growth reported as high as 40 C, and P. rostratum has a maximum temperature of 35 C (Middleton 1943, van der PlaatsNiterink 1981). Pythium hypogynum grew faster, with optimum daily growth 16 mm at 34 C (Middleton 1943, van der Plaats-Niterink 1981) than G7-1 which grew at 13.5 mm at its optimum growth temperature at 21 C. The ITS region of G7-2 was 97.1% similar to P. longandrum and 97.5% similar to P. longisporangium. Specifically within the ITS1 and ITS2 region G7-2 differs by seven and 19 nucleotides from P. longandrum and nine and 14 nucleotides from P. longisporangium respectively (TABLE I). The morphology of G7-2 was most similar to P. longandrum and P. longisporangium, which along with G7-2 have globose to oval sporangia, smooth-walled oogonia that are
ELLIS ET AL.: NEW PYTHIUM terminal to intercalary with 1–2 oospores per oogonium. Pythium longandrum has plerotic and aplerotic oospores (Paul 2001), while P. longisporangium (Paul et al. 2005) and G7-2 have mostly plerotic oospores and occasionally aplerotic oospores. The antheridia of P. longandrum and P. longisporangium are either hypogynous or monoclinous (Paul 2001, Paul et al. 2005), while those of G7-2 are mostly hypogynous and only occasionally monoclinous. Pythium longandrum may possess some of the longest antheridia, 40–50 mm, described within the genus Pythium (Paul 2001), while G7-2 has antheridia that are approximately 50% smaller, 10–22 mm long and 6–13 mm wide. The size of antheridia of P. longisporangium was not included in the original description (Paul et al. 2005). Based on both the sequence and morphological analysis these two subgroups, previously designated G7, are herein described as two new species, Pythium schmitthenneri sp. nov. (G7-1) and Pythium selbyi sp. nov. (G7-2). MATERIALS AND
METHODS
Isolation.—All isolates were recovered from soils collected from fields in 11 counties in the corn- and soybeanproduction regions in Ohio 20 Jun–19 Jul 2006 and 7–25 June 2007. The isolates were recovered from diseased soybean and corn seedlings that were used in a baiting procedure as described by Broders et al. (2009). Pieces of symptomatic tissue were plated on PIBNC (Schmitthenner and Bhat 1994), an oomycete-specific medium. Hyphal tips from mycelia growing from diseased tissue were transferred to potato-carrot agar (PCA) (van der Plaats-Niterink 1981). Cultures were maintained on PCA slant vials at 10 C. Morphological structures were observed on PCA, cornmeal agar (Tuite 1969) and sterile grass blades floated in sterile water (distilled 2: rainwater 1) (Waterhouse 1967). A protocol using Chen’s and Zentmyer’s salt solution (Chen and Zentmyer 1970) was used to favor development of sporangia and zoospores for observations. Morphological characteristics were compared to original species descriptions from standard Pythium keys (Middleton 1943, Waterhouse 1968, van der Plaats-Niterink 1981) and descriptions of Pythium species from the E1 clade (Paul 1992, 2001, 2002, 2003, 2006, 2009; Paul et al. 2005). Assessment of growth at different temperatures.—Growth of two isolates from each species, Cham222 and Darke1611 for P. schmitthenneri and Pre234 and Miami212 for P. selbyi, were evaluated on PCA in 10 cm Petri dishes. A 5 mm diam plug of each isolate was transferred to three replicate plates for each of the nine temperatures evaluated. The plates were incubated at 4, 12, 15, 18, 21, 25, 28, 32 or 34 C in the dark. Growth rate was determined by measuring the colony diameter in two places at 48, 72, 96 and 120 h at each temperature. The experiment was repeated three times with at least 24 h between each experiment. The average daily growth for each species from the three replications was calculated for each temperature.
SPECIES
479
Direct colony-PCR and sequencing.—The nuclear ribosomal DNA region of the internal transcribed spacer (ITS), including the 5.8S rDNA, and cytochrome oxidase I and II genes (cox I and cox II) of 21 isolates were sequenced via direct colony PCR. A sterile toothpick was used to collect < 1 mm3 of mycelia by gently touching the toothpick tip along the growing edge of a 3–5 d old culture grown on PCA. The mycelia were added directly to a 50 mL reaction, which consisted of 10 mL 53 Colorless GoTaq Reaction buffer (Promega Corp., Madison, Wisconsin), 5 mL 25 mM MgCl2, 3 mL containing 1.3 mM each dNTP, 0.5 mL GoTaq Taq polymerase (Promega Corp.), 5 mL each of a 5 pmol concentration of primers and 21.5 mL sterile deionized water. The following pairs of primers were used in each of the reactions: ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990) for amplification of the ITS region, FM59 (TTTATGGTCAATGTAGTGAAA) and FM 55 (GGCATACCAGCTAAACCTAA) for amplification of the cox I gene (Martin 2000), and FM 35 (CAGAACCTTGGCAATTAGG) and FM 52 (GTTGTGCTAATTCCATTCTAA) for amplification of the cox II gene (Martin 2000). PCR parameters were 94 C for 5 min; followed by denaturation at 94 C for 1 min; primer annealing for 1 min at 53 C for ITS, and 52 C for cox I and cox II, and elongation at 72 C for 1 min for 34 cycles for ITS and at 72 C for 2 min for 40 cycles for cox I and cox II, with a 5 min extension for ITS and 7 min extension for cox I and cox II at 72 C after the final cycle. PCR product was purified with ExoSap (USB Corp, Cleveland, Ohio) following manufacturer’s instructions. For sequencing 3 mL primers ITS1, ITS4, FM59, FM55, FM35 or FM52 at 2 pmoles/mL were added to 6 mL purified DNA (3.6 ng per 100 bp). Sequencing was done at the Molecular and Cellular Imaging Center at the Ohio Agricultural Research and Development Center (OARDC, Wooster, Ohio). Sequence analysis.—DNA sequences were edited and aligned with CodonCode Aligner 3.7.1 (CodonCode Corp, Dedham, Massachusetts). The sequence data was compared to the ITS region, cox I gene and cox II gene sequence data of species of Pythium (SUPPLEMENTARY TABLE I). Phylogenetic and molecular analyses were completed with MEGA4 (Tamura et al. 2007). After alignment with Clustal W neighbor joining and maximum parsimony phylogenetic analyses with representative ITS sequences for each species and ITS sequences from GenBank were performed. A bootstrap 50% majority rule consensus tree that was generated with 1000 replications was included for the clade E1 as designated by Levesque and de Cock (2004). A maximum likelihood phylogenetic tree also was inferred with Bayesian inference as implemented in MrBayes 3.1.2 (Huelsenbeck and Ronquist 2001). A Bayesian analysis using the general time reversible (GTR) model was selected for the entire unpartitioned alignment, with likelihood parameters settings (lset) number of substitution types (nst) 5 6, with a proportion of sites invariable and the rest drawn from the gamma distribution (rate 5 invgamma). Four independent analyses, each starting from a random tree, were run under the same conditions for the combined gene alignment. Three hot and one cold Markov chain Monte Carlo iterations with 1 000 000 generations with
480
MYCOLOGIA
FIG. 1. Pythium schmitthenneri sporangia, oogonia, antheridia and oospores. Terminal globose sporangia (A–C) and sporangia with discharge tube (B, C). Oogonia are terminal occasionally intercalary (D, E). Oospores are plerotic or nearly so and antheridia, indicated by arrow, are mostly diclinous (D, E). Bars: A, D, E 5 10 mm, B, C 5 100 mm. sampling every 100 generations was used for the analysis. The first 250 000 generations were discarded as the chains converged.
RESULTS Sequence analysis.—The ITS 1, 5.8S and ITS 2 region were 237, 159 and 475 bp respectively. BLAST probes in GenBank found the sequence was unique compared to all other sequence in the database. The two species with the closest homology to our G7-1 isolates were P. hypogynum and P. acrogynum, which had 99.9% sequence similarity with P. acrogynum and 99.8% sequence similarity with P. hypogynum according to the ITS 1, 5.8S and ITS 2 region. Pythium schmitthenneri had one deletion and one transition from an adenine to a guanine within the ITS 2 region when compared to P. hypogynum and one deletion within the ITS 2 region when compared to P. acrogynum (TABLE I). Based on this information the new species presented here belongs to the E1 clade according to Levesque and de Cock (2004). Based on partial sequences of the cox I and cox II genes that have been deposited for P. acrogynum and P. hypogynum; P. schmitthenneri had 100% sequence identity. Partial sequence of 1277 bp starting at the 59 end of the cox I gene for P. schmitthenneri had 100% identity with 727 bp sequence from the 59 end of the gene for P. acrogynum and 680 bp for P. hypogynum sequence of 928 bp from the 39 end of the gene for P. hypogynum also was found to have 100% identity with 768 bp starting from the 59 end of the sequence, which overlapped with 268 bp with the 39 end of the sequence for P. acrogynum. Comparison of 684 bp starting at the 39 end of cox II gene were found to have 100% identity to 563 bp of sequence for P. hypogynum and P. acrogynum, 97.5% identity to 563 bp of sequence for P. echinulatum and P. erinaceum and 97.1% identity to 684 bp of sequence for P. rostratum, with 17 of the 20
nucleotide changes occurring within the 563 bp region that was compared with other members in clade E1. The nucleotide sequences of the ITS1, 5.8S and ITS 2 ribosomal genes and partial sequences for the cox I and cox II genes were submitted to GenBank [JF836869, JF895534, JF895530, JF836870, JF895535, JF895531]. For the G7-2 isolates the ITS 1, 5.8S and ITS 2 region were 236, 159 and 491 bp respectively. BLAST queries in GenBank found that the sequence was unique. The two species with the closest homology to our isolates were P. longandrum with 97.1% sequence similarity and P. longisporangium with 97.5% similarity, according to the ITS 1, 5.8S and ITS 2 region. There were five transitions and two transversions within the ITS 1 region and 10 transitions, four transversions, four deletions and one insertion within the ITS 2 region when compared to P. longandrum. Compared to P. longisporangium there were five transitions, three transversions and one insertion within the ITS 1 region and five transitions, five transversions, four deletions and one nucleotide was inconclusive based on available sequence data within the ITS 2 region (TABLE I). Based on this information the new species presented here belongs to the E1 clade according to Levesque and de Cock (2004). Partial sequences of 1277 bp starting at the 59 end of the cox I gene were 98.1% similar to P. longisporangium, 97.6% similar to P. longandrum (680 bp from the 59 end) 96.3% similar to P. schmitthenneri, 96.6% similar to P. acrogynum and P. echinulatum (727 bp from the 59 end) and 95.4 % similar to P. hypogynum (768 bp from the 39 end). In comparison of 684 bp starting at the 39 end of cox II gene P. selbyi had close homology to P. schmitthenneri, 97.4%, and P. rostratum, 97.1% in sequence identity, and P. hypogynum and P. acrogynum with 97.2% sequence similarity to 563 bp. The cox II gene was not available for P. longandrum and P. longisporangium. The nucleotide sequence of the ITS1, 5.8S, and ITS 2
ELLIS ET AL.: NEW PYTHIUM
SPECIES
481
FIG. 2. Pythium selbyi sporangia, oogonia, antheridia and oospores. A. Terminal globose sporangia and sporangia with discharge tubes. B, C. Intercalary oogonia. Oospores are plerotic or nearly so, with mostly one (B) but often two oospores per oogonium (C). Antheridia, indicated by arrows, are hypogynous. Bars 5 10 mm.
ribosomal genes and the partial sequences for the cox I and cox II genes were submitted to GenBank [JF836871, JF895536, JF895532, JF836872, JF895537, JF895533]. TAXONOMY Pythium schmitthenneri M.L. Ellis, Broders & Dorrance sp. nov. FIG. 1 MycoBank MB561984 Coloniae in agar PCA demergatur parte, plerumque chrysanthemal ad rosette, hyphis usque ad 4–8 mm crassis compositae. Zoosporangia terminalia, rare interposita, globosa leviter ellipsoideae vel limoniform, 17–43 mm diam, 48 usque dum mm longis limonform, non-prolificantes. Zoosporae 7–10 mm longa. Oogonia laevia, terminalia, interdum intercalaria, globosa, interdum elongata, 19– 26 mm diam, paries 0.7–1.8 mm crassus. Oosporae pleroticae, vel fere, globosae, unus oosporae per oogonium, interdum duo oosporae per oogonium, 14–23 mm diam, paries 1– 2.5 mm crassus. Antheridia diclinata, interdum monoclinata, raro hypogyna, plerumque singularia raro . 1 per oogonia, 10–25 mm longa, 6–12 mm crassi. Typus in the Centraalbureau voor Schimmelcultures (CBS H-20613).
Mycelial growth on PCA partially submerged with a rosette to chrysanthemal growth pattern and on cornmeal submerged with no distinct pattern. The main hyphae were 4–8 mm diam. Asexual structures rarely form in grass blade culture, whereas sexual structures form in abundance. Asexual structures form in abundance in Chen-Zentmyer’s salt solution. Sporangia globose to slightly ellipsoidal or limoniform, nonproliferating, 17–43 mm diam (av. 32 mm), up to 48 mm long when limoniform, mostly terminal or rarely intercalary. The discharge tube arising from the sporangia was long, more two times longer than sporangia and narrow (FIG. 1). Zoospores 7–10 mm long. Oogonia smooth-walled, spherical, at times elongated, terminal, occasionally intercalary, 19–26 mm diam (av. 23 mm). The oogonial stalk was 3–10 mm.
The oogonial wall was 0.7–1.8 mm thick. Antheridia 10–25 mm long and 6–12 mm wide, mostly diclinous, occasionally monoclinous, or rarely hypogynous. Each oogonium was supplied by usually one, occasionally as many as three, antheridia. Oospores plerotic, or nearly so, 14–23 mm diam (av. 20 mm), usually one but occasionally two oospores per oogonium. The oospore wall was smooth and 1– 2.5 mm thick (FIG. 1). Daily growth on PCA was 0.7 mm at 4 C, 7 mm at 12 C, 9 mm at 15 C, 12 mm at 18 C, 13.5 mm at 21 C, 13 mm at 25 C, 11.5 mm at 28 C, 6 mm at 32 C and 0 mm at 34 C. Holotype.—United States, Ohio: Darke County. Isolate Darke1611 designated as the holotype, was recovered from soybean (Glycine max L. Merr.) root tissue with a soil-baiting procedure from agronomic soil collected in summer 2006 (collector K. Broders). The dried herbarium material were deposited at the Centraalbureau voor Schimmelcultures (CBS), Utrecht, the Netherlands, collection (CBS H-20613). A live culture as the ex-holotype also was deposited (CBS 129726). The complete ITS sequence and partial sequences of the cox I and cox II genes were deposited in GenBank (accession numbers JF836869, JF895534, JF895530). Additional specimens.—United States, Ohio: Pickaway County. Isolate Pick1415 was recovered from corn (Zea mays L.) root tissue by using a soil baiting procedure from agronomic soil collected during summer 2006 (collector K. Broders). The live culture and dried herbarium material were deposited at the Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, collection (CBS 129727, CBS H-20614). The complete ITS sequence and partial sequences of the cox I and cox II genes were deposited in GenBank (accession numbers JF836870, JF895535, JF895531).
482
MYCOLOGIA
Etymology.— The name is taken from August F. Schmitthenner (1926–), an emeritus professor in the Department of Plant Pathology at Ohio State University. In 1965–1966 on sabbatical leave at Imperial College, England, Schmitthenner studied the physiology and taxonomy of Pythium in collaboration with Grace Waterhouse of the Commonwealth Mycological Institute, Key, Surrey. It was this and subsequent work on Pythium that led to his worldwide recognition for expertise in the taxonomy of this genus (Williams and Ellett 1998). Pythium selbyi Ellis, Broders, and Dorrance sp. nov. FIG. 2 MycoBank MB 561985 Coloniae in agar PCA demergatur parte, plerumque rosette ad radiata, hyphis usque ad 4–7 m m crassis compositae. Zoosporangia terminalia, rare interposita, globosa leviter ellipsoideae, 24–41 mm diam. Zoosporae 7– 10 mm longa. Oogonia laevia, terminalia, intercalaria, globosa, interdum elongata, 26–30 mm diam, paries 0.8– 1.3 mm crassus. Oosporae pleroticae, vel fere, globosae, unus oosporae per oogonium, frequento duo oosporae per oogonium, 18–26 mm diam, paries 1–2.5 mm crassus. Antheridia hypogyna, interdum monoclinata, raro diclinata, plerumque 1–2 antheridia per oogonia, raro . 2 per oogonia, 10–22 mm longa, 6–13 mm crassi. Typus in the Centraalbureau voor Schimmelcultures (CBS #129728).
Mycelial growth on PCA partially submerged with a radiate to rosette growth pattern and the main hyphae 4–7 mm diam, some branching occurring in older hyphae. Asexual structures rarely formed in grass blade culture, whereas sexual structures were much more abundant. Sporangia form in abundance in ChenZentmyer’s salt solution. Sporangia 24–41 (av. 35 mm) mm diam, mostly terminal or rarely intercalary, globose to slightly ellipsoidal (FIG. 2). Zoospores 7–10 mm long. Oogonia smooth-walled, spherical, at times elongated, terminal, intercalary, 26–30 mm diam (av. 27.5 mm). Oogonial wall 0.8–1.3 mm thick. Antheridia mostly hypogynous, at times monoclinous, rarely diclinous. Each oogonium supplied by 1–3 antheridial cells 10– 22 mm long and 6–13 mm wide. Oospores plerotic, or nearly so, 18–26 mm diam (av. 23 mm), usually one but frequently two oospores per oogonium. The oospore wall was 1–2.5 mm thick (FIG. 2). Daily growth on PCA was 1 mm at 4 C, 7 mm at 12 C, 9 mm at 15 C, 11.5 mm at 18 C, 13 mm at 21 C, 12 mm at 25 C, 3.5 mm at 28 C, 0.5 mm at 32 C and 0 mm at 34 C. Holotype.—United States, Ohio: Preble County. Isolate Pre234 was recovered from corn (Zea mays L.) root tissue with a soil-baiting procedure from agronomic soil collected during summer 2007 (collector K. Broders). The dried herbarium material was deposited at the Centraalbureau voor Schimmelcultures (CBS),
Utrecht, the Netherlands (accession number CBS H20615). A live culture, ex-holotype, also was submitted to CBS (CBS 129728). The complete ITS sequence and partial sequences of the cox I and cox II genes were deposited in GenBank (accession numbers JF836871, JF895536, JF895532). Additional representative culture.—United States, Ohio: Champaign County. Isolate Cham264, was recovered from soybean (Glycine max L. Merr.) root tissue with a soil-baiting procedure from agronomic soil collected in summer 2006 (collector K. Broders). The live culture and dried herbarium material were deposited at the Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, collection (accession umbers CBS 129729, CBS H-20616). The complete ITS sequence, and partial sequences of the cox I, and cox II genes were deposited in GenBank (accession numbers JF836872, JF895537, JF895533) Etymology.—The name is taken from Augustine D. Selby (1859–1923), a professor in the Department of Botany at the Ohio Agricultural Experiment Station (OAES). Although not the first to work on plant diseases in Ohio, Selby is considered the first plant pathologist at OAES. He described a number of diseases including the Colletotrichum pathogen causing wheat anthracnose and the Fusarium (Gibberella) pathogen causing wheat scab. Other contributions include numerous publications such as the first and second Ohio weed manuals and A condensed handbook of diseases of cultivated plants in Ohio, which was used as a textbook throughout the United States. Selby was a founding member of the American Phytopathological Society (APS) and its publication Phytopathology and he was the third president of APS. The Department of Plant Pathology in Wooster now is housed in Selby Hall (Williams and Ellett 1998). DISCUSSION Pythium schmitthenneri and Pythium selbyi both have morphological attributes that distinguish them from other known species of Pythium within the E1 clade designated by Levesque and de Cock (2004) (TABLES II, III). The sequence data for the isolates designated as P. schmitthenneri and P. selbyi were unique according to the ITS 1, 5.8S, ITS 2 region when compared with other members belonging to the E1 clade (TABLE I, FIG. 3, SUPPLEMENTARY TABLE I). Based on the ITS region, the 10 isolates designated as P. schmitthenneri, which were collected from eight counties in Ohio, had identical sequences, and the 10 isolates designated P. selbyi from six counties in Ohio had identical sequences. One isolate had unique sequence data compared to the other 20 isolates. This
ELLIS ET AL.: NEW PYTHIUM TABLE II.
Comparison of morphological features of Pythium schmitthenneri (G7-1) with key members within clade E1
Morphological differences
P. rostratuma, b
P. acrogynumb
P. hypogynuma, b
Colony pattern Chrysanthemum pattern Not reported on PCA, submerged on cornmeal agar
Hyphae Sporangia
Antheridia
Oogonia
Oospores
6–8 mm wide Terminal or intercalary, globose, ovoid, limoniform, or ellipsoidal, nonproliferating, 17–32 (av. 25) mm, up to 27 3 23 mm when oblong Monoclinous mostly sessile and arising immediately below the oogonium, hypogynous
Mostly intercalary, occasionally terminal, smooth, 17–26 (av. 21.5) mm, often in chains Plerotic or nearly so, single, occasionally two oospores per oogonium, wall 2 mm thick
Cardinal Minimum below 5 C, temperature optimum 25 C, maximum, 35uC Growth rate 8.0 mm at 25 C a b
483
SPECIES
No report on PCA, radiate pattern on cornmeal agar
7.7 mm wide 1.5–8.3 mm wide Terminal, occasionally 24–40 (av. 31) mm diam, terminal, rarely intercalary, (sub)globose, non-proliferating, 6.5–34.5 intercalary, (av. 22) mm, discharge (sub)globose tubes about twice the diameter of the sporangia
Hypogynous, antheridial cells large, 8–15 3 6–14 (av. 11.5–9) mm
Terminal, (sub) globose, papillate, rarely smooth, 18–25 (av. 21) mm diam Plerotic, single, 18–23 (av. 20) mm diam, wall smooth, 0.8–1.7 (av. 1.5) mm thick
Strictly hypogynous, antheridial cells 3.0–11.1 3 2.8–8.3 (av. 6.5 3 5.5) mm delimited within the oogonial stalk at disitance of 5–30 mm below the oogonium Terminal, (sub)globose, smooth, 10–35 (av. 22) mm diam
Plerotic, single, smooth-walled, measurements not reported
Not reported
Minimum 1 C, optimum 31–34 C, maximum 37 C
Not reported
11 mm at 25 C
P. schmitthenneri Rosette to chrysanthemum pattern on PCA, submerged on cornmeal agar 4–8 mm wide Terminal, occasionally intercalary, (sub)globose, lemon shaped, 17–43 (av. 32) mm, up to 48 mm long when limoniform
Mostly diclinous occasionally monoclinous and hypogynous, antheridial cells 10–25 3 6–12 mm
Mostly terminal, occasionally intercalary, smooth 19–26 (av. 23) mm, oogonial stalk 3–10 mm Plerotic, single, occasionally two oospores per oogonium, 14–23 (av. 20) mm diam, wall smooth, 1–2.5 mm thick Minimum below 4 C, optimum 18–25 C, maximum 32 C 13.2 mm at 25 C
Description taken from Middleton (1943). Description taken from van der Plaats-Niterink (1981).
isolate had 99% homology to P. longandrum and P. longisporangium in the ITS 1, 5.8S, ITS 2 region. Further examination is in progress to assess whether this is also a new species, but more isolates with identical sequence are required to verify that it is not a variant of either P. longandrum or P. longisporangium. It has been proposed that Pythium be split into five new genera based on phylogeny and morphology (Uzuhashi et al. 2010). In this study the E1 clade would fall under the newly proposed genus Globisporangium, which is characterized by the globose sporangia of its members. However this genus is
composed of phylogenetically distinct species thus Uzuhashi et al. (2010) suggested that further examination of the taxonomy of this genus is required. If these five new genera names are accepted by the Pythium community, P. schmitthenneri and P. selbyi would be transferred to the genus Globisporangium. There are currently over 26 species within the E1 and E2 clades (Paul 2009), including P. schmitthenneri and P. selbyi. Comparisons of sequences from the ITS 1, 5.8S, ITS 2 region, along with morphology, are the most common method to confirm speciation in Pythium. The cox I, cox II and b-tubulin genes, and the D1, D2 and D3 of the adjacent large subunit
484 TABLE III.
MYCOLOGIA Comparison of morphological features of Pythium selbyi (G7-2) with key members within clade E1
Morphological differences Colony pattern
Hyphae Sporangia
Antheridia
Oogonia
Oospores
P. longandruma Submerged, chrysanthemal on PCA, not reported on cornmeal agar 7–8 mm, well branched Globose to somewhat elongated, mostly intercalary and catenulate, at times terminal and subterminal, 16–36 (av. 29.4) mm diam, long discharge tubes Hypogynous and monoclinous, antheridia are inflated, at times bi-lobed into two conspicuous cells, long and longitudinally applied to the oogonia, 40–50 mm long and 8-9 mm wide Smooth-walled, spherical, at times elongated, terminal, subterminal, intercalary, 17–26 (av. 21.5) mm diam Plerotic and aplerotic, spherical, one but at times two oospores per oogonium, 18–23 (av. 20.1) mm, wall 1–2.5 mm
Cardinal temperature
Not reported
Growth rate
7 mm at 25 C
a b
P. longisporangiumb
P. selbyi
Submerged, chrysanthemal on PCA, not reported on cornmeal agar 6–8 mm, well branched
Radiate to slightly chrysanthemal on PCA, submerged on cornmeal agar
Hypogynous and monoclinous sessile, 1–3 antheridia and at times catenulate, rarely diclinous
Hypogynous, occasionally monoclinous, rarely diclinous 10– 22 3 7.6–13 mm
4–7 mm, some branching in older hyphae Globose to somewhat Globose to oval, mostly terminal, cylindrical, oval, intercalary intercalary, 24–41(av. 35) mm and catenulate, 15–55 ( av. 32.6) mm diam, up to 65 mm long
Smooth-walled, spherical, Terminal and intercalary, smoothterminal, subterminal, walled, spherical, at times intercalary, 17–36 elongated 26–30 (av. 27.5) mm diam (av. 19.5) mm diam Mostly plerotic occasionally aplerotic, Plerotic or nearly so, one often two oospores per usually one, occasionally oogonium, 18–26 (av. 23) mm two and rarely three, intercalary oogonia can be aplerotic, smooth-walled, 12–22 (av. 18.1) mm, wall 1–1.5 mm Not reported Growth Range 4–32 C Optimum 18–25 C Maximum 32 C 11 mm at 25 C 11.9 mm at 25 C
Description taken from Paul (2001). Description taken from Paul et al. (2005).
nuclear ribosomal DNA have been examined for sequence variation among species of Pythium (Levesque and de Cock 2004, Martin 2000, Villa et al. 2006). However insufficient data exist within a number of clades to adequately use these regions for comparison among species. The b-tubulin gene for example has not been sequenced for all the species within the E1 clade. There is also some uncertainty as to how much variation within the ITS region is needed to be considered a new species, and this may vary depending on the clade being examined. This has been observed among species of Phytophthora, where the ITS region may reveal little difference between closely related but distinct species (Kang et al. 2010). It has been suggested that P. hypogynum and P. acrogynum are possibly one species due to their similar morphology, as P. acrogynum was placed in the group of
doubtful or excluded species by van der PlaatsNiterink (1981); the ITS 1, 5.8S, ITS 2 region (Levesque and de Cock 2004) and the cox II gene have 100% sequence identity. In a review Hyde et al. (2010) discussed the importance morphology still plays when classifying taxa and strongly suggested that mycologist return to the field, recollect species and re-typify taxa with living cultures. Kang et al. (2010) also discussed the potential pitfalls in sequence-based identification. In both reviews they raise the question as to how many genes and how much variation within these genes is needed to be considered a new species. As suggested by Kang et al. (2010), speciation can result from factors such as geospatial separation, host selection and/or mating isolation. Therefore defining a species based on a single locus is problematic. These questions will be important for sorting out many of the members in the E clade. Based on our
ELLIS ET AL.: NEW PYTHIUM
FIG. 3. The majority-rule consensus tree from the Bayesian analysis of the ITS1-5.8S-ITS2 sequence of the nuclear rDNA showing the positions of isolates of P. schmitthenneri and P. selbyi in relation to other known tax in clade E1 with Pythium ultimum var. ultimum as outgroup. Bayesian posterior probabilities are displayed next to each node. Species names are followed by GenBank accession numbers. Bar represents the expected changes per site.
analysis of 10 isolates, there is sufficient variation to separate P. schmitthenneri from P. hypogynum and P. acrogynum based primarily on morphology. The most striking morphological difference between these species is the antheridial cell type that attaches to the oogonia. Both P. hypogynum and P. acrogynum have strictly hypogynous antheridia (Middleton 1943, van der Plaats-Niterink 1981). According to the original species description of P. hypogynum (Middleton 1943), the antheridium was believed to be more primitive than those of other Pythium species with more advanced antheridial cell types and because the hypogynous antheridia in P. hypogynum were not always formed. Instead a moderately sized nucleus cell in the oogonial stalk migrates upward toward the oogonial cavity to fertilize the oospore (Middleton 1943). Pythium schmitthenneri has mostly diclinous
SPECIES
485
antheridia, and the migration of fertilization tube in place of an antheridium has not been observed in this species. The growth habit also is different for P. hypogynum and P. schmitthenneri. Pythium hypogynum has a radiate growth pattern on cornmeal agar, while P. schmitthenneri is submerged with no distinct pattern, and the temperature range for growth also varies dramatically for these two species (TABLE II). Thus P. schmitthenneri has distinct morphological features, culture growth habits, distinct optimum temperature requirements, geographical associations as well as sequence divergence among other species within the E1 clade to support it as a new species. A number of species of Pythium in the E1 clade have been found associated with plants. Pythium hypogynum has been reported to be a pathogen of cereal crops in the United States (Middleton 1941, 1943; Sprague 1946, 1950) and a weak pathogen of Fragaria sp. (Nemec 1972). Pythium acrogynum first was isolated from soil in Wuchang, Hupei (Yu¨, 1973), and has not been reported in the United States. Both P. longandrum and P. longisporangium were isolated from vineyard soil in France (Paul 2001, Paul et al. 2005). Currently five species within the E1 clade were found associated with soybean and corn in Ohio, including P. hypogynum, P. longandrum, P. echinulatum, P. schmitthenneri and P. selbyi (Broders et al. 2007, 2009). Pythium echinulatum (Broders et al. 2007), P. schmitthenneri and P. selbyi (Dorrance et al. unpubl data) were found to be moderately aggressive pathogens to both soybean and corn, however Koch’s postulates have yet to be completed for P. hypogynum and P. longandrum on both soybean and corn. Pythium schmitthenneri and P. selbyi were isolated more frequently from soybean and corn than P. hypogynum, P. longandrum and P. echinulatum. It is interesting that these new species strongly associated with soybean and corn were not identified before the studies by Broders et al. (2009), especially P. schmitthenneri with its distinct morphological differences from P. hypogynum. This could be due to the isolation methods used. In a study by Broders et al. (2007), where Pythium spp. were isolated directly from symptomatic plants collected from fields with a history of stand establishment issues in Ohio, three isolates of P. echinulatum were isolated from soybean. In a more comprehensive survey of Ohio P. schmitthenneri and P. selbyi were recovered from 30% of the 88 locations in a soil-baiting assay at 18 C, compared to P. hypogynum (, 0.1%) and P. longandrum (, 10 %) while P. echinulatum was not recovered (Broders et al. 2009). These new species might have been favored by this method for isolating Pythium spp. because both species have optimum growth at relatively low temperatures compared with P. hypogynum. Another key difference
486
MYCOLOGIA
between the two methods is when isolated from field samples the pathogens had been established much longer in the host and it was possible that secondary invaders also were being recovered, whereas the baiting procedure targeted the primary invaders. However since this initial survey both P. schmitthenneri and P. selbyi were recovered from lesions on soybean roots collected early in the season from a number of additional soybean fields in Ohio as well as in the soil-baiting procedure (Dorrance et al. unpubl data). The frequency with which these species were isolated from infected root tissue of soybean made them important to characterize so that better management strategies can be developed to control Pythium spp. affecting soybeans in Ohio. ACKNOWLEDGMENTS This project was supported in part by the Ohio Soybean Council, the OARDC Graduate Research Enhancement Grant Program (SEEDS). We thank the OARDC Molecular Cellular Imaging Center for assistance in sequencing. Salaries and research support provided in part by state and federal funds appropriated to the Ohio Agricultural Research and Development Center, Ohio State University.
LITERATURE CITED Broders KD. 2008. Seed and seedling disease of corn and soybean in Ohio: the role of Fusarium graminearum, Pythium species diversity, fungicide sensitivity, Pythium community composition and soil properties in disease severity [doctoral dissertation]. Columbus: Ohio State University Press. 187 p. ———, Lipps PE, Paul PA, Dorrance AE. 2007. Characterization of Pythium spp. associated with corn and soybean seed and seedling disease in Ohio. Plant Dis 91:727–735, doi:10.1094/PDIS-91-6-0727 ———, Wallhead MW, Austin GD, Lipps PE, Paul PA, Mullen RW, Dorrance AE. 2009. Association of soil chemical and physical properties with Pythium species diversity, community composition, and disease incidence. Phytopathology 99:957–967, doi:10.1094/PHYTO-99-8-0957 Chen DW, Zentmyer GA. 1970. Production of sporangia by Phytophthora cinnamomi in axenic culture. Mycologia 62:397–402, doi:10.2307/3757597 Deep IW, Lipps PE. 1996. Recovery of Pythium arrhenomanes and its virulence to corn. Crop Prot 15:85–90, doi:10.1016/0261-2194(95)00120-4 Dorrance AE, Berry SA, Bowen P, Lipps PE. 2004. Characterization of Pythium spp. from three Ohio fields for pathogenicity on corn and soybean and metalaxyl sensitivity. Plant Heath Progr. doi: 10.1094/ PHP-2004-0202-01-RS. Huelsenbeck JP, Ronquist F. 2001. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574.
Hyde KD, Abd-Elsalam K, Cai L. 2010. Morphology: still essential in a molecular world. Mycotaxon 114:439–451, doi:10.5248/114.439 Kang S, Mansfield MA, Park B, Geiser DM, Ivors KL, Coffey MD, Gru¨nwald NJ, Martin FN, Le´vesque CA, Blair JE. 2010. The promise and pitfalls of sequence-based identification of plant-pathogenic fungi and Oomycetes. Phytopathology 100:732–737, doi:10.1094/ PHYTO-100-8-0732 Le´vesque CA, de Cook WAM. 2004. Molecular phylogeny and taxonomy of the genus Pythium. Mycol Res 108: 1363–1383, doi:10.1017/S0953756204001431 Martin FN. 2000. Phylogenetic relationships among some Pythium species inferred from sequence analysis of the mitochondrially encoded cytochrome oxidase II gene. Mycologia 92:711–727, doi:10.2307/3761428 Middleton JT. 1941. Root rot of barley caused by Pythium hypogynum n. sp. Phytopathology 31:863 (Abs.). ———. 1943. The taxonomy, host range and geographical distribution of the genus Pythium. Memoirs of the Torrey Botanical Club, 171 p. Nemec S. 1972. Histopathology of Pythium-infected strawberry roots. Can J Bot 50:1091–1096, doi:10.1139/ b72-135 Paul B. 1992. Pythium radiosum, a new species from the bank of Lake Zurich. Mycol Helv 5:1–8. ———. 2001. ITS region of the rDNA of Pythium longandrum, a new species: its taxonomy and its comparison with related species. FEMS Microbiol Lett 202: 239–242, doi:10.1111/j.1574-6968.2001.tb10810.x ———. 2002. Pythium segnitium sp. nov., isolated from the Canary islands, its taxonomy, ITS region of rDNA and its comparison with related species. FEMS Microbiol Lett 217:207–212. ———. 2003. Characterization of a new species of Pythium isolated from a wheat field in northern France and its antagonism toward Botrytis cinerea causing the gray mold disease of the grapevine. FEMS Microbiol Lett 224:215–223, doi:10.1016/S0378-1097(03)00451-8 ———. 2006. A new species of Pythium isolated from a vineyard in France. FEMS Microbiol Lett 263:194–199, doi:10.1111/j.1574-6968.2006.00422.x ———. 2009. Pythium burgundicum sp. nov. isolated from soil samples taken in French vineyards. FEMS Microbiol Lett 301:109–114, doi:10.1111/j.1574-6968.2009.01810.x ———, Bala K, Gognies S, Belarbi A. 2005. Morphological and molecular taxonomy of Pythium longisporangium sp. nov. isolated from Burgundian region of France. FEMS Microbiol Lett 246:207–212, doi:10.1016/ j.femsle.2005.04.004 Rao B, Schmitthenner AF, Caldwell R, Ellett CW. 1978. Prevalence and virulence of Pythium species associated with root rot of corn in poorly drained soil. Phytopathology 68:1557–1563, doi:10.1094/Phyto-68-1557 Schmitthenner AF, Bhat RG. 1994. Useful methods for studying Phytophthora in the laboratory, plant pathology. Ohio Agric Res Dev Cent Spec Circ 143. Sprague R. 1946. Root rots and leaf spots of grains and grasses in the northern great plains and western states. Pl Dis Rep, Suppl 163:101–268.
ELLIS ET AL.: NEW PYTHIUM ———. 1950. Diseases of cereals and grasses in North America. New York: Ronald Press Co. 538 p. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software. Mol Biol Evol 24:1596–1599, doi:10.1093/molbev/ msm092 Tuite J. 1969. Plant pathological methods—fungi and Bacteria. Minneapolis, Minnesota: Burgess Publishing Co. 183 p. Uzuhashi S, Tojo M, Kakishima M. 2010. Phylogeny of the genus Pythium and description of new genera. Mycoscience 51:337–365, doi:10.1007/s10267-010-0046-7 van der Plaats-Niterink AJ. 1981. Monograph of the genus Pythium. Stud Mycol 21. Baarn, the Netherlands: Centraalbureau voor Schimmelcultures. 242 p. Villa NO, Kageyama K, Asano T, Suga H. 2006. Phylogenetic relationships of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and btublin gene sequences. Mycologia 98: 410– 422, doi:10.3852/mycologia.98.3.410
SPECIES
487
Waterhouse GM. 1967. Key to Pythium Pringsheim. Mycol Pap 109:1–15. ———. 1968. The genus Pythium Pringsheim. Diagnoses (or descriptions) and figures from the original papers. Mycol Pap 110:1–71. White TJ, Bruns T, Lee SB, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Snisky JJ, eds. PCR protocols: a guide to methods and application. New York: Academic Press, Inc. Williams LE, Ellett CW. 1998. A history of the Department of Plant Pathology, Ohio State University, Ohio, Agricultural Research and Development Center, Wooster. 216 p. Yanar Y, Lipps PE, Deep IW. 1997. Effect of soil saturation duration and soil water content on root rot of maize caused by Pythium arrhenomanes. Plant Dis 81:475–480, doi:10.1094/PDIS.1997.81.5.475 Yu¨ YN. 1973. Five new species of Pythium. Acta Microbial Sin 13:116–123.
