Two new species, Phytopythium iriomotense sp. nov. and P. aichiense ...

Mycol Progress (2015) 14: 2 DOI 10.1007/s11557-015-1027-1

ORIGINAL ARTICLE

Two new species, Phytopythium iriomotense sp. nov. and P. aichiense sp. nov., isolated from river water and water purification sludge in Japan Md. Abdul Baten & Li Mingzhu & Keiichi Motohashi & Yasushi Ishiguro & Mohammad Ziaur Rahman & Haruhisa Suga & Koji Kageyama

Received: 1 August 2014 / Revised: 20 October 2014 / Accepted: 3 November 2014 / Published online: 3 February 2015 # German Mycological Society and Springer-Verlag Berlin Heidelberg 2015

Abstract Phytopythium iriomotense sp. nov. was isolated from river water of Iriomote Island, Okinawa Prefecture, Japan. The species can grow at 10–35 °C. The optimum temperature was 30 °C, with a radial growth of 24.3 mm per day. The species is morphologically characterized by globose to sub-globose sporangia with apical papillae, internally nested and internally extended proliferating sporangia, lateral hyphal swellings, compound sympodia, globose and smooth oogonia, amphigynous or crook-necked antheridial cells, oogonia with double oospores, aplerotic or plerotic oospores, and a chrysanthemum growth pattern on V8A. Phytopythium aichiense sp. nov. was isolated from water purification sludge in Aichi prefecture, Japan. The species can grow at 3–35 °C. The optimum temperature was 28 °C with a radial growth of 12.3 mm per day. P. aichiense is morphologically characterized by sub-globose, ovoid or limoniform sporangia with apical papillae, internally nested or internally extended proliferating sporangia, filamentous inflated or crook-necked

M. A. Baten (*) The United Graduate School of Agricultural Science, Gifu University, Gifu 501-1193, Japan e-mail: [email protected] L. Mingzhu : Y. Ishiguro : M. Z. Rahman : K. Kageyama River Basin Research Center, Gifu University, Gifu 501-1193, Japan K. Motohashi Faculty of Regional Environment Science, Tokyo University of Agriculture, Tokyo, Japan H. Suga Life Science Research Center, Gifu University, Gifu 501-1193, Japan Present Address: L. Mingzhu College of Life Sciences, Shaanxi Normal University, Xi’an 710062, China

antheridial cells, aplerotic oospores and a stellate growth pattern on V8A. Phylogenetic analyses based on the rDNA ITS region and combined phylogenetic trees based on the nuclear LSU rDNA and beta-tubulin gene, and the mitochondrial coxI and coxII genes, revealed that both species are genetically distinct from each other and from morphologically related species. Keywords Oomycete . Morphological analysis . Waste water treatment

Introduction Phytopythium is a member of the Peronosporales, family Peronosporaceae, as it clusters together with Halophytophthora, Phytophthora and downy mildews, while Pythium (Pythiaceae) is the sister group (Hulvey et al. 2010). Phytopythium is phylogenetically separated from the genus Pythium (Bala et al. 2010). So far, Phytopythium includes 16 species. The genus is represented worldwide (Van der PlaatsNiterink 1981). Several species of this genus are saprophytes in natural environments, while others are plant pathogens. The species inhabit water and soil, and several of them, including P. helicoides and P. vexans, are causing severe water-soaked root rot and stem rot diseases (Kageyama et al. 2007; Tao et al. 2011; Yang et al. 2013). Therefore, Phytopythium is agriculturally and commercially important. The common morphological characteristics of Phytopythium are: sporangia ovoid to globose with papillae except for P. vexans, common internal proliferation similar to that of Phytophthora, and mode of zoospore discharge similar to that of Pythium. The sporangium forms a discharge tube with a vesicle at the tip. The undifferentiated protoplasm

2 Page 2 of 12

moves through the tube to the vesicle, followed by differentiation into biflagellate zoospores. Most species have large, smooth oogonia, thick-walled oospores, and one to two elongated paragynous antheridial cells that are laterally attached to the oogonium. The genus is also characterized by high optimum and maximum growth temperatures of approx. 30 and 35–40 °C, respectively (Lévesque and de Cock 2004). According to the phylogenetic results of Lévesque and de Cock (2004), the genus Pythium was divided into 11 major clades, designed A–K. When Villa et al. (2006) reconstructed the phylogenetic tree based on the sequences of the rDNA ITS region, cytochrome c oxidase (coxII), and β-tubulin genes, clade K was separated from the genus Pythium and appeared to be more closely related to Phytophthora. Clade K was named Phytopythium by Bala et al. (2010). DNA sequences of the internal transcribed spacer region of ribosomal DNA (rDNA ITS region) of numerous taxa are available in DNA databases, and have become a powerful tool for identification in Pythium species (Lévesque and de Cock 2004; Matsumoto et al. 1999; Villa et al. 2006). The coxI and coxII genes also have a high resolution for species differentiation in oomycetes (Robideau et al. 2011; Martin and Tooley 2003). Iriomote is the second largest island in Okinawa Prefecture, Japan, and harbors some of Japan’s least disturbed natural environments, with over 90 % of the island covered by dense jungle and mangrove swamps. According to Köppen climate classification, Iriomote has a tropical rainforest climate (Peel et al. 2007). Its maritime tropical weather favors the survival and spread of zoosporic fungi like Pythium clade K (Kageyama 2010). Wastewater treatment generates large quantities of sludge that must be treated and reused or safely disposed of to ensure environmental protection. Raw wastewater sludge contains more than 90 % of water with organic solids, which cause problems in transportation, treatment and disposal. Generally, chemical polymers are used for sludge settling and dewatering in wastewater treatment plants (Subramanian et al. 2008). Wastewater sludge contains a variety of viruses, bacteria, and fungi, including oomycetes, as it is a rich source of organic matter. In fact, wastewater sludge contains all nutrient requirements for oomycete growth (Fakhru’l-Razi and Molla 2007). During a study on the occurrence and diversity of oomycetes in Japan, we identified several known Phytopythium isolates based on morphological and molecular phylogenetical analyses. We also found two new Phytopyhtium species with unique combinations of morphological and molecular characteristics that clearly separated the new species from any known species of the genus. This paper presents a formal description of the new species and provides morphological arguments and molecular support, based on three nuclear and two mitochondrial genes, for their status as distinct taxa.

Mycol Progress (2015) 14: 2

Materials and methods Isolates Four isolates (GUCC0025, GUCC0028, GUCC0036 and CBS137104) were recovered from surface water on Iriomote Island, Okinawa Prefecture, in 2007 and 2008. In addition, one isolate (CBS137195) was recovered from wastewater sludge in Aichi prefecture in 2011. Since then, all isolates have been preserved in the Gifu University Cultures Collection (GUCC). DNA extraction and PCR For DNA extraction, the isolates were incubated for 2–3 days on V8A medium at 25 °C. A small amount of mycelium was transferred to 100 μl PrepMan Ultra Reagent (Applied Biosystems, Inc., California, USA) in a 1.5 ml Eppendorf tube, and heated at 100 °C for 10 min. After a 2 min incubation at room temperature, the sample was centrifuged at 20, 000 g for 3 min and the supernatant was transferred to a new tube. This DNA solution was diluted fivefold with TE buffer (10 mM Tris–HCl, pH 7.5 and 0.1 mM EDTA) for PCR. The rDNA internal transcribe spacer (ITS) region, the large subunit (LSU) rDNA, the beta-tubulin gene, and the cytochrome oxidase I and II (coxI and II) genes were amplified using the primer sets listed in Table 1. Each 25 μl reaction mixture contained 0.5 μM of each primer, 0.125 units rTaq DNA polymerase (TaKaRa Bio Inc., Shiga, Japan), 2 mM dNTP mixture, 2.5 μl PCR buffer (10 mM Tris–HCl, pH 8.3, 50 mM KCl, and 1.5 mM MgCl2), and 1 μl template DNA. Reactions were carried out in a 2700 DNA Thermal Cycler (Applied Biosystems, Inc.). The amplification conditions for rDNA ITS and LSU rDNA were: 94 °C for 3 min; 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; then 72 °C for 10 min. The amplification conditions for the beta-tubulin gene were: 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min; then 70 °C for 10 min. The amplification conditions for the coxI and coxII genes were: 94 °C for 3 min; 35 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 1 min; then 72 °C for 10 min. Sequence amplification The PCR products were purified using the GenElute PCR Clean-up Kit (Sigma-Aldrich Co., Missouri, USA), following the manufacturer’s instructions. For sequencing, a 10 μl reaction volume containing 1 μl purified PCR products, 1 μl appropriate primer, 4 μl Ready Reaction Mix (Applied Biosystems, Inc.), and 4 μl H20 was assembled. Sequencing was performed using a thermo cycler program of 96 °C for 1 min followed by 25 cycles of 96 °C for 10 s, 50 °C for 5 s, and 60 °C 4 min, with a final incubation at 10 °C. The reaction

Mycol Progress (2015) 14: 2 Table 1 Primers used in this study for DNA amplification and sequencing

Page 3 of 12 2

DNA region

Primer name

Primer sequences (5′–3′)

Reference

rDNA ITS

ITS4 ITS5 NL1 NL4 FM85mod OomCOILevup FM58 FM66 Btub_F1A Btub_R1A Btub_R2a Btub_F2a

TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC GCATATCAATAAGCGGAGGAAAAG GGTCCGTGTTTCAAGACGG RRHWACKTGACTDATRATACCAAA TCAWCWMGATGGCTTTTTTCAAC CCACAAATTTCACTACATTGA TAGGATTTCAAGATCCTGC GCCAAGTTCTGGGARGTSAT CCTGGTACTGCTGGTAYTCMGA GATCCACTCAACGAAGTACG CGGTAACAACTGGGCCAAGG

White et al. 1990

LSU rDNA coxI coxII Beta-tubulin

a

Primers used for sequencing only

products were purified by ethanol precipitation and analyzed using an ABI 3100 DNA Sequencer (Applied Biosystems, Inc.). For each PCR product, the two sequences obtained with the forward and reverse primers were assembled using the ChromasPro version 1.33 software (Technelysium Pty Ltd., Queensland, Australia), and the consensus sequences were used for alignment analysis. The nucleotide sequence data have been deposited in the DDBJ sequence database with the accession numbers listed in Table 2.

Phylogenetic analyses In total, two phylogenetic trees were constructed. Firstly, the rDNA ITS phylogenetic tree was constructed from 30 isolates, including the out-group Phytophthora nicotianae. Secondly, a combined tree was produced using sequences of four genes, the LSU rDNA, beta-tubulin, coxI and coxII genes from 23 isolates, including the out-group Phytophthora nicotianae. To produce the combined phylogenetic tree, we tried to include all known Phytopythium species. However, as we did not acquire the cultures for P. sindhum and P. sterilum, we did not include these species in the analysis. All sequences were first aligned using the multiple sequence alignment software SeaView version 4 (Gouy et al. 2010). Phylogenetic trees were generated by maximum likelihood (ML) and maximum parsimony (MP) phylogenetic analyses. The best-fit evolutionary model was determined for each data set by comparing different evolutionary models via the corrected Akaike information criterion (ALIc, Akaike 1974; Sugiura 1978) for MP and ML analyses. Kakusan4 (Tanabe 2011) and PAUP* version 4.0β10 (Swofford 2002) were used for likelihood calculation. The ML analysis was performed by the likelihood ratchet method (Vos 2003). For the ML tree search, 1,000 sets of 25 % site-upweighted data were estimated using Treefinder (Jobb et al. 2004) with application of the best-fit model.

O’Donnell 1993 Robideau et al. 2011 Martin and Tooley 2003 Blair et al. 2008

Kroon et al. 2004

MP analysis with the selected evolutionary model was done with Kakusan4 (Tanabe 2011) and PAUP* version 4.0β10 (Swofford 2002). MP analysis was performed for 1, 000 replications with different random starting points using the step-wise addition option to increase the likelihood of finding the most parsimonious tree. Alignment gaps were treated as missing data, and all characters were unordered and had equal weight. The branch-swapping algorithm was tree bisection and reconstruction (TBR). Branches of zero length were collapsed and all multiple, equally parsimonious trees were saved. The best tree was automatically selected using the Kishino-Hasegawa likelihood test (Kishino and Hasegawa 1989) that is part of the PAUP*. Tree length (TL), consistency index (CI), retention index (RI), and rescaled consistency index (RC) were calculated. The trees have been deposited in the TreeBASE database. http://purl.org/phylo/treebase/phylows/study/TB2:S16184?xaccess-code=c9bf3f29a0097c5a857b24e44cae7585& format=html Morphology and growth rate The position, shape and size of sporangia, the formation of zoospores, and the position, shape and size of antheridia, oogonia and oospores were determined in grass leaf blade cultures (Waterhouse 1967). Autoclaved grass leaf blades were placed on CMA or V8A medium inoculated with an isolate. After 1–2 days of incubation at 25 °C, colonized blades were transferred to autoclaved pond water (pond water: distilled water = 1: 2) and incubated at 20 and 25 °C. Growth patterns were observed on VG agar (V8A) medium after 7 days incubation at 25 °C in the dark. Mycelial growth was measured on three replicate plates of a medium containing equal qualities of corn meal agar (CMA). Each plate was inoculated with a 6-mm mycelial disk taken from the margin of a colony on CMA. The plates were incubated at 2, 3, 5, 10, 15, 20, 25, 28, 30, 35 and 40 °C. The radius of each colony

2 Page 4 of 12 Table 2


Accession numbers of the sequences of the rDNA ITS and LSU rDNA regions and the coxI, coxII and beta-tubulin genes

Species

P. aichiense P. chamaehyphon P. carbonicum P. citrinum P. cucurbitacearum P. delawarense P. helicoides

P. iriomotense

P. litorale P. sterilum P. megacarpum P. mercuriale P. montanum P. oedochilum P. ostracodes P. sindhum P. vexans

Isolates

GenBank accession number rDNA ITS

LSU rDNA

coxI

coxII

Beta-tubulin

CBS137195 CBS259.30 CBS112544 CBS119171 CBS748.96 382B CBS286.31 Roph3 H5 GUCC0025 GUCC0028 GUCC0036 CBS137104 NBRC107451

AB948197 AB690609* AB725876* AY197328* AB725877* AB725875* AB725878* AB690616* AB690611* AB690622 AB690623 AB690624 AB690629 AB690612*

AB948194 AB690593* AB996605 AB690597* AB690598* AB690591* AB690594* AB690589* AB690582* AB690600 AB690601 AB690602 AB690607 AB690583*

AB948191 AB690644* AB690648* AB690649* AB690650* AB690642* AB690645* AB690640* AB690633* AB690652 AB690653 AB690654 AB690659 AB690634*

AB948192 AB690674* AB690678* AB690679* AB690680* AB690672* AB690675* AB690670* AB690663* AB690682 AB690683 AB690684 AB690689 AB690664*

AB948170 AB948188 AB948183 AB948180 AB948189 AB948181 AB948187 AB948185 AB948186 AB948172 AB948171 AB948173 AB948174 AB948182

PE101 CBS112351 CBS122443 CBS111349 CBS252.70 CBS292.37 CBS768.73 CBS124518 2D111 NBRC107442 NBRC107393 NBRC107380 NBRC107381 NBRC107397

DQ217603* AB725881* AB725882* AB725883* AB690618* AB690619* AY598663* HM244825* AB725880* AB690626* AB690630* AB690627* AB690628* AB690610*

NA AB690584* AB690585* AB690586* AB690592* AB690595* AB690587* NA AB704203* AB690604* AB690608* AB690605* AB690606* AB690581*



NA AB948168 AB948179 AB948184 AB948175 AB948176 AB948178 NA AB948169 NA NA NA NA NA

* = Downloaded sequence data NA = Information is not available

was measured daily. Colony patterns were observed on V8A after 7 days of incubation at 20 or 25 °C in the dark.

Results Phylogenetic analyses The rDNA ITS sequences of the Iriomote and Aichi isolates were 789 and 846 base pairs (bp) long, respectively. The alignment data matrix of 18 taxa consisted of a total of 583 characters, of which 349 were conserved; 167 characters were phylogenetically informative for parsimony analysis, and 67 characters were not. MP analysis generated 228 equally parsimonious trees with a minimum possible length of 338 and maximum possible length of

1,448 (CI=0.619, RI=0.813, HI=0.381, RC=0.503). The topology of the tree generated by the maximum likelihood (ML) analysis (Fig. 1) was similar to that of the MP tree. As shown Fig. 1, the 18 taxa were divided into three monophyletic clades (Clade 1–3). For the combined data set containing the LSU rDNA and the beta-tubulin, coxI and coxII genes, the total sequences of the water and sludge isolates comprised 2,812 and 2,808 bp, respectively. The alignment data matrix of 16 taxa included 2,786 characters; of the 2,098 conserved characters, 200 were phylogenetically uninformative and 488 were phylogenetically informative for the parsimony analysis. The MP analysis generated two equally parsimonious trees with a minimum possible length of 867 and maximum possible length of 2,877 (CI=0.638, RI=0.755, HI = 0.362, RC = 0.482). The topology of the tree


Page 5 of 12 2

Fig. 1 Maximum likelihood tree of Phytopythium species produced using PAUP* and based on the rDNA ITS region. Numbers on the branches represent bootstrap values obtained from 1,000 replications (only values greater than 50 % are shown). Shaded isolates indicate the new species

GUCC0025 100/100

GUCC0028 GUCC0036

100/80

P. iriomotense sp. nov.

CBS137104 99/100 P. oedochilum CBS252.70

58/84

P. oedochilum CBS292.37

72/50

P. mercuriale CBS122443

P. boreale CBS551.88 100/99 P. megacarpum CBS112351 CBS137195

P. aichiense sp. nov.

Clade 1

P. citrinum CBS119171

95/92

P. litorale NBRC107451 P. sterilum PE101 94/98 88/85

P. delawarense 382B P. montanum CBS111349

99/99

P. carbonicum CBS112544

P. ostracodes CBS768.73 P. sindhum CBS124518 P. vexans NBRC107442 P. vexans NBRC107393

73/63

P. vexans NBRC107380 P. vexans NBRC107381 100/100

Clade 3

P. vexans NBRC107397 P. vexans 2D111 P. cucurbitacearum CBS748.96

99/88

0.02

generated by the maximum likelihood (ML) analysis (Fig. 2) was similar to that of the MP tree. As shown Fig. 2, the 16 taxa were divided into three monophyletic clades and the members of each clade were identical with those in the rDNA ITS phylogenetic tree for those strains included in both analyses (Fig. 2). In the rDNA ITS and combined phylogenetic trees, the Iriomote isolates GUCC0025, GUCC0028, GUCC0036 and CBS137104 were identified as a possible new species. These isolates formed a monophyletic group with high bootstrap support (100 %) in both the MP and ML analysis. The isolates showed high homology in the rDNA ITS region (> 99 %) and in the coxI gene (100 %) with each other. The Aichi isolate CBS137195 appeared to be a new species, as its rDNA ITS region clearly separates it from known species of this genus. On the other hand, based on the combined phylogenetic analysis, the Aichi isolate formed a clade with P. litorale.

P. chamaehyphon CBS259.30 P. helicoides CBS286.31 P. helicoides RoPh3 99/94 P. helicoides H5

Clade 2

Phytophthora nicotianae GF101

Taxonomy of the Iriomote isolate Phytopythium iriomotense M.A. Baten et K. Kageyama. sp. nov., MB808873 (Figs 3, 4a and 5) Colonies with chrysanthemum pattern on V8A. Growth on CMA between 10 and 35 °C, with optimum growth at 30 °C (rate of growth: 24.3 mm/per day). Hyphae hyaline and well branched. Sporangia globose to sub-globose with conspicuous apical papillae. Mean sporangium length and width: 32.7 ±4.3 and 25.8±3.7 μm (ranges: 27–42 and 18–31 μm), and length/width ratio 1.2. Sporangia terminal with internally nested and internally extended proliferation. Homothallic; Oogonia globose, smooth, mostly terminal, and occasionally intercalary with average diameter of 27.3±4.2 μm (ranges: 18–32 μm). Antheridia rarely amphigynous and regularly crook-necked in shape. Oospores aplerotic or plerotic with an average diameter of 24.4±3.8 μm (17–29) μm. Type: Japan, Okinawa Prefecture, Iriomote Island from river water, 2008, Collector Mingzhu Li. Isolate NBRC H-13237

2 Page 6 of 12


Fig. 2 Maximum likelihood tree of Phytopythium species produced using PAUP* and based on the LSU rDNA, beta-tubulin, coxI and coxII genes. Numbers on the branches represent bootstrap values obtained from 1,000 replications (only values greater than 50 % are shown). Shaded isolate indicate the new species

GUCC0036 100/99

GUCC0028 CBS137104

100/100

P. iriomotense sp. nov.

GUCC0025 P. oedochilum CBS252.70

75/73

100/99

P. oedochilum CBS292.37

P. mercuriale CBS122443 P. boreale CBS551.88

85/89

P. megacarpum CBS112351

Clade 1

100/100

P. ostracodes CBS768.63

100/97

100/100

P. carbonicum CBS112544 P. montanum CBS111349

99/100

CBS137195 P. aichiense sp. nov. P. litorale NBRC107451

97/89

P. citrinum CBS119171 96/96

P. delawarense 382B P. chamaehyphon CBS259.30

100/100 100/67

P. helicoides CBS286.31 P. helicoides Roph3

Clade 2

P. helicoides H5 100/100

P. cucurbitacearum CBS748.96 P. vexans 2D111

Clade 3

Phytophthora nicotianae GF101 0.01

holotypus (frozen dry specimen). Ex-type strains are NBRC107388 and CBS137104. DDBJ accession numbers of the rDNA ITS region, LSU rDNA, beta-tubulin, coxI and cox II gene sequences are AB690629, AB690607, AB948174, AB690659 and AB690689, respectively. Etymology: iriomotense refers to the location in Japan where the holotype was isolated. Morphological characteristics: We studied the morphological features of the four Iriomote isolates GUCC0025, GUCC0028, GUCC0036, and CBS137104. The observations reported here apply to all four isolates, and numerical data are derived from combined measurements from the four isolates. The sporangia formed in large numbers in water culture at 20– 25 °C. Mature sporangia were globose (Fig. 3a) to subglobose (Fig. 3b) with terminal and conspicuous apical papillae. The average length and width of the sporangia were 32.1± 3.8 and 25.7±3.4 μm (overall range: 24–39 and 19–32 μm) with a mean length/width ratio of 1.2. Zoospores were formed inside the vesicle, which discharged through a short tube (Fig. 3h). The sporangia proliferated internally nested (Fig. 3c and d) and internally extended (Fig. 3e). After internal

proliferation, hyphae developed secondary sporangia that formed zoospores (Fig. 3f). In the internally nested proliferation, the isolates commonly produce three-layered empty sporangia (Fig. 3d). Compound sympodia (Fig. 3g) and lateral hyphal swellings (Fig. 3i) were produced rarely in grass leaf blade culture. The isolates were homothallic in nature. Oogonia were produced abundantly in single culture. The oogonia were globose, smooth-walled, mostly terminal (Fig. 3j) and occasionally intercalary (Fig. 3k). The average diameter of the oogonia was (26.8±3.3 μm, overall ranges: 20–31 μm). The antheridia were diclinous with one to two antheridia per oogonium. The antheridial cells were crooknecked (Fig. 3l) and made apical contact to the oogonium. The species occasionally formed amphigynous antheridial cells (Fig. 3m). The oospores were occasionally double (Fig. 3n) but mainly single (Fig. 3j–m and o) in one oogonium; they were aplerotic or plerotic with an average diameter of 23.7±3.2 μm, ranging from 17 to 28 μm. Cultural characteristics: Colonies of the all Iriomote isolates were chrysanthemum pattern on V8A (Fig. 4a). Average radial growth was 24.7 mm per day at the optimum

Mycol Progress (2015) 14: 2 Fig. 3 Morphological characteristics of Phytopythium iriomotense. a Globose and papillated sporangia. b Subglobose sporangia. c, d Internally nested proliferation. e Internally extended proliferation. f Subsequent sporangia. g Compound sympodia. h Zoospore development. i Lateral hyphal swellings. j Globose, smooth and terminal oogonia. k Intercalary oogonia. l Crooknecked antheridial cell. m Amphigynous antheridial cells. n Double oospores with single oogonium. o Plerotic oospore. Bars, 20 μm

Page 7 of 12 2

a

b

c

d

e

f

g

h

i

j

k

l

m

n

o

temperature of 30 °C (Fig. 5). The minimum and maximum growth temperatures were 10 and 35 °C, respectively. Taxonomy of the Aichi isolate Phytopythium aichiense M.A. Baten et K. Kageyama. sp. nov., MB808874 (Figs 4b, 5 and 6). Fig. 4 Colony patterns of P. iriomotense (CBS137104) and P. aichiense (CBS137195). a P. iriomotense; b P. aichiense; V8A juice agar

Colonies with stellate pattern on V8A. Growth on CMA between 3 and 35 °C, with optimum growth at 28 °C. No hyphal swellings. Sporangia sub-globose, ovoid or limoniform, terminal with papillate and internal nested or internal extended proliferation. Mean sporangium length and width: 31.4±3.9 and 24.9±2.4 μm (ranges: 25–39 and 19– 27 μm), and length/width ratio 1.2. Homothallic; Oogonia

a

b

V8A

V8A

2 Page 8 of 12


Growth rate mm/per day

25 20 CBS137104 CBS137195

15 10 5 0 0

5

10

15 20 25 Temperature (ºC)

30

35

40

Fig. 5 Growth rates at different temperatures of P. iriomotense (CBS137104) and P. aichiense (CBS137195) on CMA

globose, smooth and terminal with average diameter of 34.3± 3.5 μm (ranges: 29–40 μm). Antheridial stalks shortbranched, mostly diclinous, and rarely monoclinous. One to two antheridial cells attached to a single oogonium. Fig. 6 Morphological characteristics of Phytopythium aichiense. a Sub-globose papillated sporangia. b Ovoid papillated sporangia. c Limoniform papillated sporangia. d, e Internally nested proliferation. f Internally extended proliferation. g, h Zoospore development. i Subsequent sporangia. j Crooknecked antheridial cell. k Inflated antheridial cells. l Diclinous antheridial stalks. m Monoclinous antheridial stalks. n Branched antheridial stalks. o Aplerotic oospore. Bars, 20 μm

Antheridial cells crook-necked or filamentous, inflated in shape. Oospores aplerotic with average diameter of 24.2± 4.9 μm. Type: Japan, Aichi Prefecture, from water purification sludge, 2011, Collector Koji Kageyama. Isolate NBRC H13211-holotypus (frozen dry specimen). Ex-type strains are NBRC110059 and CBS137195. DDBJ accession numbers of the rDNA ITS region, LSU rDNA, beta-tubulin, coxI and coxII gene sequences are AB948197, AB948194, AB948170, AB948191 and AB948192, respectively. Etymology: aichiense refers to the location in Japan where the holotype was isolated. Morphological characteristics: We studied the morphological features of the Aichi isolate CBS137195. The observations reported here apply to single isolate. Mycelia were hyaline, well branched and without hyphal swellings. Sporangia formed abundantly in water culture at 20–25 °C. Mature sporangia were usually sub-globose (Fig. 6a), ovoid (Fig. 6b) or limoniform (Fig. 6c), with apical papillae. The average length and width of the sporangia were 31.4±3.9

a

b

c

d

e

f

g

h

i

j

k

l

m

n

o

a

NA

19.7 mm/per day

Absent

Aplerotic or plerotic av. 24.4 μm Min 10 °C, optimum 30 °C and max 35 °C

86 %

Min 5 °C, optimum 25–30 °C and max 35 °C 9 mm/per day

Absent

Present

Smooth and globose, av. 29.8 μm Mostly diclinous, multiple knotted around the oogonia

Sub-globose to obovoid, papillated and terminal av. 22 μm Present Absent Internal or internal nested

P. mercurialeb

Van der Plaats-Niterink 1981, b Belbahri et al. 2008, c Paul 2000 and d Duan 1985

Daily growth rate on corn meal agar at 25 °C rDNA ITS homology

Cardinal temperature

Oogonia with double oospores Oospore

Antheridia

Oogonia

Smooth and globose av. 27.3 μm Diclinous, 1–2 per oogonium, crook-necked or occasionally amphigynous antheridial cells are present

Globose to sub-globose, papillated and terminal av. 32.7 μm Present Present Internal or internal nested

Sporangia

Hyphal swelling Compound sympodia Proliferation

CBS137104

86 %

20 mm/per day

86 %

8 mm/per day

Plerotic or nearly plerotic av. 32.5 μm Min 10 °C, optimum 30 °C and max 35 °C

Aplerotic av. 30.3 μm Min 10 °C, optimum 30 °C and max 35 °C

Globose to sub- globose, papillated and terminal av. 25–55 μm Absent Absent External, internal and internal nested Smooth and globose av. 35 μm Monoclinous, rarely diclinous, 1–2 per oogonium, antheridial cells are broadly laterally attached to the oogonium Absent

P. ostracodesa

Sub-globose, lemoniform, obovoid or ovoid, papillated av. 32.8 μm Absent Absent External, internal and internal nested Smooth and globose av. 32.8 μm Diclinous, occasionally monoclinous, 1–2 (4) per oogonium, cells were large, curved, and broadly laterally attached to the oogonium Absent

P. oedochiluma

Morphological description of Phytopythium iriomotense and the most closely related species

Organs/characters

Table 3

Plerotic av. 22.2 μm

Pleroticav. 26.8 μm

86 %

8–10 mm/per day

Min 15 °C, optimum 28 °C and max 35 °C

Absent

87 %

Min 4 °C, optimum 25–31 °C and max 43 °C 20 mm/per day

Monoclinous, rarely diclinous, 1–2 per oogonium, antheridial cells are amphigynous or sessil

Smooth and globose av. 22.5 μm

Present Absent Internal

Absent

P. borealed

Smooth and globose av. 28 μm Monoclinous, 1–2 per oogonium, antheridial cells are applied length-wise to a large portion of the oogonial wall Absent

Present Absent Internal

Absent

P. megacarpumc

Mycol Progress (2015) 14: 2 Page 9 of 12 2

93 % 94 %

Nechwatal and Mengden 2005, b Belbahri et al. 2005, c Paul 2004 and d Broders et al. 2009 a

91 % N/A

12 mm/per day 13.3 mm/per day 11.6 mm/per day

91 %

10 mm/per day

Absent Aplerotic av. 24.2 μm

Absent Plerotic or nearly plerotic av. 24.9 μm 11 mm/per day Absent Absent Branched antheridial stalks Oospore

Absent Type of antheridia

Daily growth rate on corn meal agar at 25 °C rDNA ITS homology

Absent

Absent Absent

Globose and smooth av. 27.2 μm Broad lengthwise contact Globose and smooth av. 27.6 μm Hypogynous Absent

Secondary sporangium after internal proliferation Oogonia

Hyphal swellings Proliferation

Globose and smooth av. 34.3 μm Crook-necked or filamentous inflated Present Aplerotic av. 24.2 μm

Absent

Present

Globose, lemoniform or (ob)void av. 32.5 μm Present Internal nested and internal extended Present Sub-globose, pyriform to lemoniform av. 24.2 μm Absent Internal extended

Subglobose, ovoid or ob-pyriform av. 28.5 μm Present Internal nested and internal extended Present Sub-globose, ovoid or limonoform av. 31.4 μm Absent Internal nested and internal extended Present Sporangia

Globose and pyriform av. 25.7 μm Present Internal nested and internal extended Present

P. citrinumc P. sterilumb P. litoralea CBS137195 Organs

It is worth noting that the identification of both P. iriomotense and P. aichiense is the result of more than 7 years effort, with the screening of more than 1,000 isolates from different prefectures of Japan. Morphological observation was used for screening and then the rDNA ITS region or the coxI gene was used for the representative isolates in the secondary steps. We described two new Phytopythium species isolated from river water and water purification sludge in Japan. The water isolates recovered from Iriomote island are morphologically distinct from other Phytopythium species, and are described here as Phytopythium iriomotense sp. nov. All four tested isolates are almost identical both morphologically and phylogenetically, irrespective of isolation year and location. They produce unique morphological characteristics, such as compound sympodia, crook-necked or amphigynous antheridial cells, and oogonia with double oospores (Table 3). P. iriomotense showed a close relationship with P. boreale, P. mercuriale, P. megacarpum, P. oedochilum, and P. ostracodes in the phylogenetic trees. The species is morphologically distinct from P. mercuriale, which forms oogonia surrounded by multiple antheridia (Belbahri et al. 2008). P. odochilum and P. ostracodes are distinguished from the

Morphological description of Phytopythium aichiense and the most closely related species

Discussion

Table 4

and 24.9±2.4 μm (overall range: 25–39 and 19–27 μm), with a mean length/width ratio of 1.2. The sporangia proliferated internally nested (Fig. 6d and e) and internally extended (Fig. 6f). Internal proliferation hyphae developed secondary sporangia that formed zoospores (Fig. 6i). Sporangial vesicles generally contained ∼30 zoospores (Fig. 6g and h): encysted zoospores were 9–10 μm in diameter. The species was homothallic in nature. Oogonia were produced abundantly in single grass leaf blade cultures of the isolate, and on CMA. The oogonia were globose, smooth-walled and terminal. The average diameter of the oogonia was 34.3±3.5 μm (overall range: 29–40 μm). The antheridial stalks were mostly diclinous (Fig. 6l) and occasionally monoclinous (Fig. 6m). One or two antheridial cells were attached to a single oogonium. The antheridial stalks were short-branched (Fig. 6n). The antheridial cells were crook-necked (Fig. 6j), making apical contact with the oogonium. The species also formed filamentous, inflated antheridial cells (Fig. 6k). The oospores were aplerotic (Fig. 6o) with an average diameter of 24.2±4.9 μm. Cultural characteristics: The colonies of the Aichi isolate showed stellate growth patterns on V8A (Fig. 4b). The optimum growth temperature was 28 °C on corn meal agar with an average radial growth of 12.3 mm per day (Fig. 5). The minimum and maximum growth temperatures were 3 and 35 °C, respectively. The Aichi isolate CBS137195 is a comparatively slowly-growing and low temperature-tolerant species of the genus.


P. delawarensed

2 Page 10 of 12


new species by its globose and lateral hyphal swellings, compound sympodia, crook-necked or amphigynous antheridial cells, and oogonia with double oospores. P. megacarpum and P. boreale do not produce zoospores (Paul 2000), whereas the new species produces globose zoospores in vesicles. The isolate CBS137195 that was recovered from water purification sludge in Aichi, Japan is described here as Phytopythium aichiense sp. nov. The isolate produces distinct morphological characteristics, such as crook-necked or filamentous, inflated antheridial cells, and short, branched antheridial stalks (Table 4). Phylogenetic analysis of the sludge isolate and more than 29 other isolates, representing 16 known and two putative new species based on five loci, validated the results of the morphological comparison. The new species is closely related to P. citrinum, P. delawarense, P. litorale and P. sterilum in the phylogenetic trees (Figs. 1 and 2). It is morphologically different from P. citrinum which forms pyriform to limoniform sporangia and amphigynous antheridial cells (Paul 2004). The new species forms crook-necked or filamentous, inflated antheridial cells and short, branched antheridial stalks, whereas P. delawarense does not. P. litorale and P. sterilum can be distinguished easily from the new species by the absence of sexual structures (Belbahri et al. 2005; McLeod et al. 2009; Nechwatal and Mengden 2005).

References Akaike H (1974) A new look at the statistical model identification. IEEE Trans Autom Control 19:716–723 Bala K, Robideau GP, Lévesque A, de Cock WAM, Abad ZG, Lodhi AM, Shahzad S, Ghaffar A, Coffey MD (2010) Phytopythium sindhum Lodhi, Shahzad & Levesque, sp. nov. Persoonia 24:136– 137 Belbahri L, Calmin G, Hernandez ES, Oszako T, Lefort F (2005) Pythium sterilum sp. Nov. isolated from Poland, Spain and France: its morphology and molecular phylogenetic position. FEMS Microbiol Lett 255:209–214 Belbahri L, Mcleod A, Paul B, Calmin G, Moralejo E, Spies CFJ, Botha WJ, Clemente A, Descals E, Hernandez ES, Lefort F (2008) Intraspecific and within-isolate sequence variation in the ITS rRNA gene region of Pythium mercuriale sp. nov. (Pythiaceae). FEMS Microbiol Lett 284:17–27 Blair JE, Coffey MD, Park S-Y, Geiser DM, Kang S (2008) A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genet Biol 45:266–277 Broders KD, Lipps PE, Ellis ML, Dorrance AE (2009) Pythium delawarii- a new species isolated from soybean in Ohio. Mycologia 101:232–238 Duan RL (1985) A new species and two new records of Pythium in China. Acta Mycol Sin 4(1):1–4 Fakhru’l-Razi A, Molla AH (2007) Enhancement of bioseparation and dewaterability of domestic wastewater sludge by fungal treated dewatered sludge. J Hazard Mater 147:350–356 Gouy M, Guindon S, Gascuel O (2010) SeaView version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol Biol Evol 27(2):221–224

Page 11 of 12 2 Hulvey J, Telle S, Nigrelli L, Lamour K, Thines M (2010) Salisapiliaceae-a new family of oomycetes from marsh grass litter of Southeastern North America. Persoonia 25:109–116 Jobb G, Von Haeseler A, Strimmer K (2004) TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics. BMC Evol Biol 4:18 Kageyama K (2010) Mycobiota in the subtropical and cool temperate areas in Japan. IFO Res Commun 24:117–156 Kageyama K, Senda M, Asano T, Suga H, Ishiguro K (2007) Intra isolate heterogeneity of the ITS region of rDNA in Pythium helicoides. Mycol Res 111:416–423 Kishino H, Hasegawa M (1989) Evalution of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominoidea. J Mol Evol 29:170– 179 Kroon LPNM, Bakkar FT, Van Den Bosch GBM, Bonants PJM, Flier WG (2004) Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genet Biol 41: 766–782 Lévesque CA, de Cock WAM (2004) Molecular phylogeny and taxonomy of the genus Pythium. Mycol Res 108:1363–1383 Martin FN, Tooley PW (2003) Phylogenetic relationships among Phytophthora species inferred from sequence analysis of the mitochondrially encoded cytochrome oxidase I and II genes. Mycologia 95:269–284 Matsumoto C, Kageyama K, Suga H, Hyacumachi M (1999) Phylogenetic relationships of Pythium species based on ITS and 5.8S sequences of ribosomal DNA. Mycoscience 40:321–331 McLeod A, Botha WJ, Meitz JC, Spies CFJ, Tewoldemedhin YT, Mostert L (2009) Morphological and phylogenetic analyses of Pythium species in South Africa. Mycol Res 113:933–951 Nechwatal J, Mengden K (2005) Pythium litorale sp. nov., a new species from the littoral of lake constance, Germany. FEMS Microbiol Lett 255:96–101 O’Dannell K (1993) Fusarium and its near relatives. In: Reyonolds DR, Taylor JW (eds) The fungal homomorpwh: miotic, meiotic and pleomorphic speciation in fungal systematics. CAB International, Wallingford, pp 225–233 Paul B (2000) ITS1 region of the rDNA of Pythium megacarpum sp. nov., its taxonomy, and its comparison with related species. FEMS Microbiol Lett 186:229–233 Paul B (2004) A new species of Pythium isolated from burgundian vineyarda and its antagonism towards Botrytis cinerea, the causative agent of the grey mould disease. FEMS Microbiol Lett 234:269–274 Peel MC, Finlayson, Mcmahon TA (2007) Updated world map of the Köppen -Geiger climate classification. Hydrol Earth Syst Sci 11: 1633–1644 Robideau GP, de Cock AW, Coffey MD, Voglmarr H, Brouwer H, Bala K, Chitty DW, Désaulniers N, Eggerrtson QA, Gachon CMM, Hu C-H, Küpper FC, Rintoul TL, Sarhan E, Verstappen ECR, Zhang Y, Bonants PJM, Ristaino JB, Lévesque CA (2011) DNA barcoding of oomycetes with cytrochrome c oxidase subunits I and internal transcriber spacer. Mol Ecol Resour 11:1002–1011 Subramanian BS, Yan S, Tyagi RD, Surampalli RY (2008) A new, pelletforming fungal strain: its isolation, molecular identification, and performance for simultaneous sludge-solids reduction, flocculation, and dewatering. Water Environ Res 80(9):840–852 Sugiura N (1978) Further analysis of the data by Akaike’s information criterion and the finite corrections. Comm Stat Theory Methods 7: 13–26 Swofford DL (2002) Phylogenetic analysis using parsimony. Version 4.0. Sinauer Associates, Sunderland Tanabe AS (2011) Kakusan4 and Aminosan: two programs for comparing nonpartioned, proportional, and separate model for combined molecular phylogenetic analyses of multilocus sequence data. Mol Ecol Resour 11:914–921

2 Page 12 of 12 Tao Y, Zeng F, Ho H, Wei J, Wu Y, Yang L, He Y (2011) Pythium vexans causing stem and rot of Dendrobium in Yunnan province, China. Phytopathology 159:255–259 Van der Plaats-Niterink AJ (1981) Monograph of the genus Pythium. Stud Mycol 21:1–242 Villa NO, Kageyama K, Suga H (2006) Phylogenetic relationship of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and β-tubulin gene sequences. Mycologia 98:410–422 Vos RA (2003) Accelerated likelihood surface exploration: the likelihood ratchet. Syst Biol 52:368–373

Mycol Progress (2015) 14: 2 Waterhouse GE (1967) Key to Pythium pringsheim. Mycol Pap 109:1–15 White TJ, Burns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocol: a guide of methods and applications. Academic, San Diego, pp 315– 322 Yang X, Richardson PA, Olson HA, Hong CX (2013) Root and stem rot of begonia caused by Phytopythium helicoides in Virginia. Plant Dis 97:1385