May 1, 1992 - software is quite flexible, and the management of stored ... Novel Nonradioactive Polymerase Chain Reaction-Based Assays of Dried Blood.
Table 7. Cuvette-Related Carryover Assay cuvettes
Mean,mmol/L
1-21: total blulrub$n
1-21: ureab (U1)
22-42: ur.ab(U2)
(7.52)
6.86 0.16
6.74
SD, mmol/L CV,%
0.11 2.33 1.63 Bias, %C 1.78 a Modified .Jendrasslk-Grotmethod; urea(additive) present In the reaction mixtureat -2.6 mol/L. b Determined with Axon reagents. C((U - 112)/U2]x 100.
SD of 5.57-5.72 mmol/L, for a negative carryover effect of 1.9%. Given the very low within-run SDs for these assays, we consider this type of carryover also to be insignificant. The negligible bias value reported in Table 7 for cuvette carryover documents that, even in the extreme assay conditions we used, there was no cuvetterelated carryover. This proves the high efficiency of the cuvette-washing procedure of the Axon system. Recovery in control sera. The mean values measured in the control sera were between 95% and 105% of the manufacturers’
assigned
values.
Discussion During the 5-month evaluation period, we collected -10 000 data points, encountering only one problem: the instrument stopped because of a malfunction of the
CLIN. CHEM. 38/10, 2100-2107
level-sensor of the reagent 1 probe, but this was solved within 24 h by the manufacturer’s service personnel. The operation proved to be simple, and maintenance was not time consuming. The results obtained proved the overall analytical reliability of the system, which is compact and easy to use on a 24-h basis. The instrument software is quite flexible, and the management of stored data allows valuable chances of control to the operator. The settings for the built-in methods are easily understandable; user-defined methods may also be applied easily. Moreover, the reagent configuration can be quickly modified, when desired, because of the software operations of loading/unloading methods. Thus, because of its reliability and practicability, we conclude that the Axon system is well suited for laboratories with various needs. We thank Laura Porati for the dedicated completion of the work. We also greatly appreciate the support of G. Tarenghi and A. Fumagalli (Scientific Dept., Bayer Diagnoatici SpA, Cavenago Brianza) for the statistical evaluation. experimental
References 1. European Committee for Clinical Laboratory Standards. Guidelines for the evaluation of analyzers in clinical chemistry, 3rd draft. Berlin: Beuth Verlag GmbH, ECCLS document Vol.3, no.2, June 1986. 2. Passing H, Bablok W. A new biometrical procedure for testing the equality of measurements from two different analytical methods. Application of linear regression procedures for method comparison studies in clinical chemistry, Part I. J Clin Chem Clin Biochem 1983;21:709-20. 3. Broughton PMG, Gowenlock AR, McCormack JJ, Neill DW. A revised scheme for the evaluation of automatic instruments for use
in clinical chemistry. Ann Olin Biochem 1974;11:207-18.
(1992)
Two Novel Nonradioactive Polymerase Chain Reaction-Based Assays of Dried Blood Spots, Genomic DNA, or Whole Cells for Fast, Reliable Detection of Z and S Mutations in the a1-Antitrypsin Gene Brage
Storstein
Andresen,’
Inga Knudsen,’
Peter
K. A. Jensen,2
Two new nonradloactive polymerase chain reaction (PCR)based assays for the Z and S mutations in the a1-antitrypsin gene are presented. The assays take advantage of PCRmediated mutagenesis, creating new diagnostic restriction enzyme sites for unambiguous discrimination between test samples from indMduals who are normal, heterozygous, or homozygous for the mutations. We show that the two assays can be performed with purified genomic DNA as well as with boiled blood spots. The new assays were validated by parallel testing
with a technique
in which PCR is corn-
1Molecular Genetic Laboratory, University Department of Clin-
ical Chemistry, Aarhus Kommunehospital
and Skejby Sygehus,
Kirsten
Rasmussen,2
and Niels Gregersen’
bined with allele-specific oligonucleotide (ASO) probes. In all cases tested the results obtained by the different techniques were in accordance. The new assays can be used for prenatal diagnostics and can be performed directly with boiled tissue samples. Because the new assays are easy to perform and reliable, we conclude that they are well suited for routine diagnosis.
AddItional Keyphrases: fetal status
heritable disorders allele-specific oligonucleotide probes compared a1-Antitrypsin (a1-AT) is a 52-kDa glycoprotein produced mainly in liver tissue.3 It serves as the major
DK-8200 Aarhus N, Denmark.
‘Institute of Human Genetics, University of Aarhus, DK-8000 Aarhus C, Denmark. Received January 24, 1992; accepted May 1, 1992. 2100
CLINICAL CHEMISTRY,
Vol.38, No. 10, 1992
8Nonstandard abbreviations: a1-AT, a1-antitrypsin; PCR, polymerase chain reaction; ASO, allele-specific oligonucleotide; and ARMS, Amplification Refractory Mutation System.
of neutrophile elastase, a powerful proteolytic stored in neutrophile leukocytes (1). a1-AT deficiency (reviewed in 2) is an autosomal recessive inherited disease, present in 1 in 1000 newborns in Northern Europe. Individuals with a1-AT deficiency are at risk of developing early-onset emphysema, because lack of the inhibitor leaves the structural framework of the lungs unprotected (3). In addition, patients homozygous for the Z mutation of the gene have an increased risk of developing liver disease in childhood, which may progress to cirrhosis and early death. Diagnosis of a1-AT deficiency is therefore important for estimating the risk for disease and for making recommendations for augmentation therapy. Furthermore, prenatal diagnosis of the Z mutation can be justified in certain families. In families with a1-AT deficiency in which serious cases of liver disease have been observed previously, the risk of a subsequent homozygous child developing liver disease inhibitor enzyme
is -40%
(4).
a1-AT deficiency results from a variety of mutations in the a1-AT gene. At least 17 different disease-associated mutations in this gene are currently known (2). In the vast majority of cases, the disease is caused by homozygosity for the Z mutation or by compound heterozygosity (Z mutation in one allele and S mutation in the other). The Z mutation (E342K) is a G#{176}89 to A transition in exon V of the a1-AT gene; the S mutation (E264V) results from an A7677 to T transversion in exon ifi (5, 6). The various
a1-AT genotypes have been identified by restriction fragment length polymorphism analysis (4, 7) of purified genomic DNA and by allele-specific oligonucleotide (ASO) probes (8). Since the development of the polymerase chain reaction (PCR), several PCRbased assays have been constructed, including PCR combined with ASO probes (9,10), direct sequencing of PCR-amplified DNA fragments (11), the Amplification Refractory Mutation System (ARMS) (12), and PCR combined with cleavage by RNase A (13). All of these assays have shortcomings for use in routine diagnosis. They are too laborious, involve the use of radioactivity, or are unreliable. To overcome these shortcomings, we have designed two new nonradioactive PCR-based assays to detect Z and S mutations in the a1-AT gene. The new assays are based on the principle of using PCR-mediated mutagenesis (14) to create new restriction enzyme sites; this enables discrimination between normal and mutation-bearing alleles by restriction enzyme digestion of PCR-amplified fragments. We previously used this technique to detect the most frequent mutation in the medium-chain acyl-CoA dehydrogenase gene (15, 16) and to detect the apoBlOO 3500 mutation in the gene for apolipoprotein B100 (17). Here we compare the new assays with the conventional ASO-probe assays for the Z and S mutations by typing purified genomic DNA from patients with diagnosed a1-AT deficiency, from patients with pulmonary emphysema, and from a family whose members exhibit both the Z and S mutations. We also show that the new assays can be performed directly with boiled blood spots,
making
diagnosis
fast and easy. Finally,
we report
use
of the new assays for prenatal diagnosis of two cases of a1-AT deficiency in the same family, and show that the new assays can also be performed directly with boiled samples of chorionic villus tissue. Materials and Methods Materials Primers for the PCR amplifications and oligonucleotide probes were synthesized with a DNA Synthesizer from Applied Biosystems Inc. (Foster City, CA). For the PCR amplifications we used an Automated Thermal Cycler from Perkin-Elmer Cetus (Norwalk, CT). Mononucleotides dATP, dCTP, dGTP, and dTP for the PCR amplification were from Sigma Chemical Co. (St. Louis, MO). Recombinant Taq polymerase was from PerkunElmer Cetus. Restriction enzymes Asp700 and TaqI were purchased from Boebrunger, Mannheim, FRG; XmnI was from Stratagene, La Jolla, CA. a1-Casein was obtained from Merck, Darmstadt, FRG. Acrylamides were from Serva Feinbiochemica, Heidelberg, FRG. The size marker was AC1857 DNA digested with DraI. Sources of DNA. Blood samples from patients with pulmonary emphysema, patients with a1-AT deficiency, and family members of family I and family II were collected by Kirsten Bruun Petersen, Gert Bruun Petersen, and Ronald Dahl. The typing of the emphysema patients and of family II was published previously (18). Material for the two cases of prenatal diagnosis in family ifi was collected by Peter Skovbo, Department of Gyneocology,
Alborg
Sygehus,
Alborg,
Denmark.
Procedures Preparation of DNA. Genomic DNA was isolated by standard methods (19) from blood samples, placental tissue, and chorionic viulus biopsies, and from cultured cells from the choriomc villus biopsies as well as from cultured cells from the aborted fetuses. Blood spots were prepared from either fresh or frozen blood (frozen from 1 week to 8 years) by applying -50 1L to thick Whatman filter paper. Filter paper pieces (2.5 x 2.5 mm) corresponding to 2-5 zL of blood were first fixed with methanol; the DNA was then liberated by boiling each piece in 50 L of sterile water for 15 miii (16). Either tissue samples (-2 mm3) from a chorionic villus biopsy or from cultured cells from chorionic tissue
were washed twice in a solution of, per liter, 0.1 mol of NaC1, 0.01 mol of Tris . HC1, and 1 mmol of ED’FA, pH 8.0. The samples were then boiled for 2 mm in 50 pL of a solution of, per liter, 0.1 mol of NaOH, 2 mol of NaC1, and 20 mL of Triton X-100. After centrifugation we used 1-2.5 L of the supernate for PCR amplification. PCR amplification.s. All PCR amplifications were performed with standard buffer (lOx amplification buffer: 0.5 mol of KC1, 0.1 mol of Tris HC1, 15 mmol of MgC12, and 0.1 g of gelatin per liter, pH 8.3) in a 100-1zL total volume primers,
containing DNA template, oligonucleotide dNTPs (20.0 nmol of dATP, dCTP, dGTP, and dT’FP), and 2 U of Taq polymerase. Before amplification, the PCR mixtures were overlaid with 75 pL of paraftln CLINICAL CHEMISTRY, Vol.38, No. 10, 1992
2101
Table 1. PCR CondItions ASO probe
Primers
PCR mutagenesis
pl+p2+p3+p4
of purified genomic DNA
p7553+ p7702 or
p7553+p7702
p9966+pl 0063 1 g of purified genomic DNA
p9966+pl
or 0063
Template
1g
Primeramount (each)
60 pmol
30 pmol
20 L of boiled blood spot or 2.5 of boiled tissue sample 15 pmol
I cycle of:
1 cycle of:
1 cycle of:
Cycling conditions
95#{176}C, 5 mm;
95#{176}C, 8 mm; 55#{176}C, 5mm; 72#{176}C, 5 mm; and
95#{176}C, 5 mm; 55#{176}C, 1 mm; 74#{176}C, 2 mm; and 3 cycles of: 95 #{176}C, 1 mm;
50#{176}C, 1 mm;
74#{176}C, 2 mm; and 34 cycles of:
29 cycles of: 95#{176}C, 1 mm; 55#{176}C, 2mm; 72#{176}C, 5mm; and 1 cycle of:
95#{176}C, 1 mm; 50#{176}C, 1 mm; 74#{176}C, 2 mm;
55 #{176}C, 1 mm;
74#{176}C, 2 mm; and 36 cycles of: 95#{176}C, 1 mm; 50#{176}C, 1 mm; 74#{176}C, 2 mm; and
and 1 cycle of:
74#{176}C, 9 mm
72 #{176}C, 9 mm
1 cycle of:
74#{176}C, 9 mm
oil. The details of the various described in Table 1.
PCR amplifications
are
A blank amplification containing all reagents but no sample DNA was always included in the experiments to check for the presence of contaminating DNA from
cloned or previously amplified DNA. PCR combined with ASO probe analysis for the Z and S mutations. A 148-bp fragment containing the region harboring the site for the S mutation and a 139-bp fragment harboring the Z mutation site were co-amplified in one PCR procedure with use of the four oligonucleotide primers p1, p2, p3, and p4 (Table 2). After the amplification, l-.tL samples of the PCR mixture, containing the two amplified fragments, were denatured and applied at corresponding positions on four Zeta nylon membranes. The membranes were hybridized separately with each of four different Ey-32P]ATP endlabeled ASO probes. Two probes were used for each of the two mutations: one probe with the normal sequence (Sn-probe or Z-probe) and one probe with the mutant sequence (S5-probe or Zz-probe) (Table 2). After hybridization, the membranes were washed separately at low stringency, followed by stringent washing at tempera-
tures specific for each probe. The bound probes were made visible by autoradiography. Details of the ASO probe analysis for the S and Z mutations in PCRamplified DNA were described previously (9,18). PCR amplification mutagenesis and diagnostic restriction enzyme digestion for the Z and S mutations. The principles of the new assays are described in Figure 1. For convenience we optimized both assays so that the 2102
CLINICALCHEMISTRY,Vol.38, No. 10, 1992
Table 2. Oligonucleotldes In the Assays S mutation primers p1 5’-CAATGCCACCGCCATCTrCTrCCTGCCTG-3’ p2 p7553
p7702
5’-TGTGGGCAGCTFCTrGGTCACCCTCAGGT-3’
5’-CGmAGGCATGAATAACTI-CCAGC-3’ 5’-GATGATATCGTGGGTGAGAACA1Tr-3’
Z mutation primers p3
5’-CCTGGGATCAGCCTTACAACGTGTCTCTG-3’
p4 p9966
5’-CGGGGGGGATAGACATGGGTATGGCCTCT-3’ 5’-ATAAGGCTGTGCTGACCATCGTC-3’
p10063
5’-GAACTFGACCTCGAGGGGGATAGAC-3’
ASO probes for the S mutation site
SM S
5’-CAGCACCTGGAAAATGAACTC-3’ 5’-CAGCACCTGGIAAATGAACTC-3’
ASO probes for the Z mutation site ZM 5’-ACCATCGACGAGAAAGGGACT-3’ Z 5’-ACCATCGACAAGAAAGGGACT-3’ Nucleotides corresponding to the mutation site are underlined.
amplifications could be performed with the same PCR program. Thus, the two assays can be performed simultaneously, making diagnosis for the two mutations easier. In the S mutation assay, the p7702 primer (antisense) contains an AA instead of a TT dinucleotide at position 7683-7684. This change results in the creation of a XmnI site (GAANNNNTFC) when the normal sequence is copied by PCR, because a T is inserted at position 7677. Alleles with the S mutation instead have an A at
( +1-
XmnI
3’ -‘TTIACAAGAGTGGCTGCTATAGTAG 5’-
GAAcCGTTTAGGCATGTTTAACATCCACC1GGG--J\--
Template
:
3’-
:
:
-5
GAAATGAACTCACCCACCATA1CATCACCA
:
%,/t’
CTTCGCAAATCCCTACAAATTGTACGTCCACCC
:
primer
7702
-3’ :
CATTTACTTGAGTGGGTCGTATAGCAGTGCT-5’ 7677
poe.
7553
Primer
5’-
CGTTTAGCCATGAATAACTTCCAGC
(
-3’
XmnI
1 Xmnl
8-ALLELE
PCR
-
M-ALLELE
.
and/or -
x:nI
XmnI
S-ALLELE
XIbnI 133 bp
and/or
U-ALLELE
149 bp 149 bp
-
-
111 bp
.
( Taqi p08.9989
Template primer
5’9966 3’-
TGCATAACGCTCTGCTCACCATCGACAGA.._ ACCTATTCCCACACGACTCG1ACCTCTCT__ ATAAGGCTGTCCTCACCATCGTC -3’ (+/-
I
PCR
, ‘
-
---
CATGTCTATCCCCCCCCACGTCAAGTTCAACA CTACACCTAGGCCCGGCTCCACTTCAAGTTGT
primer
10063
-3’ -5’
Taq.I)
_#{149}3 Taqi
-
Ia,u
U-ALLELE
V
-5’
‘I,
9966.
Z-ALLELE
3’- CAGATAGCGGCAGCTCCAGTTCAAG
97 bp
-
and/or
-
-
97 bp
I
86 bp
Taq I
Z-ALLELE
I
and/or U-ALLELE
64 bp
‘
Fig. 1. Principle of the assay forthe S mutation (upper panel) and for the Z mutation (lower pane!) Upper pane!: In the S mutation assay,PCR amplification with the two primers p7553 and p7702 produces a 149-bpfragment of axon Illof the a1-AT gene. The p7702 primerIntroduces a diagnostic Xmnl she (GAANNNNTI’C)only in the PCR product from normal alleles but not In that from alleles bearing the S mutation. The presence or absence of this Xmnl site makes It possibleto distinguish between PCR-ampllfled normaland S mutation-bearing alleles aftercleavagewithXmnl followed by polyacrylammdegel electrophoresis. The p7553primerintroduces a Xrnnl site In all amplification products; therefore, thIs site serves as an Internal control for the restrictionenzymecleavage. Aftercleavage with Xmnl, amplified S mutation-bearing alleles are 133 bp and amplIfied normal alleles are 111 bp. Lower pane!: Inthe Z mutation assay, PCR amplification with the two primers p9966 and p10063 produces a 97-bp fragment of exon Vol the a1-AT gene. The p9966 prImer Introduces a Taql sIte (TCGA) only mnthe PCR product from normal alleles but not Inthat from alleles beating the Z mutation. The presence or absence of this Taql site makes Itpossible to distinguish between normal and Z mutation-bearing alleles after cleavage with TaqI followed by polyactylamlde gel electrophoresls. The p10063 primer introduces a Taql site in all PCR products; therefore, this Taql site serves as an internalcontrol for restriction enzyme cleavage.
After cleavage with Taql, amplified Z mutation-bearing alleles are 86 bp and amplified normal alleles are 64 bp
this position; therefore, the restriction enzyme site is not created when they are copied. The nucleotides U at positions
position
7565
and
7566
are changed
to AA,
and A at
7571 is changed to T by the p7553 primer (sense), thus creating an XmnI site in both amplified normal and mutation-bearing alleles. This site serves as an internal control of restriction enzyme digestion. In the Z mutation assay, the p9966 primer (sense) contains a T instead of an A at position 9986. This change creates a TaqI site (TCGA) when the normal sequence with a G at position 9989 is copied, but not when the Z mutation sequence with an A at position 9989 is copied. By changing the G at position 10050 to
an A, the p10063 primer (antisense) creates a TaqI site, which serves as an internal control of cleavage efficiency in all alleles copied. The primer sequences, with the mismatching nucleotides underlined, are shown in Table 2. Before the restriction enzyme digestion, we tested the performance of the PCR procedure, including the “blank” amplification, by subjecting samples of the PCR products to electrophoresis in a 3% agarose gel. Restriction enzyme digestion. Samples of 7-20 L were digested overnight in a 50-ML total volume containing 5 ML of a1-casein (1 g/L) and 10 U of the respective restriction enzyme. After 14-16 h, we added CLINICAL CHEMISTRY,
Vol.38, No. 10, 1992
2103
10 U more of enzyme and continued the digestions for 1-2 h. For digestion with XmnI, we used the buffer recommended by the supplier. For digestion with TaqI, we found the best results with lx low-salt buffer at 65#{176}C (lOx low-salt buffer: 0.1 mol of MgC12, 0.01 mol of dithiothreitol, and 0.1 mol of Tris HC1 per liter, pH 7.5). Afterwards, we electrophoresed the digested samples and undigested samples in 16% polyacrylamide gels, staining the bands with ethidium bromide.
gous for the Z mutation
Results
zyme, Asp700. Despite testing several different buffers and various amounts of restriction enzyme, we found that optimal cleavage efficiency could be achieved only with the XmnI enzyme. Thus, in cases where different isoschizomeric restriction enzymes can be used, it might be advantageous to test the performance of all alternative enzymes. To be able to diagnose the two mutations more quickly and easily, we optimized the PCR conditions so
Using various sources of DNA, we found that the two new assays functioned well and were reliable. To compare the performances of the new assays with the conventional PCR/ASO probe assays, we used both methods to test purified genomic DNA from family I. The results of the typing for the S mutation (Figure 2) and the Z mutation (Figure 3) with the new assays (A panels) and the PCRJASO probe assays (B panels) were identical in all family members. With the S mutation assay, homozygous persons showed only one band of 133 bp (Figure 2A, lane C3), persons who did not have the S mutation showed only one band of 111 bp (Figure 2A, lane Cl), and persons heterozygous for the S mutation showed both the 133-bp band and the 111-bp band (Figure 2A, lane C2). In the Z mutation assay, a single band of 86 bp was seen when the person was homozygous for the Z mutation (Figure 3A, lane C4), a single band of 64 bp was seen when the person did not have the Z mutation (Figure 3A, lane Cl), and persons heterozy-
the
64-bp
illustrates
1
2
7’
3A,
lane
C2).
This
clearly
who are heterozygous for the respective mutations can be distinguished unambiguously from normal persons and from subjects who are homozygous for the mutation in question. Note that alleles with the S mutation will appear “normal” in the Z mutation assay, and vice versa. During optimization of the S mutation assay, we also tested the performance of the XmnI isoschizomeric en-
the new assays could be performed directly with DNA liberated from boiled blood spots (Guthrie cards). Because the amounts of DNA liberated from blood spots are generally very low and variable, we needed to make the PCR amplification more specific (Table 1). To optimize the new assays, we used blood spots obtained from family members from family II, a family previously examined by isoelectric focusing and by the PCRJASO probe assay (18). A comparison of the genotypes based
that
A C1CC3C4
showed both the 86-bp band and
band (Figure that individuals
C,C2C3C4 I
I
1 I
23456
I
7 I
I
I
B I
BUG I
8 1UC, C31
Z
97 bp 86bp
U
64bp
S U C,
B
,
234
I
2
I
I
I
6
C2
C3
C4
56
234
7
7
#{149}..#{149}.S#{149}
Sm
#{149}#{149}S*.
Zz
Ss U/U U/S S/S Z/Z M/S U/Z S/Z MIZ S/Z U/S MIZ
FIg. 2. New PCR-based assay (A) and conventional PCR/ASO probe assay (B) compared for typing purified genomic DNA from family I for the S mutation (A) Ethidlum bromide-staIned polyacrylamide gel after electrophoresis of Xmnl-digested and undigested PCR products: UC, uncleaved PCR product; C,, control MM; C2, control MS; C3. control SS; C.4. control ZZ; B, blank amplIfication. Lanes 1-7, family members 1-7 from family I:!, MS; 2, MZ; 3, SZ; 4, MZ; 5, SZ; 6, MS; 7, MZ. The uncleaved PCR product is 149 bp.
Cleaved S mutation-bearing fragments are 133
bp and cleaved fragments with normal sequence are 111 bp. (B) Autoradiography of fIltershybridized with either normalprobe (SM)or mutant probe(S5). C,, controlMM;C3. control MS; C3.control SS; C4, control ZZ. Lanes 1-7: family members 1-7 from family I
2104
I
CLINICAL CHEMISTRY,Vol.38, No. 10, 1992
M/M M/Z
S/S Z/Z
M/S
MIZ
S/Z
M/Z
#{149} S/Z MIS MIZ
FIg. 3. New PCR-based assay (A) and conventional PCR/ASO probe assay (B) compared for typingpurifiedgenomic DNA from familyI forthe Z mutation (A) Ethidium bromide-stained polyacrylamide gel after electrophoresis of Taq I-digested and undigested PCR products: UC, uncleaved PCR product C,, control MM; C3. control MZ; C3. controlsS; C control ZZ; B, blank amplification. Lanes 1-7, familymembers 1-7 from family 1:1, MS; 2, MZ; 3, SZ: 4, MZ;5, SZ; 6, MS; 7, MZ.The uncleaved PCR product ls97 bp. Cleaved Z mutation-bearing fragments are 86 bp; cleaved fragments with normal sequence are 64 bp. (B) Autoradiography of filters hybridized with either normal probe (4,) or mutant probe (Zr). C,, control MM;C3. control MZ; C3. control SS; C,4,control ZZ. Lanes 1-7, family members 1-7 fromfamily I
The results were compared with results obtained previously (18, and unpublished results), when genomic DNA samples from the same patients were tested with the traditional PCRJASO probe assays. In all cases, the
IJI UCC1C2C31 I
I
2 I
I
34 I
results
5 6 7 8 9 BUC a a I I
I
149 bp
S
133 bp
M
111 bp
UCC1C2C3 I
I
I
1 2 I
3 4 I
I
5 6 I
I
7 8 I
I
I
I
I
I
z
M
Fig. 4. S mutation assay (upper electropherogram) and Z mutation assay (lower electropherogram) performed on blood spots from family II Ethldlum bromide-stained polyacrylamide gel after electrophoresis of Xmnldigested and undigested PCR products: UC, uncleaved PCR product; C,, control MM;C3. control SS; C3. control ZZ; B, blankamplification. Lanes 1-9, family members 1-9 from family II
on the results obtained by the PCR’ASO probe assays of purified genomic DNA (summarized in Figure 4) with the results obtained by the new methods for assays of blood spots (Figure 4) shows that the diagnoses totally agree. Moreover, the results obtained when the two new assays are performed with blood spots (Figure 4) are just as easy to interpret as the results obtained by the new assays performed with purified genomic DNA from members of family I (Figures 2 and 3). Purified genomic DNA samples blood spots) from 16 patients with pulmonary emphysema and from nosed a1-AT deficiency were tested
with
the
two
new
assays
were
in
assays.
9 B B 4 UC I
obtained
complete accordance with the results obtained previously. The age of the blood spots or of the frozen blood did not seem to influence the performance of the two
(in some cases also a clinical history of
8 patients with diagwith the new assays.
After having confirmed the good performances of the new assays, we used them for prenatal diagnoses. Family III had previously had a seriously affected child, who is homozygous for the Z mutation. By testing purified genomic DNA from the parents and the index patient, we confirmed the previous diagnosis (obtained by the PCR/ASO probe assay), showing that the parents are heterozygous carriers (Figure 51, lanes 1 and 2) and that the index patient is homozygous for the Z mutation (Figure 51, lane 3). The first prenatal diagnosis was performed with purified genomic DNA from chorionic villus biopsies obtained from each of two dizygotic twin fetuses. In the Z mutation assay, the DNA from both fetuses displayed a single band at 86 bp (Figure 51, lanes 4 and 5), showing that both samples were homozygous for the Z mutation. On this basis, the parents chose to abort the twin fetuses. After termination of the pregnancy, the diagnosis was verified in DNA samples from cultured cells of the aborted fetuses (Figure 5t, lanes F1 and F2) and in DNA prepared from a sample of placental tissue obtained after the abortion (Figure 5!, lane P). The second prenatal diagnosis was performed 4 months later in a new pregnancy of the mother in the same family (family Ill). This time we performed the diagnosis with DNA isolated from a chorionic villus biopsy of the fetus (Figure 511, lane CVA) and directly with a boiled sample of the same chorionic villus biopsy (Figure 511, lane CVB). We also assayed DNA isolated from cultured cells from the choriomc villus biopsy (Figure 511, lane CV) and directly boiled samples of the cultured cells (Figure 51!, lane CVD). Because only the 64-bp band was observed in all the fetal samples, we concluded that this fetus was homozygous for the normal allele and the pregnancy was continued.
I II
I11
UC C4 C C6 C7
1
2 CVACVBCVCCVD B UC C7 I
I
z
I
I
I
I
‘
‘
I
z
M
M
FIg. 5. Prenatal diagnosis in family IIIperformed with the new assay for the Z mutation Ethidiumbromide-stained polyacrylamidegel after electrophoresis of Taql-digested and undigested PCRproducts. (I) Farstprenatal diagnosis: C,, control MM;C3. control SS; C3.controlZZ; B, blank amplification; UC, uncleaved PCR product. Lane 1, mother; 2, father; 3, indexpatient; 4,5, chorionacvillus DNAfrom the twin fetuses; F,, F2, DNAfrom cultured cells of the abortedtwin fetuses; P. placental DNA from the aborted twin fetuses. (II) Second prenatal diagnosis: UC, uncleaved PCR product; C control MM;C5. control MZ;C controlSS; C7, controlZZ. Lane 1, father; 2, mother; CV3. chorionic viHusDNAfrom the fetus; CV whole cells from the chodonic villus biopsy; CV(> DNAfrom the cultured cells from the chorionic villusbiopsy; CVI.,.cultured cells from the chorionic villus biopsy; B, blank amplification
CLINICALCHEMISTRY,Vol.38, No. 10, 1992
2105
The S mutation assay showed only a single band of 111 bp in all samples tested (results not shown). Therefore, we concluded that all samples were normal with respect to this site. DiscussIon Diagnosis of a1-AT deficiency has traditionally been on isoelectric focusing and measurement of the a1-AT protein concentration in serum. This method is fast and simple, but interpretation of the banding pattern obtained by isoelectric focusing is difficult and requires specially trained personnel. Alternative methods of diagnosis involve determination of the diseasecausing mutations in DNA samples by PCR-based assays (9-13). The most widely used techniques for this are PCR combined with ASO probes and the ARMS assay. PCR combined with ASO probes for the Z and S mutations (9) is very reliable, but is labor intensive; for routine use, it requires the use of two radioactively labeled probes. Nonradioactive (biotin-labeled) probes have also been used (10), but this system is not sufficiently robust for routine use. The ARMS assay (12) may seem like a good alternative to the PCRJASO probe assays: it is nonradioactive and is more easily performed. Interpretation of the results obtained with the ARMS technique is based on distinguishing between successful amplification and failure to amplifr in pairs of reactions. We previously tried using the ARMS technique to detect the S and Z mutations, as described by Newton et al. (12), but in routine use the diagnosis was not always reliable, even though an internal control for amplification was included. It became clear that the presence of a band was often determined by the initial amount of DNA template present and by how many cycles of PCR were performed. Consequently, the ARMS method does not seem suited for use with blood spots as the source of DNA, because the amounts of DNA released from blood spots are generally low and variable. As a compromise between ease of performance and reliability, we had until recently considered PCR combined with radioactively labeled ASO probes as the method of choice for routine diagnosis of the Z and S mutations (18, 20). However, radiolabeled ASO probes are expensive and the procedure is laborious. The new assays presented here alleviate these drawbacks. Moreover, in the families studied, the results obtained with the new assays agreed with the PCR/ASO probe assays, and identical segregation was found. Total agreement between results obtained with the new assays and with the PCR/ASO probe assays was also found for tests involving an additional 24 patients. We therefore conclude that the two new assays presented here are just as reliable as the PCRJASO probe assays, and may therefore be used for routine diagnosis. We have also shown that the new assays can be used for carrier detection and prenatal diagnosis in an affected family (family LII). The results obtained for family III illustrate that prenatal diagnosis for a1-AT defibased
2106
CLINICAL CHEMISTRY. Vol. 38, No. 10, 1992
ciency can be performed with DNA from chorionic villus biopsies. Moreover, the fact that one can perform the two new assays directly on choriomc villus samples means that the assays can be performed very quickly, because the DNA need not be purified before analysis. Furthermore, the new assays, in contrast to the ARMS method, can be performed with boiled blood spots to give unambiguous results. This advantage makes the new assays very rapid indeed, because no purification of genomic DNA is required. The use of blood spots is also desirable because they are easier to ship and store than are blood samples. In our experience, the most critical step in the new assays is the restriction enzyme digestion step. There-
fore, when constructing the assay, great care should be taken to ensure that the preconditions for complete digestion are as good as possible-avoiding production of primer-dimer product in the PCR, and choosing the optimal restriction enzyme site to create without limiting whether the restriction enzyme site should be created in the mutant sequence or in the normal sequence (21). Another very important element that is often ignored (22-25) is inclusion of control sites for restriction enzyme cleavage. Including a control site will indicate
when digestion is incomplete, thereby avoiding problems with false-negative or false-positive results. The control sites in our assays are placed in such a way that the cleaved-off fragments are a different size (16 bp in the S assay and 11 bp in the Z assay) from the fragment cleaved off at the mutation site (22 bp in both the S and Z assays). Given this difference in fragment sizes, we can distinguish unambiguously between cases of incomplete digestion and true heterozygosity. In contrast to the problems we encountered in optimizing the restriction enzyme digestion step, the PCR amplification step was less difficult to optimize. Even when one of the primers contained a mismatch as close as at position 2 from the 3’-terminus (p9966 primer in the Z mutation assay) or had as many as three mismatching nucleotides located in the middle (p7553 primer in the S mutation assay), successful amplification was easy to attain. Because PCR can tolerate rather drastic mismatching, we believe it would be easy to manipulate the sequences around any given mutation site by PCRbased mutagenesis in such a way that the sequences can be recognized and discriminated by restriction enzymes. This belief has thus far been corroborated by the fact that the method has been used to detect mutations in the genes for -globin (21), cystic fibrosis (22), cystic fibrosis and rhodopsin (retinitis pigmentosa) (25), apoB100 (17, 23,24), and medium-chain acylCoA dehydrogenase (15, 16). Therefore, we postulate that this method can be universally applied for detection of point mutations and small insertions or delelipoprotein
tions. This work was supported by the Danish Medical Research Council and the Danish Center for Human GenomeResearch. We thank Lars Bolund for helpful discussion of the manuscript.
References 1. Carell RW, Jeppeaon J, Laurell C, et al. Structure and variation of human a-1-antitrypein. Nature 1982298:329-33. 2. Crystal RG. a-1-Antitrypain deficiency, emphysema, and liver disease. J Clin Invest 1990;85:1343-52. & Janoff A. Elastases and emphysema: current assessments of the protease-antiprotease hypothesis. Am Rev Respir Dis 1985;132: 417-33. 4 Cox DW, Mansfield T. Prenatal diagnosis of alpha-1-antitrypsin deficiency and estimates of fetal risk for disease. J Med Genet 1987;24:52-9.
5. Kurachi K, Chandra T, Friezner Degen SJ, et al. Cloning and sequence of cDNA coding for a-1-antitrypain. Proc Natl Acad Sci USA 1981;78:6826-30. 6. Long GL, Chandra T, Woo SLC, Davie EW, Kurachi K. Complete sequence of the cDNA for human al-antitrypsin and the gene
for the S variant.
Biochemistry
1984;23:4828.-37.
7. Matteson KJ, Ocher H, Chatravsrti A, et al. A study of restriction fragment length polymorphisms at the human alpha1-ant tryp8m locus. Hum Genet 1985;69:263-7. 8 Kidd VJ, Golbus MS, Wallace RB, Itskura K, Woo SLC. Prenatal diagnosis of alpha-1-antitrypein deficiency by direct analysis of the mutation site in the gene. N Engl J Med 1984;310639-42. 9. Petersen KB, K#{248}lvraa S, Bolund L, Petersen GB, Koch J, Gregersen N. Detection of alfa-1-antitrypsin genotypes by analysis of amplified DNA sequences. Nucleic Acids Res 1988;16:352. 10. Gregersen N, Winter V, PetersenKB, et al. Detection of point mutations in amplified single copy genes by biotin labelled oligonucleotides: diagnosis of variants of alfa-1-antitrypsin. Clin Chim Acta 1989;182:151-64. 11. Newton CR, Kalsheker N, Graham A, et al. Diagnosis of a-1-antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products. Nucleic Acids Res 1988;17:8233-43. 12. Newton CR, Graham A, Heptinstall LE, et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Rae 1989;17:2503-.16. 13. Abe T, Takahashi H, Holmes MD, Curiel DT, Crystal RG. Ribonuclease A cleavage combined with the polymerase chain reaction for detection of the Z mutation of the alpha-1-antitrypsin gene. Am J Respir Cell Mol Biol 1989;1:329-34. 14. Haliasaoe A, Chomel JC, Tesson JL, et al. Modification of enzymatically amplified DNA for the detection of point mutations.
Nucleic Acids Res 1989;17:3606.
15. Gregersen N, Andresen BS, Bross P, et al. Molecular characterization of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency: identification of a Lys3 to Glu mutation in the MCAD gene, and expression of inactive mutant protein in E. coli. Hum Genet 1991;86:545-.51. 16. Gregersen N, Blakemore AJF, Winter V, et a!. Specific diagnosis of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency in dried bloodspots by a polymerase chain reaction (PCR) assay detecting a point mutation (G985) in the MCAD gene. Clin Chim Acta 1991;203:23-34. 17. Hansen PS, Rudiger N, Tybjrg-Hansen A, Frgeman 0, Gregersen N. Detection of the apoB-3500 mutation (glutamine for arginine) by gene amplification and cleavage with M8p1. J Lipid Res 1991;32:1229. 18 Petersen KB, PetersenGB, DahI R, et al. Alfa-1-antitrypein alleles in patients with pulmonary emphysema, detected by DNA amplification (PCR) and oligonucleotide probes. Eur Reapir J 1992;5:531-7. 19. Gustafson
S, Prober JA, Bowie EJW, Sommer SS. Factors affecting the yield of DNA from human blood. Biochemistry 1987;165:294-9. 20. Schwartz M, Petersen KB, Gregersen N, Hinkel K, Newton CR. Prenatal diagnosis of alpha-1-antitrypsin deficiency using polymerase chain reaction (PCR). Comparison of conventional RFLP methods with PCR used in combination with allele-specific oligonucleotides or RFLP analysis. Clin Genet 1989;36:419-26. 21. Lundeman R, Hu SP, Volpato F, Trent RJ. Polymerase chain reaction (PCR) mutagenesis enabling rapid non-radioactive detection of common -thalassaemia mutations in Mediterraneans. Br J Haematol
1991;78:100-4.
22. Friedman KJ, Highsmith E Jr, Silverman LM. Detecting multiple cystic fibrosis mutations by polymerase chain reactionmediated site-directed mutagenesis. Cliii Chem 1991;37:753-5. 23. Geisel J, Schleifenbaum T, WeiBhaar B, Oette K. Rapid diagnosis of familial defective apolipoprotein B 100. Eur J Clin Chem Clin Biochem 1991;29:395-9. 24. Schwartz El, Shevtsov SP, Kuchinski AP, Kovalev YP, Plutaby OV, Berlin YA. Approach to identification of a point mutation in apo B100 gene by means of a PCR-mediated site-directed
mutagenesis. Nucleic Acids Res 1991;19:3752. 25. Sorscher EJ, Huang Z. Diagnosis of genetic disease by primerspecified restriction map modification, with application to cystic fibrosis and retinitis pigmentosa. Lancet 1991;337:1115-8.
CLIN. CHEM. 38/10,2107-2110(1992)
Standardization with Synthetic 22-kDa Monomer Human Growth Hormone Reduces Discrepancies between Two Monoclonal Immunoradiometric Assay Kits Gluseppe
Banfi,
Marcello
Marinelli,
Marina
Pontillo,
and Pierangelo
Discrepancies among different methods for assaying human growth hormone have been described in various studios. The two major sources of discordant results are the heterogeneity of the antibodies and the different standardization bases used by the assay manufacturers. We propose standardizing assays with 22-kDa biosynthetic monomer human growth hormone diluted with the diluents supplied by the kit manufacturers. In a study of two monoclonal immunoradiometric assays (Hybritech, specific for the 22-kDa Laboratorio Analisi, Istituto Scientifico H. S. Raffaele, Olgettina 60,20132 Milan, Italy. Received January 13, 1992; accepted May 1, 1992.
Via
Bonini
recognizing also a 20-kDa variant horwith 22-koa monomer human growth hormone reduced by 63% the differences in results for 44 serum samples from children. The use of 22-Wa human growth hormone as a common standard, highly pure and easily available in large quantities, could help limit the interpretative problems in growth diagnostics. monomer;
Sotin,
mone), standardization
AdditionalKeyphrasee:variation, source of
-
somatotropin
Disagreement and discrepancies among different methods for assaying human growth hormone (hGH, somatotropin) have been reported by various researchCLINICAL CHEMISTRY, Vol. 38, No. 10, 1992
2107
