universita' degli studi di padova - Padua@Research - Unipd

UNIVERSITA' DEGLI STUDI DI PADOVA ___________________________________________________________________ DOCTORATE SCHOOL OF CROP SCIENCE CURRICULUM AGROBIOTECHNOLOGY – CYCLE XXIII

Department of Environmental Agronomy and Crop Science

THE STILBENE SYNTHASE MULTIGENIC FAMILY: GENOME-WIDE ANALYSIS AND TRANSCRIPTIONAL REGULATION

Direttore della Scuola : Ch.mo Prof. Andrea Battisti Supervisore : Ch.mo Prof. Margherita Lucchin

Dottorando : Alessandro Vannozzi (firma del dottorando)

DATA CONSEGNA TESI 31 gennaio 2011

I

II

“There are two possible outcomes in any research: If the result confirms the hypothesis, Then you've made a measurement. If the result is contrary to the hypothesis, Then you've made a discovery". E. Fermi

III

IV

Declaration I hereby declare that this submission is my own work and that, to the best of my knowledge and belief, it contains no material previously published or written by another person nor material which to a substantial extent has been accepted for the award of any other degree or diploma of the university or other institute of higher learning, except where due acknowledgment has been made in the text. (signature/name/date) A copy of the thesis will be available at http://paduaresearch.cab.unipd.it/

Dichiarazione Con la presente affermo che questa tesi è frutto del mio lavoro e che, per quanto io ne sia a conoscenza, non contiene materiale precedentemente pubblicato o scritto da un'altra persona né materiale che è stato utilizzato per l’ottenimento di qualunque altro titolo o diploma dell'università o altro istituto di apprendimento, a eccezione del caso in cui ciò venga riconosciuto nel testo. (firma/nome/data) Una copia della tesi sarà disponibile presso http://paduaresearch.cab.unipd.it/

V

VI

Acknowledgements It’s not easy to synthetise in a few words all the thoughts that buzz in my head when I think about people I should, I would and I must acknowledge. Probably all the pages in this thesis wouldn’t be enough to mention all of them, so I’ll try to be fair, and I excuse in advance for my negligence if I will leave somebody out. These acknowledgements should have been the first pages i wrote on this thesis, as the three years of life I spent during my Ph.D. were not just a scientific and educational investment, but first of all an emotional and human track. Much more important than a novel transcription factor regulating stilbene biosynthesis in grapevine!! I would start with Margherita Lucchin, my supervisor here in Italy. She gave me the opportunity to challenge myself with this project, and she took care of me more like a mother than like a simple advisor, feeling worried when I was upset for my results, helping me in all possible ways to overtake troubles I met, and leaving me the freedom to undertake all the wonderful experiences I lived during these years. Together with Margherita I need to say thank to Marzia Salmaso, which helped me through my first uncertain steps in science. Marzia is not just a mate. She is a friend first of all, as the majority of people I had the honour to work with. Amongst them I’d like to mention Cristian Forestan, Daria Ambrosi, Silvia Nicolè, Donato Loddo, Alberto Collavo, Giulio Galla, and other fantastic people I had the good fortune to met just recently, such as Luca Ceccato and Silvia Farinati. We are all mates…you know… but our challenge is more having fun than having results!!!! Many thanks to all people working at the Department of Environmental Agronomy and Crop Production of the University of Padova, Prof. Serena Varotto and Prof. Gianni Barcaccia in particular and all the students (particularly females) which made the departement environment more interesting… Special thanks to the University of Verona, in particular to Prof. Mario Pezzotti and Dr. Marianna Fasoli, who provided me the grapevine expression atlas for the expressional analyses of stilbene synthase genes in grapevine tissues, and to Alberto Ferrarini who helped me with the alignments and analyses of the mRNA-seq output data on the grapevine 12X coverage genome assembly.

VII

Finally, for what concerns the Italian-side, I would like to thank Federica Cattonaro and all people working at the Institute of Applied Genomics (IGA) in Udine, for giving me the opportunity to analyse my mRNA-seq data with their bioinformatic tools and for being friendly and kind during my staying in Udine. Now I have to jump a bit out of my garden… a bit out of Italy and a bit out of Europe…Precisely I have to jump on the other side of the word, the shining one…Australia!! Ian Dry accepted the responsibility to receive me as a visitor student for a couple of months, that quickly become almost a year. I think in a life there are just a couple of days that really deserve to be remembered, that make a person what they are and that give a life a determined course rather than another. For me that day was on September 22th, 2003, when somebody (please don’t ask me who, I am a scientist not a religious) gifted me the possibility to stay here, bringing on my life, changing it in better and carrying on my projects. Another day was April 11th, 2009, when I met Ian. Ian has been, and actually is, my North Star in science (can you see the North star from Australia?). He showed me what I would like to be in the future: a fantastic scientist, a point of reference for colleagues, an insatiable knowledge-picker and a stimulating person for talking about everything. I cannot thank Ian enough for what he gifted me, the love for science, but I know that the only way to show him how grateful I am is to put on my lab-coat and keep pipetting…. Because as he used to say, “science never goes on holidays, there’s a lot of work to do!!!” Together with Ian, I want to thank all friends and colleagues I met at the CSIRO Plant Industry in Adelaide and that contributed to this project. Thanks to Paul Boss who provided me some microarray data that represented the starting point of my speculation on the transcriptional regulation of stilbene synthases in grapevine, Mandy Walker and Nady Harris who helped me with the gene reporter assays and gave me some constructs for functional analyses. Many thanks also to Angela Feechan, Brady Smith and Jamila Chaib for adopting me during my staying in Adelaide and for happy distractions and life beyond the laboratory. I thank all my family, particularly Mum, Dad, my brother, Paola, Maurizio and my grandparents, for always supporting my decisions and providing me love and suggestions that have allowed me to become what I am today.

VIII

IX

X

Table of contents

Riassunto ........................................................................................................................................... 17  Summary ............................................................................................................................................ 21  Abbreviations................................................................................................................................... 25  Chapter 1 ­ General introduction .............................................................................................. 29  1.1  Grapevine and its genome ........................................................................................................... 29  1.2  Phytoalexins ..................................................................................................................................... 31  1.3  Phytoalexins from the Vitaceae: stilbenes. ........................................................................... 32  1.4  Biological roles of stilbenes ........................................................................................................ 37  1.4.1  Stilbenes as constitutive and inducible defences ...................................................................... 37  1.4.2  Stilbenes as antimicrobial compounds ......................................................................................... 39  1.4.3  Stilbenes as a deterrent against herbivores ................................................................................ 40  1.4.4  Stilbenes as alellochemicals ............................................................................................................... 40  1.4.5  Stilbenes as antioxidants ..................................................................................................................... 41  1.4.6  Stilbenes as antifungal agents ........................................................................................................... 42  1.4.7  Stilbene content and disease resistance ....................................................................................... 42  1.5  Stilbene biosynthesis .................................................................................................................... 44  1.5.1  Stilbenes biosynthesis requires precursors from the general phenylpropanoid  pathway ............................................................................................................................................................... 44  1.5.2  Plant polyketide synthases: chalcone and stilbene synthases ............................................ 45  1.5.3  Stilbene synthase and chalcone synthase catalyse the formation of the same  polyketide intermediate ............................................................................................................................... 46  1.5.4  Stilbene synthase evolved from chalcone synthase ................................................................. 48  1.5.5  Stilbene synthases in grapevine are a large gene family ....................................................... 48  1.6  Regulation of stilbene biosynthesis ......................................................................................... 50  1.6.1  Transcriptional regulation of stilbenes synthesis .................................................................... 50  1.6.2  The MYB gene family ............................................................................................................................. 50  1.6.3  The R2R3‐MYB subgroup ................................................................................................................... 51  1.6.4  A protein complex is required for initiation of transcription .............................................. 52  1.6.5  Transcriptional control of flavonoid biosynthesis by R2R3­MYB factors ....................... 54 

XI

1.6.6  Several R2R3‐MYB TFs regulate the general phenylpropanoid pathway in response  to stresses ........................................................................................................................................................... 54  1.6.7  Regulation of the flavonoid pathway in grape ............................................................................ 55  1.7  Aims of the study .............................................................................................................................57 

Chapter 2 – General Material and Methods ........................................................................... 59  2.1  Materials ............................................................................................................................................59  2.1.1   General solutions and growth media ............................................................................................ 59  2.1.2  Oligonucleotide primers ...................................................................................................................... 61  2.1.3  Bacterial strains ...................................................................................................................................... 63  2.1.4  Grapevine tissue ...................................................................................................................................... 63  2.1.5  Plasmopara viticola culture and maintenance ............................................................................ 63  2.2  Methods ..............................................................................................................................................64  2.2.1  Polymerase Chain Reaction (PCR) ................................................................................................... 64  2.2.2   Agarose gel electrophoresis .............................................................................................................. 65  2.2.3  Purification of DNA fragments from agarose gels ..................................................................... 65  2.2.4   Dephosphorylation of DNA 5’ termini .......................................................................................... 65  2.2.5  Purification of DNA samples following enzymatic reactions ............................................... 66  2.2.6  DNA ligation .............................................................................................................................................. 66  2.2.7  Butanol precipitation of ligation reactions .................................................................................. 66  2.2.8  Preparation of electro‐competent E. coli cells ............................................................................ 67  2.2.9 Transformation of bacteria with recombinant plasmids ........................................................... 67  2.2.10 Preparation of plasmid DNA ................................................................................................................ 67  2.2.11 Preparation of bacterial glycerol stocks ......................................................................................... 68  2.2.12 Preparation of DNA samples for sequencing ................................................................................ 68  2.2.13 Extraction of genomic DNA .................................................................................................................. 68  2.2.14 Extraction of total RNA .......................................................................................................................... 68  2.2.15 First strand cDNA synthesis ................................................................................................................ 69  2.2.16 Sequence analysis and manipulation ............................................................................................... 69 

Chapter III: Genome­wide analysis of STS genes in grapevine ....................................... 71  3.1  Introduction ......................................................................................................................................71  3.2  Materials and methods .................................................................................................................73  3.2.1  Database search, gene structure determination and chromosomal locations of  grapevine STS genes ....................................................................................................................................... 73 

XII

3.2.2  Phylogeny reconstruction and bootstrap analysis ................................................................... 74  3.2.3  Southern blot analysis for STS members ..................................................................................... 74  3.2.4  mRNA‐seq samples preparation and sequencing ..................................................................... 74  3.2.5  Alignment and analysis of Illumina reads against the V. vinifera genome ..................... 75  3.2.6  Differential gene expression analysis ............................................................................................ 76  3.2.7  Analysis of a gene expression atlas of V. vinifera cv. Corvina development .................. 76  3.3  Results ................................................................................................................................................ 78  3.3.1  Identification, annotation and chromosomal distribution of grapevine STS genes ... 78  3.3.2  Phylogenetic analyses of the predicted VvSTS proteins ........................................................ 80  3.3.3  Southern blot analysis of the VvSTS gene family ....................................................................... 83  3.3.4  Expression analysis of the VvSTS gene family ............................................................................ 85  3.4 Discussion ............................................................................................................................................. 94 

Chapter 4: Isolation and identification of R2R3­MYB transcription factors co­ expressed with VvSTS genes under biotic and abiotic stress conditions ............. 101  4.1 Introduction ....................................................................................................................................... 101  4.2  Materials and methods ............................................................................................................... 103  4.2.1  mRNA‐seq analysis of the R2R3‐MYB TF gene family in stressed tissues ................... 103  4.2.2  Collection of material for quantitative real‐time PCR expression analysis ................. 103  4.2.2.1 Wounding treatment .......................................................................................................................... 103  4.2.2.2 UV‐C exposure ....................................................................................................................................... 104  4.2.2.3 P. viticola infection .............................................................................................................................. 104  4.2.3  Quantitative real‐time PCR analysis ............................................................................................ 105  4.3 Results .................................................................................................................................................. 106  4.3.1  Identification of a candidate R2R3­MYB TF gene induced in grapevine in response to  biotic and abiotic stresses ........................................................................................................................ 106  4.3.2 VvMYB14 and VvSTS genes are co‐expressed in cell cultures treated with jasmonates  .............................................................................................................................................................................. 109  4.3.3  Sequence homology of VvMYB14/15 with other R2R3‐MYB transcription factors 110  4.3.4  Quantitative RT‐PCR analysis of VvSTSs and a VvMYB14 expression in response to  abiotic and biotic stresses ........................................................................................................................ 112  4.3.4  Discussion............................................................................................................................................... 121 

Chapter 5: Functional demonstration of regulation of VvSTS transcription by  VvMYB14 ..................................................................................................................................... 125 

XIII

5.1 Introduction ....................................................................................................................................... 125  5.2 Materials and methods .................................................................................................................. 126  5.2.1 Solutions and growth media for hairy root transformation .................................................. 126  5.2.2 Cloning of reporter constructs for transient promoter assays ............................................. 127  5.2.3 Transient transfection Experiments and dual luciferase assay ............................................ 128  5.2.4 Cloning of VvMYB14 for over‐expression and silencing in grapevine hairy roots ........ 129  5.2.5 Grapevine hairy root transformation .............................................................................................. 130  5.2.6 Quantitative real‐time PCR analysis on wounded hairy roots .............................................. 131  5.3 Results ................................................................................................................................................. 131  5.3.1 VvMYB14 activates promoters of VvSTS22 and VvSTS36 ........................................................ 131  5.3.2 Progressive deletions in the VvSTS36 promoter lead to a decrease in the promoter  activity ............................................................................................................................................................... 135  5.3.3 Silencing of VvMYB14 in grapevine hairy roots affects the induction of VvSTS36  expression in response to wounding .................................................................................................... 137  5.3 Discussion ........................................................................................................................................... 141 

Chapter 6: General conclusions .............................................................................................. 143  References ...................................................................................................................................... 147  Chapter 7: Chloroplast Microsatellite Markers to Assess Genetic Diversity and  Origin of an Endangered Italian Grapevine Collection .............................................. 173  7.1 Introduction ....................................................................................................................................... 174  7.2 Matherials and metods .................................................................................................................. 175  7.2.1 Plant material and DNA extraction ................................................................................................... 175  7.2.2 cpSSR analysis ........................................................................................................................................... 177  7.2.3 cpSSR data analysis ................................................................................................................................. 177  7.3 Results and Discussion .................................................................................................................. 178  7.4 Conclusions ........................................................................................................................................ 184  7.5 References .......................................................................................................................................... 185 

Appendix 1: Novel vectors used for functional characterization of VvMYB14 TF . 189 

XIV

15

16

Riassunto Gli stilbeni rappresentano un gruppo minore di fenilpropanoidi, caratterizzati da una matrice chimica difenil-etilenica, rilevabili solamente in un ristretto gruppo di piante superiori tra cui alcune specie di pino (Pinaceae), arachide (Fabaceae), Sorgo (Poaceae) e vite (Vitacea) (Morales et al., 2000). Come avviene per altri fenilpropanoidi, ad es. nel caso dei flavonoidi, l’accumulo di stilbeni è legato per lo più all’esposizione della pianta a stress di tipo biotico e non, tra i quali danneggiamento meccanico, esposizione a radiazione ultravioletta (UV-C), infezione e trattamento con sostanze chimiche (Dixon and Paiva 1995). Nell’arco degli ultimi decenni gli stilbeni, e il resveratrolo in particolare, hanno catalizzato l’attenzione di numerosi studi scientifici, in virtù delle loro proprietà biologiche e mediche. Dal punto di vista biologico, queste sostanze possiedono svariate funzioni, fungendo da deterrenti contro erbivori e insetti (Torres et al. 2003), da composti ad azione anti fungina (Morales et al., 2000; Jeandet et al., 2002), da sostanze allelopatiche (Seigler 2006; Fiorentino et al., 2008) e da antiossidanti (Privat et al., 2002). Dal punto di vista medico, sembrano invece coinvolti in un generale allungamento delle prospettive di vita, rivestendo un ruolo importante nella prevenzione e cura di malattie cardio-respiratorie, neuro-degenerative ed altre malattie quaili cancro, diabete, ecc… (Baur et al., 2006). La pathway di sintesi degli stilbeni può essere considerata una pathway “alternativa” a quella che sovrintende alla biosintesi dei flavonoidi. Tutte le piante superiori sono in grado di produrre composti quali il p-cumaroyl CoA o il cinnamoyl CoA, attraverso l’azione di enzimi ubiquitari nel regno vegetale quali la fenilanina ammonia liasi (PAL), la cinnamato 4-idrossilasi (C4H) o la 4-cumaroil–CoA ligasi (4CL). Questi composti rappresentano il substrato di partenza per la chalcone sintasi (CHS), enzima chiave che porta allo scaffold di sintesi dei flavonoidi. Soltanto in quelle piante in grado di produrre e accumulare stilbeni queste molecole fungono da substrato anche per le stilbene sintasi (STS), una classe di enzimi strettamente correlate alle chalcone sintasi, responsabili della biosintesi di resveratrolo e degli stilbeni in generale. Le STSs appartengono alla superfamiglia delle poliketide sintasi del tipo III, di cui la CHS rappresenta il principale esponente. Alcune specie vegetali, tra cui pino (Pinus spp.), Fallopia japonica (Polygonum cuspidatum) o vite (Vitis vinifera) in alcuni stadi di sviluppo della bacca, sono in grado di accumulare queste

17

molecole in modo costitutivo (Beñová et al., 2008). Nonostante ciò, gran parte degli studi sull’accumulo di stilbeni è stata condotta in arachide o vite, piante nelle quali la presenza di tali composti è prevalentemente legata alla risposta a stress di tipo biotico e abiotico, come risultato dell’attivazione trascrizionale delle STSs e di geni codificanti per enzimi a monte nella pathway generale dei fenilpropanoidi quali PAL o C4H (Lanz et al., 1990; Bais et al., 2000). A oggi, non esiste alcuna informazione riguardo a fattori di trascrizione (TFs) coinvolti nella regolazione di questa pathway, tuttavia, nel corso degli ultimi anni, un numero sempre maggiore di informazioni si è accumulato per ciò che concerne la regolazione della pathway dei flavonoidi. In tale contesto, un ruolo fondamentale sembra ascrivibile alla sottofamiglia dei fattori di trascrizione MYB-R2R3, responsabili della regolazione del metabolismo dei flavonoli, lignine e antocianine (Boudet 2007). Il gruppo dei MYB-R2R3 rappresenta una delle sotto-famiglie di TFs più numerose nel regno vegetale, con ben 108 membri identificati da una recente analisi della copertura 8.4X del genoma di vite (Matus et al., 2008). In vite, la caratterizzazione funzionale di alcuni MYB-R2R3 ha mostrato il loro coinvolgimento in diversi steps della biosintesi dei flavonoidi: VvMYBA1 e VvMYBA2 sono ad esempio coinvolti nella regolazione delle sintesi di antocianine, VvMYB5A, VvMYB5B e VvMYBPA1 regolano diversi geni strutturali della pathway dei flavonoidi, mentre VvMYB12 sembra coinvolto nella sintesi di flavononi (Bogs et al., 2007; Walker et al., 2007; Deluc et al., 2008). L’obbiettivo di questo studio si è articolato in due macroargomenti principali: la caratterizzazione genomica e trascrizionale dell’intera famiglia multigenica delle stilbene sintasi in vite e l’individuazione, con conseguente caratterizzazione funzionale, di fattori di trascrizione coinvolti nella sua regolazione. La caratterizzazione genomica dell’intera famiglia delle stilbene sintasi in vite si è sviluppata dapprima mediante l’identificazione, l’annotazione e lo studio delle relazioni filogenetiche che intercorrono tra i diversi membri di tale famiglia e, in seguito, valutando il profilo di espressione di ogni singolo gene in diversi organi in vari stadi di sviluppo e in dischi fogliari sottoposti a stress di varia natura. In quest’ultimo caso, l’espressione dei membri identificati nel genoma con copertura 12X V1 è stata saggiata tramite analisi dell’intero trascrittoma (mRNA-seq) usando una tecnologia di sequenziamento di nuova generazione (NGS) Illumina e rilevando l’esistenza di diversi gruppi di STSs caratterizzati da gradi

18

diversi di responsività ai vari stress. L’analisi di espressione in diversi organi e stadi di sviluppo è stata invece realizzata in collaborazione con l’Università di Verona, che ha fornito un atlante di espressione basato su tecnologia microarray di tipo Nimblegen e Combimatrix. Le sonde presenti su tali chip sono state disegnate sulla base delle predizioni ottenute dalla copertura 12X V1 del genoma ottenuto dalla linea PN40024 e ibridate con numerosi organi di vite, tra cui foglia, bacca divisa in esocarpo, endocarpo e seme, radici in vitro, germoglio, tendrile ecc…Tali tessuti sono stati considerati in diversi stadi temporali tra i quali allegagione, invaiatura, pre-maturazione, maturazione e appassimento per ciò che riguarda bacca o stadi giovanili o senescenti per foglia. In questo caso le analisi hanno parzialmente validato i dati ottenuti nell’analisi mRNA-seq oltre a fornire un quadro dettagliato del pattern di espressione di questi geni nell’intero sistema pianta in assenza di stress. Il secondo scopo del lavoro di seguito presentato è stato l’identificazione di fattori di trascrizione coinvolti nella regolazione della pathway biosintetica responsabile della sintesi di stilbeni. Data la stretta relazione che intercorre tra la pathway di sintesi degli stilbeni e quella dei flavonoidi, e sulla base delle numerose evidenze scientifiche che legano la regolazione di quest’ultima alla attività di MYB-R2R3, (Deluc et al. 2008; Bogs et al. 2007; Walker et al. 2007), i dati Illumina ottenuti dai tessuti stressati sono stati analizzati con lo scopo di individuare geni MYB-R2R3 co-espressi con le VvSTS. Di 108 MYB-R2R3 analizzati, soltanto due geni hanno evidenziato un pattern di espressione correlato a quello delle VvSTS. Tali geni sono già stati annotati da Matus et al. (2008) e prendono il nome di VvMYB14 e VvMYB15. Successive analisi real time su dischi fogliari sottoposti a stress biotici e non, hanno confermato una marcata co-espressione tra VvMYB14 in particolare e due VvSTS altamente stress-inducibili (VvSTS22 e VvSTS36). Tramite saggio “gene reporter” è stata validata una reale interazione tra VvMYB14 e le sequenze promotoriali di queste due stilbene sintasi e, al fine di confermare il ruolo di VvMYB14 anche in planta, sono state create delle linee silenziate di Hairy Roots. In uno screening preliminare delle linee trasformate, quelle che mostrano il più alto grado di silenziamento di VvMYB14 sono anche quelle che mostrano il più basso grado di induzione di VvSTS36, confermando un ruolo di questo fattore di trascrizione nella regolazione trascrizionale della pathway biosintetica delle stilbene sintasi.

19

20

Summary Plant stilbenes represent a relatively small group of phenylpropanoid compounds characterized by a diphenylethylene backbone and have been detected in only a few unrelated plant species, including pine (Pinaceae), peanut (Fabaceae), sorghum (Poaceae) and grapevine (Vitaceae) (Morales et al., 2000). As with other phenylpropanoids, stilbenes accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals (Dixon and Paiva 1995). During the last decade stilbenes, and resveratrol in particular, have captured the attention of biology and medicine due to both the biological and medicinal activities of those compounds.

Among the

biological effects they have been suggested to act as deterrents against animals and insects (Torres et al. 2003), antifungal compounds (Morales et al., 2000; Jeandet et al., 2002), allochemicals (Seigler 2006; Fiorentino et al., 2008) and antioxidants (Privat et al., 2002). In terms of medical applications, they have been shown to have beneficial effects in the treatment of cardiovascular disease, cancer, diabetes and neurodegenerative diseases (Baur et al., 2006). Stilbenes are formed via the phenylalanine/polymalonate route (Hall and Yu, 2008). The last step of the biosynthetic pathway is catalysed by stilbene synthase (STS), which produces resveratrol in a single enzymatic reaction utilizing p-coumaryl-CoA and three malonyl-CoA units as substrates (Schröder and Schröder 1990). Despite the fact that all higher plants are able to accumulate basic compounds like p-coumaroyl CoA or malonylCoA through general and ubiquitous enzymes such as phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H) or 4-coumaroyl–CoA ligase (4CL), only a limited group of plants are able to produce resveratrol (and derivatives) through the STS enzyme. This stilbene-producing enzyme belongs to the large CHS type III polyketide synthase family, the main members of which are the chalcone synthases, which shares 75-90% of the amino acid sequence with STSs (Schröder et al., 1988). Both of these enzymes utilize the same substrate, but through different cyclization events lead on one hand to the production of chalcones and flavonoids and, on the other, to the production of resveratrol and stilbenes. Some plant species, such as Pine, Fallopia japonica (syn. Polygonum cuspidatum) and

21

grapevine during several stages of berry development, constitutively accumulate large amounts of stilbenes (Beñová et al., 2008). However, most studies concerning stilbene accumulation have been conducted on tissues of peanut and grapevine, where they accumulate in response to various biotic and abiotic stresses, as a result of increased transcription of both STS genes and upstream enzymes in the phenylpropanoid pathway such as PAL and C4H (Lanz et al., 1990; Bais et al., 2000). While little is known about the transcriptional regulation of the stilbene biosynthetic pathway, a number of studies have demonstrated a role for transcription factors in the regulation of other steps of the phenylpropanoid pathway. These regulators include R2R3-MYB transcription factors (TFs), responsible for the regulation of flavonols, lignin and anthocyanin metabolism (Boudet 2007). The R2R3-MYB TF group is the largest MYB TF sub-family in plants (Du et al., 2009) with the grapevine genome estimated to contain 108 R2R3-MYB members (Matus et al., 2008). To date, most R2R3-MYBs have been reported to play a major role in the regulation of secondary metabolism, such as the phenylpropanoid biosynthesis. In grapevine, R2R3-MYB factors have been demonstrated to be involved in the regulation of several steps of the flavonoid biosynthetic pathway: VvMYBA1 and VvMYBA2 are involved in the regulation of anthocyanin biosynthesis. VvMYB5a, VvMYB5b and VvMYBPA1 appear to control general branches of the flavonoid pathway and VvMYB12 regulates the production of flavonols (Bogs et al., 2007; Walker et al., 2007; Deluc et al., 2008). This study involved two principal components: (a) the genome-wide analysis of the whole STS multigenic family in grape and (b) the identification of candidate transcription factors involved in the regulation of the grape stilbene synthase pathway. The first point was achieved firstly by the identification, annotation and phylogenetic study of all members predicted to belong to the STS family and secondarily by transcriptional analysis of the whole STS family in grapevine in response to biotic and abiotic stress conditions and in unstressed healthy tissues at different developmental stages (in collaboration with the University of Verona). The expression of all identified VvSTS members predicted on the 12X V1 grape genome draft was evaluated using mRNA sequencing technology on Pinot noir leaf discs treated by wounding, exposure to UV-C light and downy mildew infection. The analysis was performed using a next generation whole-transcriptome sequencing technology (Illumina) and revealed different sub-groups of VvSTS genes characterized by

22

different degrees of response to the different elicitors. The constitutive expression of VvSTS genes in different tissues was analysed with a different approach, in collaboration with the University of Verona. A grapevine expression atlas obtained using a Nimblegen and Combimatrix microarray technology based on the 12X V1 coverage assembly predictions (kindly provided by the University of Verona) was screened for VvSTS genes providing interesting insights into the transcriptional regulation of VvSTS genes in grapevine. A wide range of grapevine tissues were analysed, including leaf, berry tissues, such as exocarp, endocarp and seed, in vitro roots, rachis, stem, tendril etc. Moreover, tissues were evaluated at different developmental stages such as fruit set, pre-ripening, ripening or withering concerning the berry development or at different temporal stages regarding leaves or other vegetative tissues. Analyses using the grapevine expression atlas confirmed the existence of different VvSTS subgroups characterized by different expression patterns and provided a comprehensive picture of VvSTS expression patterns in planta. Considering the close relationship between the flavonoid and stilbene biosynthetic pathways and the fact that certain key genes within the flavonoid pathway have been shown to regulated by R2R3MYB transcription factors (Bogs et al. 2007; Walker et al. 2007; Deluc et al. 2008) the mRNAseq data obtained from stresses grape tissues were also examined for the expression MYB TFs that might show similar expression patterns to the VvSTS genes. Of the 108 grape R2R3-MYB factors analysed, two accessions displayed similar expression patterns to the inducible VvSTS genes. These two accessions were previously designated VvMYB14 and VvMYB15 by Matus et al. (2008) based on their homology to the Arabidopsis thaliana MYB14 gene. Validation of the expression data obtained from the mRNAseq analysis, was achieved using a quantitative RT-PCR approach, by screening in more detail the relationship between selected VvSTS and VvMYB14 expression patterns in grape tissues following the application of abiotic and biotic stress treatments. Two highly responsive VvSTS genes were selected for analysis, VvSTS22 and VvSTS36. All treatments confirmed a strong correlation between the expression of VvMYB14 and the two VvSTS genes. To obtain direct evidence of the regulation of VvSTS promoter activity by VvMYB14 a gene reporter assay using a dual luciferase assay system was utilized. Chardonnay cell suspensions transiently expressing VvSTS promoter-luciferase expression constructs showed a statistically significant increase of VvSTS promoter activity when co-transformed with

23

VvMYB14. Finally, to validate the role of VvMYB14 in the regulation of the VvSTS pathway in planta, attempts were made to silence VvMYB14 in a grapevine hairy root system. In a preliminary screening of transformed hairy root lines, those lines showing the highest levels of VvMYB14 silencing were found to show the lowest induction of VvSTS36 in response to wounding, giving a first biological confirmation of real role for VvMYB14 in the regulation of the VvSTS pathway.

24

Abbreviations Units °C

degrees Celcius

aa

amino acid

bp/kb

base pairs/kilobase pairs

g

relative centrifugal force

g; mg; µg

gram(s); milligram(s); microgram(s)

h

hour(s)

kPa

Kilopascal

L; ml; µl

litre(s); millilitre(s); microlitre(s)

M; mM; µM; nM

molar (moles per L); millimolar; micromolar; nanomolar

Mm

millimetre(s)

min

minute(s)

s

second(s)

U

Unit

V

volt(s)

v

volume

w/v

weight per volume

Flavonoid pathway 4CL

4-coumarate CoA ligase

ANR

anthocyanidin reductase

bHLH

basic helix-loop-helix

C4H

cinnamate 4-hydroxylase

CHI

chalcone isomerise

CHS

chalcone synthase

DFR

dihydroflavonol 4-reductase

F3’5’H

flavonoid 3’,5’-hydroxylase

F3’H

flavonoid-3’-hydroxylase

F3H

flavanone-3-hydroxylase

FLS

flavonol synthase

LAR

leucoanthocyanidin reductase

25

LDOX

leucoanthocyanidin dioxygenase

PA

proanthocyanidin

PAL

phenylalanine ammonia-lyase

STS

stilbene synthase

TTG

transparent testa glabra

UFGT

UDP-glycosyl:flavonoid-3-O-glycosyltransferase

General

26

A, C, G, T

adenine, cytosine, guanine, thymine

BLAST

basic local alignment search tool

cDNA

complementary DNA

CSIRO

Commonwealth Scientific and Industrial Research Organisation

C-terminal

carboxy-terminal

DM

downy mildew

DNA

deoxyribonucleic acid

dNTP

dinucleotide triphosphate

EDTA

ethylenediaminetetraacetic acid

EST

expressed sequence tag

HPLC

high performance liquid chromatography

Hz

hertz(s)

IASMA

Istituto Agrario di S. Michele all’Adige

IGA

Istituto di Genomica Apllicata

IPTG

Isopropylthiogalactoside

LB

Luria broth

mRNA

messenger RNA

NCBI

National Center for Biotechnology Information

N-terminal

amino-terminal

oligo

oligonucleotide

ORF

open reading frame

PCR

polymerase chain reaction

Phe

phenylalanine

RNA

ribonucleic acid

RPKM

reads per kilobase of exon model

rpm

revolutions per minute

SE

standard error

TAE

tris-acetic acid-EDTA

TBE

tris-boric acid-EDTA

TE

tris-EDTA

TF

transcription factor

Tm

temperature of DNA dissociation (melt)

ELF

elongation factor

UTR

untranslated region

UV

ultra violet light

X-gal

5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside

27

28

Chapter 1 - General introduction

1.1

Grapevine and its genome Grapevine (Vitis vinifera L.) represents one of the major crop species on a word-wide

scale, with a world production approaching 67 million of tonnes and a harvested area of over 7.4 millions hectares (FAO 2009). The cultivated grapevine belongs to the genus Vitis, within the family Vitaceae, which includes approximately sixty species. In the Vitis genus, V. vinifera represents the only species to be extensively used in the wine industry and is the only species indigenous to Eurasia. Since the Neolithic era, grapevine has played an important role in the cultural heritage of humanity, being celebrated by the Ecclesiastes, Horace, Goethe, Jefferson, and the Nobel laureate J.C. Cela. Its cultivation appears to be linked with the discovery and production of wine and is dated, based on historical evidence, to 7400-7000 years ago (McGovern, 2003). From its first domestication site in the region of Iran, its cultivation was subject to a gradual spread, firstly in regions such as Mesopotamia and Egypt, followed by the Mediterranean and finally the whole Europe during the roman époque. Missionaries then spread it to the New World. Grapevine cultivation now represents a well-established reality on a word scale, including countries such as South Africa, New Zealand and Australia. V. vinifera spp. sativa, domesticated from the wild ssp. sylvestris (Levadox, 1956) is characterised by hermaphroditic self-fertilizing flowers, nevertheless, out-breeding by means of pollinating insects or wind is the norm, leading to an high degree of heterozygosis and carrying many deleterious recessive mutations. All wild Vitis species have 38 chromosomes (n=19) and most interspecies hybrids are fertile (Olmo 1976). In the last decade, the will to increase the economical competitiveness linked to its cultivation in terms of quality and productivity, and the need to adapt it to the new geographical areas depletion, climate changes, the advent of new diseases and the market demands, led to a remarkable increase of physiology and pathology studies on this species, together with the development of tools and genetic resources aimed at its improvement. On August, 26th 2006 a great step forward in grapevine biology was achieved through the publication of the first draft of the grapevine genome by the French-Italian Consortium

29

(Jaillon et al., 2007), followed, a few months later, by the publication of a second genome draft by the Institute of S. Michele all’ Adige (IASMA; Velasco et al., 2007). The sequencing of the grapevine genome represented the fourth genome of the flowering plants, the second one among wood plants and the first one concerning fruit producing plants. The French-Italian sequencing was obtained by the selection of the PN40024 line, a particular clone characterised by a high degree of homozygosity (approximately 84%) and obtained through multiple auto-fecundation cycles in order to by-pass the high heterozygosis that characterise grapevine. The actual genome sequence available on line is the 12X assembly coverage (www.genoscope.cns.fr/esterne/GenomeBrowser/Vitis). The genome size is approximately 475 Mb and by means of GAZE and JIGSAW computational frameworks, 26.346 gene predictions have been identified. The genome sequence obtained by the ENTAV 115 clone, which is the Pinot noir line used by IASMA for their sequencing, is slightly larger, with a size for the haploid genome estimated at 504.6 Mb and a total number of 29.585 gene predictions (http://genomics.research.iasma.it/gb2/gbrowse/grape). The public release of these two grapevine genomes represents a remarkable goal, but also a formidable starting point for a vast range of studies aimed at improving our knowledge about gene function and variability in this species. Transfer and interpretation of results obtained in model organisms on molecular mechanisms involved in the determination of important agronomical characters is now feasible together with the new opportunity for a molecular breeding in grapevine. One extremely interesting character that emerged from the study of published grapevine genome sequences is the prediction of the presence of large gene families related to qualitative characters of the vine. One example is for genes encoding stilbene synthases (VvSTSs), which are the subject of this study. Grape STSs are involved in the resveratrol biosynthesis, a compound belonging to the plant phytoalexins family (Dixon and Paiva 1995), which has also been demonstrated to be involved in the beneficial effects, related to a moderate consumption of red vine (Baur et al., 2006).

30

1.2

Phytoalexins Around 450 million years ago, several pioneering green algal ancestors probably

related to Charales (Kenrick et al., 1997) spread out from water to occupy a new biogeographical niche: dry land. The move to dry land was accompanied by the need to deal with important stresses including desiccation, UV radiation, as well as attack by already diversified microbial soil communities. This led to a number of physiological adaptations, including the evolutionary emergence of entirely new specialized secondary metabolic pathways (Waters 2003). One in particular was crucial: the phenylpropanoid pathway, so named because of the C6 + C3 scaffold resulting from the pathway’s initial denaturation of the primary metabolite phenylalanine. This pathway represents a ubiquitous and specific trait of land plants providing vital compounds such as lignin and flavonoids (Emiliani et al., 2009). Lignin is an abundant structural polymer formed from monolignol derivatives of the phenylpropanoid pathway and, together with cellulose, provides the structural integrity necessary for the emergence of self-supporting structures. Flavonoids, which often impart a species-specific chemical ‘signature’ upon an organism and confer a multitude of evolutionary advantages, serve vital roles in plant protection against biotic and abiotic stresses, reproduction and internal regulation of plant cell physiology and signalling (Noel et al. 2005). In their natural environment, green land plants are subjected to attack by a wide range of pathogens, such as fungi, bacteria and viruses. The defence responses adopted by plants to resist pathogen attack consist of both constitutive mechanisms, such as physical barriers (cutin, suberin, lignin, phenolic compounds), and active or inducible mechanisms involving the production of reactive oxygen species (ROS), programmed cell death (PCD) events, the synthesis of pathogenesis-related proteins (PR) and the localised accumulation of phytoalexins. These defence mechanisms are not only induced by biotic stresses but can also be induced by abiotic stresses such as exposure to UV light, wounding or treatment with chemicals (respiratory inhibitors, surfactants, plant regulators, salts of heavy metals, as well as elicitors released by pathogens or products resulting from the degradation activity of fungal enzymes on host cell-walls) (Harborne et al., 1999).

31

Phytoalexins are low molecular mass, lipophylic, antimicrobial compounds synthetised in plants that accumulate rapidly at the site of incompatible pathogen interaction. (Kuc et al., 1995; Purkayashta 1995) The term probably derives from the Greek language and means “warding off agents in plant”. They are broad-spectrum inhibitors and are chemically diverse with different classes of compounds characteristic of particular plant species. Phytoalexins have been shown to have biological activity against a wide range of pathogens and can be considered as markers for disease resistance in plants. They include a large spectrum of secondary metabolites such as pterocarpans, isoflavans, prenylated isoflavonoids, psoralens, coumarins, 3-deaxyanthocyanidins, flavonols, aurones and stilbenes (Bailey and Mansfield, 1982; Dixon and Paiva 1995).

1.3

Phytoalexins from the Vitaceae: stilbenes. Because of the agricultural and economical importance of grapevine as a crop plant, its

defence mechanisms against phyto-pathogenic organisms, as well as abiotic stresses, have attracted considerable interest in recent times. Among these defence mechanisms is the production of phytoalexins. Phytoalexins from Vitaceae have been the subject of numerous studies during the past decade, not only because their biological activities in planta, but also because of their possible pharmacological applications. Although these compounds display an enormous chemical diversity throughout the plant kingdom, in grapevine they seem to constitute a rather restricted group of molecules belonging to the “stilbene family”. This class of molecules was firstly discovered in grapevine by Langcake and Pryce (1977) who proposed for them the trivial generic name “viniferins” based on the observation that their production was a common feature of the vine family (Vitaceae). In reality viniferins represent a grape-specific sub-group of the larger family of stilbenes, a relatively small group of phenylpropanoids that are characterised by a 1,2-diphenilethylene backbone and that have been detected in a few unrelated plant species including grapevine (Counet et al., 2006). Plant stilbenes, together with flavonoids, belong to the plant polyketide class, which represents a major group of phenylpropanoids derived from the extension of the activated form of coumaric acid with three acetyl moieties. The term “stilbene” derives from the Greek word “στιλβος”, which means shining, and it’s probably related to the characteristic

32

brighht-blue fluoorescence thhat characterises tissu ues accumuulating thesee compoun nds when obserrved under long wavelength UV-llight (Langccake et al., 1976; 1 Jeanddet et al., 1991). From m a chemicaal viewpointt, a stilbenee molecule is i a diaryethhylene, whiich is a hyd drocarbon consiisting in a trans- or ciis- ethene double d bond d substitutedd with a phhenyl group p on both carboon atoms of the double bond. Stiilbenes exisst in two poossible isom mers (Figuree 1). The first is the transs-1,2-diphennylethylenee, called (E))-stilbene or o trans-stilbbene. The second s is c henylethylenne, called (Z Z)-stilbene and is sterrically hindeered and leess stable the cis-1,2-diph becauuse of interractions of the t two arom matic rings. Cis- transs- inter-convversion can n occur in preseence of heatt or ultravioolet light (H Hart et al., 19 981).

Fiigure 1.1 - Cis and trans forms off stilbene

Aparrt from the Vitaceae, V sttilbenes havve been deteected in at least l 72 unrrelated plan nt species distriibuted amoong 31 gennera and 122 families including i F Fagaceae, L Liliaceae, Moraceae, M Myrttaceae, Papiilionaceae, Pinaceae, and a Poaceaeeae (Counet et al., 20066; Sotheesw waran and Suphhaty 1993; Yu Y et al., 2005). 2 How wever, despiite the multtiplicity of basic stilbeene units deteccted in thesse different species, most m plant sttilbenes, including thoose ones deetected in grapeevine, are derivativess of the basic b unit trans-resverratrol (3,5,,4’-trihydroxy-transstilbeene). Resvveratrol wass probably first f mentionned in a Jap panese articlle in 1939 bby M. Takao oka, who isolaated this com mpound froom the poisoonous mediicinal Verattrum album m, var. grand diflorum. The name probbably comes from the fact that this t compoound is a reesorcinol derivative d comiing from a Veratrum V sppecies (Takaaota, 1939). Resvveratrol hadd a strong im mpact in bioological and d medical research r sinnce it was postulated to bee involved with w a phenoomenon called “French h paradox”. This term w was coined from Dr.

33

Serge Renaud, a scientist from Bordeaux University in France (Simini 2000) and basically refers to the observation that French people suffer a relatively low incidence of coronary heart diseases, despite having a diet relatively rich in saturated fats. It was suggested that the high consumption of red wines, a well-known resveratrol source, by the French population was a primary factor of this trend. In reality, the concentration of resveratrol in red wine is probably not in sufficient amount to explain the French paradox. Nevertheless hundreds of studies have reported that this compound can prevent or slow a variety of illness, including cancer, cardiovascular diseases, as well as extend the lifespan of various organisms (Baur et al. 2006). In addition to resveratrol, more complex compounds derived from its modification have been detected as constitutive and stress-inducible compounds in several grapevine tissues (Figure 2). A significant proportion of stilbenes may accumulate in a glycosylated form. Large amounts of cis- and trans- piceid, a 3-O-β-D glucoside of resveratrol, was detected in healthy berries of different grape varieties (Waterhouse and Lamuela-Raventos 1994; Waffo-Teguo et al., 1996; Romero-Pérez et al., 2001; Gatto et al., 2008), as well as upon irradiation with UV light (Adrian et al., 2000) and powdery mildew infection (RomeroPérez et al., 2001). Gatto et al. (2008) suggested that resveratrol glucosides could be the chemical form preferentially expressed constitutively, while trans-resveratrol may represent an “inducible form”. This hypothesis is supported by the observation that uninfected grape berries contain similar amount of trans-resveratrol and trans-piceid whereas highly infected berries show a much higher proportion of trans-resveratrol (Romero-Pérez et al., 2001). Cis- and trans- piceid were detected not only in grapes and in grapevine tissues but also in many red and white grape juices, indicating that grape juice, and red juice in particular, may be an alternative dietary source to wine to achieve the beneficial effect of stilbenes (Romero-Pérez et al., 1999). Glycosylation is a common modification of plant secondary metabolites and leads to an alteration in their hydrophylicity, stability, sub-cellular localization and bioactivity. Glycosylation of stilbenes could be involved in their storage, transport from the cytoplasm to apoplasm and protection from peroxidative degradation (Morales et al. 1998). One interesting observation is that whereas in plants that naturally produce stilbenes, these metabolites are generally accumulated in both free and

34

glycosylated forms, in non-stilbene producing plants transformed with stilbene synthase genes these compounds often result in the accumulation of the glycosylated form. An example is the accumulation of cis-piceid in transgenic A. thaliana over-expressing a Sorghum stilbene synthase gene (Yu et al., 2005). A similar balance, depending on the tissue and ripening stage of transgenic plants, was observed in tomato and apple fruit (Giovinazzo et al., 2005; Nicoletti et al., 2007; Ruhmann et al., 2006). A possible explanation is that glycosylation of stilbenes by endogenous non-specific glucosyltransferases and subsequent storage in vacuoles could protect plant cells from potentially toxic effect of resveratrol or stilbenes (Hipskind and Paiva, 2000). A large number of grapevine stilbenes molecules are oligomers, which include dimers, trimers and tetramers arising from the oxidative coupling of resveratrol or resveratrol derivatives by peroxidase iso-enzymes such as peroxidase A1, B3 (located in the cell-wall and in the cell-wall-free spaces) and B5 (located at the vacuole level; Calderon et al., 1992). These compounds are generically referred to as viniferins. Viniferins accumulate in grapevine leaves upon fungal infection or UV irradiation or in woody parts of grapevines as constitutive compounds (Langcake et al., 1977). Langcake (1981) identified five main products of resveratrol oxidation including ε-, α-, γ- and β-viniferins which comprise the dimer, trimer, tetramer and a highly polymerized oligomer. δ-viniferin is a grapevine phytoalexin-mimic consisting of a resveratrol dehydrodimer analogous to ε-viniferin, but with a different oxidation coupling involving the hydroxyphenyl group situated in the 4’position of the stilbene moiety (Langcake et al., 1977). Oligomerization of resveratrol to get δ-viniferin has been obtained in vitro by enzymatic oxidation using horseradish peroxidase or laccase-like stilbene oxidases from Botrytis cinerea (Breuil et al., 1999). Breuil et al. (1999) suggested that, as the oxidative dimerization by Botrytis laccase of results in a stilbene with a higher molecular weight and hydrophobicity, this insolubilisation process could represent a defence mechanism of the pathogen to bypass the host phytoalexinresponse. A confirmation of that is the observation that a high resveratrol concentration in wine has been associated with moderate fungal infection, whereas there is a lack of any phytoalexin in wine made from berries which have been extensively infected by B. cinerea (Jeandet et al., 1995).

35

Productss of resveraatrol methoxxylation reppresent ano other class of o resveratrrol derivativ ves in grapevinne. Hundreeds of O-m methylated compound ds have been b charaacterized am mong phenylprropanoids, ranging froom mono- or o poly- meethylated coompounds aand belongiing to monoliggnols, chalccones, flavvones, isofflavones, flavonols, fl a anthocyanin ns and stilbene families (Noel et al., a 2003). Pterostilbenne is a resv veratrol derrivative thaat, together with resveratrrol was deetected in grapevine leaves inffected withh the oom mycete path hogen Plasmoppara viticolaa (Langcakee et al., 19779). A consttitutive accuumulation oof this comp pound was nott reported in healthyy grapevinee tissues an nd, althouggh it also displays strong s antifunggal activity like l other coomplex stilbbenes such as viniferinns, it accum mulates at a much m lower concentratio c on in respoonse to biootic stressees. As menntioned forr other stilbene derivativves, pterosttilbene has recently atttracted the attention of o many sttudies due to its putative positive rolles in humaan health (R Roupe et al., 2006).

Figurre 1.2 - Prinncipal formss of grape stilbenes (modified from m Chong et al., 2009)

36

1.4

Biological roles of stilbenes

1.4.1 Stilbenes as constitutive and inducible defences Several plant species, such as Polygonum cuspidatum and Pinus spp. constitutively accumulate large amount of stilbenes. HPLC analysis of powder obtained from dried roots of several varieties of P. cuspidatum revealed the presence of four major stilbenes: transresveratrol,

trans-piceid,

and

trans-piceatannol

and

astringin,

a

3,3’,4,5’-

tetrahydroxystilbene and its glucoside, with a peak of resveratrol and piceid in the var. japonica (Hart et al., 1981; Jayatilake et al., 1993; Beñová et al., 2008). In pine, as in other trees such as Eucalyptus (Eucalyptus regnans) and Maclura, stilbenes occur primarily in the dead or moribund tissues of the heartwood and bark, while they seem to be scarcely constitutively accumulated in green tissues like leaves and sapwood (Barnes et al., 1955; Hathway, 1962; Hillis, 1972; Wang 1977).

Figure 1.3 - Biotic and abiotic stresses involved in the induction of STS genes and upstream genes of the general phenylpropanoid pathway such as PAL and C4H.

37

In these species, and in particular for conifers, the role of stilbenes in constitutive defences is well documented. On the other hand, the majority of studies on the induced biosynthesis and accumulation of stilbenes have been conducted on cells and leaves of peanut, grapevine and pine seedlings. In these plant tissues stilbenes are scarcely expressed under normal conditions, but strongly accumulate in response to a wide range of biotic and abiotic stresses, as a result of an increased transcription of STS genes and the coordinate activation of upstream genes belonging to the general phenylpropanoid pathway, such as PAL and C4H (Figure 1.3). A range of abiotic stress treatments lead to the stilbene biosynthesis including mechanical damage (Chiron et al., 2000; Pezet et al., 2003), UV-C light irradiation (Adrian et al. 2000; Wang et al. 2010), treatments with chemicals such as aluminium ions, cyclodextrins and ozone (Rosemann, 1991; Adrian et al., 1996; Zamboni et al., 2009) and the application of plant hormones like ethylene and jasmonates (Belhadj et al., 2008a, 2008b). Among biotic stresses, synthesis of stilbenes is particularly well documented in grapevine, where it has been shown to be induced upon infection with different fungal pathogens, including powdery mildew (Erysiphe necator) (Fung et al., 2008; Schnee et al., 2008), downy mildew (P. viticola) (Langcake and Pryce 1976; Adrian et al., 1997) and gray mold (B. cinerea) (Langcake and McCarty. 1979; Bézier et al., 2002) (Figure 1.4). Figure 1.4 summarizes all different biological and medical roles described for inducible and constitutive stilbenes.

38

Biologiccal  B Roles

Mediccal  Rolees

Defence frrom  herbivorres

Preventiion from  Cardio‐v vascular  diseaases

Insecticid dial activity y

Can ncer  protection

Antimicrobial  activity y

Action aagainst  diab bete

Allochemiical activity y

Neu uro‐ degeneerative          diseaases

Antioxidaant  activity y

Extensio on of life  spaam

Antifunggal  activity y

b an nd medical roles of stillbenes Fiigure 1.4 – Proposed biological

1.4.2 2 Stilben nes as antimicrobiial compo ounds T constittutive produuction of sttilbenes is thought to play an im The mportant role in the preveention of wood decay by b microorgganisms (Liieutier et al.., 1996). Thhe “decay prrevention activvity” of stilbbenes, was evaluated in three heaartwood-stilbbene system ms (pine-pin nosylvin, eucallypt-resveraatrol, osage orange-ooxyresveratrrol) and a significannt correlattion was obserrved between the preseence of these compoun nds in woodd and resisttance to deccay (Hart

39

et al., 1979). The antimicrobial activity of stilbenes has also been observed in other plants or systems. For example, the algicidial activity of 29 synthetic and natural stilbenes analogues was tested against the 2-methylisoborneol (MIB)-producing cyanobacterium Oscillatoria perornata and the cis and trans isomers of 4-(3,5-dimethoxystyryl)-aniline in particular showed a moderate and selective algicidial activity toward this microorganism (Mizuno et al., 2008).

1.4.3 Stilbenes as a deterrent against herbivores There is increasing evidence from different plant species, to support an important role for the constitutive production of stilbenes as deterrents agents against attack from insects and herbivores. For example, the higher concentration of pinosylvin (PS) and pinosylvin methyl ether (PSME) in buds, catkins and juvenile internodes of green alder (Alnus crispa) appears to drive the snowshoe hare (Lepus americanus) feeding preferences to mature internodes, which contain approximately threefold lower levels of these compounds compared to the juvenile form (Bryant et al., 1983; Clausen et al., 1986). A study which investigated the effect of phenols on conifer resistance to bark beetles (Coleoptera: Scolytidae) indicated that resveratrol caused a reduction of the feeding performance of the male with an effect increasing with concentration (Faccoli et al., 2007). Moreover, stilbene glucosides, that account for as much as 15% (w/w, dry weight) of Picea glehnii bark, showed a large feeding-deterrent ability against the termite Reticulitermes speratus (Shibutani et al., 2004). In addiction to the deterrent activity that can act against feeding by herbivores or insects, in some cases, stilbenes seem may also have a direct insecticidal effect. Stilbenoids extracted from the bark of Yucca periculosa, an ornamental plant characterised by a strong resistance to insect attack, were shown to inhibit the growth and development of a model lepidopteron corn pest (Spodoptera frugiperda) by interfering with its sclerotization process (Torres et al., 2003).

1.4.4 Stilbenes as alellochemicals In addition to their role in deterring herbivores and insects from feeding on plant tissues, the constitutive production of stilbenes may also be involved in inhibiting the growth of

40

neighbouring plants, ie act as alellochemicals. Stilbenes are known to inhibit photosynthesis, which is probably the evolutionary reason for their exclusion from photosynthetic tissues and their higher accumulation in dying tissues like xylem parenchyma cells or berries in advanced ripening or withering stages. Piceatannol from Scirpus marittimus (Cyperaceae) was demonstrated to inhibit both photosynthesis and plant growth (Seigler 2006). Moreover, evaluation of the potential allelopathic effects of 14 stilbenoids isolated from leaves of Carex distachya Desf. were evaluated on the germination and seedling growth of three coexisting Mediterranean species (Dactylis hispanica, Petrorhagia velutina, and Phleum subalatum) and showed inhibiting and stimulating effects, depending on the target species. Indeed, stilbene derived compounds can play a fundamental role as chemical signals (Fiorentino et al., 2008).

1.4.5 Stilbenes as antioxidants When plants are exposed to UV irradiation, photo-oxidative stress can occur as a result of the light-dependent generation of ROS (Asada 1994; Foyer et al., 1994). Active oxygen species are part of the alarm-signalling system in plants and act to modify the metabolic and transcriptional profile so that the plant can deal with adverse environmental conditions, invading organisms and ultraviolet irradiation. Nevertheless, excessive production of ROS is detrimental to the plants, damaging cellular components including proteins, lipids and RNA (Casati and Walbot, 2004). Stilbenes appear to be a part of the plant cell antioxidative defence system to counteract the toxicity of ROS. This is the case observed for several stilbenes recently isolated from stem and roots of Parthenocissus laetevirens, which posses an antioxidant activity, that is stronger for some cyclised stilbene oligomers with an unusual phenanthrene moiety compared to the one of uncyclised stilbenes (He et al. 2008). It was proposed that the photo-catalysed cyclization of stilbenes could be a UV-dependent transformation, which generates stronger antioxidants to counteract the UV-induced oxidative stress. Moreover, the heterologous expression of a grape cDNA coding for a stilbene biosynthetic gene under the control of the fruit specific promoter TomLoxB led to a high accumulation of trans-resveratrol in transformed fruits and a significant increase in the antioxidant capability and ascorbate content (D’Introno et al., 2009).

41

1.4.6 Stilbenes as antifungal agents Resveratrol and stilbenes in general have been known to be involved in the inhibition of growth of bacterial and fungal pathogens for at least 60 years (Morales et al., 2000). Pynosylvin methyl ether (PSME) and especially pinosylvin (PS), for instance, show fungicidal activity in vitro against the wood-destroying fungi Coriolus versicolor and Gloeophyllum trabeum (Schultz et al. 1992). The effect of resveratrol and its glucoside trans-piceid was evaluated in vitro on germination, appressoria formation, and penetration of Venturia inaequalis, the causal agent of apple scab. Resveratrol showed a significant inhibitory effect on fungal penetration whereas piceid displayed a significant inhibitory effect on spore germination and completely inhibited fungal penetration at concentrations between 200 and 400 μg mL-1. Adrian et al. (1997) reported a significant inhibitory effect of resveratrol on the conidial germination and mycelia growth of B. cinerea, the causal agent of gray mold, in liquid cultures when used at a concentration ranging from 60 μg mL-1 (25% inhibition) to 160 μg mL-1 (100% inhibition). Pterostilbene was found to have an even higher inhibitory activity, with complete inhibition of conidial germination at 60 μg mL-1. Resveratrol was found to induce major cytological modifications in conidia and sporelings, including the production of secondary and tertiary germ tubes, formation of curved germ tubes, cytoplasmic granulation of conidia, disruption of the plasma membrane and protoplasmic retraction in hyphal tip cells (Adrian et al., 1997). A similar activity was observed against grapevine downy mildew (P. viticola, at concentrations compatible with the activity range of other phytoalexins. Again, the toxicity of the more complex forms of stilbenes, such as δ-viniferins and pterostilbenes was higher when compared with the resveratrol (Pezet et al., 2004).

1.4.7 Stilbene content and disease resistance While a number of studies have established a positive correlation between stilbene levels and pathogen resistance, there is a lack of direct genetic proof to show that stilbenes play a role in disease resistance, especially on grapevines inoculated with various pathogens, analysis of stilbene production potential of different grapevine genotypes revealed that resistance to the necrotrophic pathogen B. cinerea appears to be strongly

42

correlated with the capacity of these genotypes to produce two major phytoalexins, resveratrol and ε-viniferins in response to UV-C treatment (Sbaghi et al., 1995; DouilletBreuil et al., 1999). Resveratrol production is particularly high in the American resistant species V. rupestris, reaching up 750 μg g-1 of fwt within 48 h after induction, a concentration that considerably exceed concentration necessary to inhibit fungal growth. In contrast, cultivars of the susceptible species V. vinifera such as Pinot noir, Mourvèdre or Xarello never exceed a resveratrol concentration 200 μg g-1 fwt following UV-C treatment. Downy mildew-resistant cultivars, for instance, accumulate a much higher level of stilbenes than susceptible ones and, in particular, rapidly convert resveratrol into the much more toxic viniferin compounds (Pezet et al. 2004). Similar results were obtained by studying the production and accumulation of stilbenes in V. vinifera inoculated with powdery mildew (E. necator). The level of stilbene at the infection site could determine subsceptibility or resistance to powdery mildew (Schnee et al., 2008). Highest viniferins concentration was in fact measured on resistant cultivars and correlated with inhibition of the pathogen growth. An involvement of stilbene and viniferins in particular, in contributing to the resistance against fungi is also suggested by the observation that the peroxidase B3, the only plant enzyme responsible for the oxidation of trans-resveratrol to viniferins (Morales et al., 1997), is a marker of P. viticola-resistance in some hybrids between different Vitis species, whereas is not constitutively expressed in P. viticola-susceptible parent species (RosBarcelo et al., 1996). Furthermore, peroxidase activity was also associated with the socalled “ontogenic resistance”, i.e. the leaf age-related increase in disease resistance. Effectively old leaves show a higher peroxidase activity compared to young ones and are characterized by a higher resistance. The non-protein amino acid β-aminobutyric (BABA) acid induces resistance against many different oomycetes, including downy mildew, through the activation of a plant physiological state called “priming” characterized by the activation of defence responses faster and stronger after pathogen challenge (Conrath et al., 2006). Pre-treatment of a susceptible V. vinifera cultivar with BABA prior to P. viticola infection also induces the accumulation of specific phytoalexins, trans-ε viniferin, trans-δ viniferin and trans-pterostilbene, which are undetectable in non BABA-primed plants. This significant of toxic stilbenes in BABA-primed grapevines could explain their enhanced resistance to P. viticola (Slaughter et al., 2008). Finally, high stilbene content was also

43

associated with disease resistance in peanuts. Kernels from insect-damaged pods of diseaseresistant genotypes accumulated significantly more trans-arachidin and trans-resveratrol phytoalexins than susceptible genotypes (Sobolev et al., 2007).

1.5

Stilbene biosynthesis

1.5.1 Stilbenes biosynthesis requires precursors from the general phenylpropanoid pathway The biosynthetic pathway leading to the production of stilbenes is a small branch of the general phenylpropanoid pathway and can be considered as an extension of the flavonoid pathway. The first steps of the general phenylpropanoid pathway are common to the majority of higher plant species and leads to the synthesis of malonyl-CoA and CoA-esters of cinnamic ester derivatives from the starting substrate phenylalanine. In most species that maintain this pathway, apart from grasses and some species of fungi and bacteria that directly use tyrosine as a substrate, three highly conserved enzymes are required to transform phenylalanine into the Coenzyme A (CoA)-activated hydroxycinnamoyl (phenylpropanoid) esters able to enter various downstream pathways. The first enzyme of the pathway PAL catalyses the deamination of phenylalanine to produce cinnamic acid, which acts as the precursor for all phenylpropanoids of secondary metabolism (Calabrese et al., 2004; MacDonald and D’Cunha, 2007). Cinnamic acid 4-hydroxylases (C4H) catalyzes the introduction of a hydroxyl group at the para position of the phenyl ring of cinnamic acid, giving rise to coumaric acid. This enzyme is a member of the ubiquitous enzyme family of oxygenases known as Cytochrome P450 hydroxylases (P450s) and so named because of the characteristic peak of absorption of their catalytic iron cofactors (Munro et al., 2007; Rosler et al., 1997). The final thioester-activation step of the general phenylpropanoid pathway is catalysed by the enzyme p-coumaroyl:CoA ligase (4CL), a member of the ubiquitous AMP-producing adenylating enzymes superfamily (AAE). The carboxyl group of p-coumaric acid is activated by the formation of a thioester bond with CoA to produce p-coumaroyl-CoA (Dixon and Paiva 1995; Ferrer, 1999). As mentioned above, in some particular cases, the use of tyrosine as starting substrates reduces the

44

number of steps of the general phenylpropanoid pathway from three to two (Hwang et al., 2003).

1.5.2 Plant polyketide synthases: chalcone and stilbene synthases In all plants characterized to date, the p-coumaroyl end product of the phenylpropanoid pathway represents the substrate entering the flavonoid pathway. Flavonoids represent a large (approximately 9000) structurally diverse class of phenolic compounds found in all higher plants (Ferrer et al., 2008). These natural plant products are utilized for a large range of purposes including antimicrobial defense, anthocyanin flower pigmentation, UV photoprotection, pollen fertility etc (Austin et al., 2003). All flavonoids are derived from the “chalcone scaffold”, in which the key step is catalysed by the ubiquitous enzyme chalcone synthase (CHS) that connects phenylpropanoid and flavonoid metabolism. Duplications and functional divergences of the CHS genes in the course of plant evolution have given rise to an expanding super family of homologues enzymes known as Type III polyketide synthases of which CHS represents the archetypal enzyme. Chalcone synthase, like the other genes belonging to the type III polyketide synthase family, catalyses the iterative condensation of three acetate units derived from decarboxylative condensation of malonyl-CoA onto the p-coumaroyl-CoA. Chalcones are then formed via an intramolecular cyclization of the resulting covalently linked linear tetraketide intermediate (Austin et al., 2003; Yu and Jez 2008). Downstream enzymes in branching pathways such as isomerases, reductases, hydroxylases, glycosyltransferases and acyltransferases act on this chalcone scaffold to produce a number of biologically important compounds such as flavones, isoflavonoid, flavonols, flavandiols, proanthocyanidins and anthocyanins (Ferrer et al., 2008). Despite it representing the most important enzyme of the CHS type III PKS family, from a evolutional point of view, CHS is not the only enzyme utilizing p-coumaroyl-CoA as a substrate. In stilbene producing plants, another key enzyme belonging to the type III polyketide synthase super family, stilbene synthase (STS), can also divert p-coumaroylCoA into the stilbene biosynthetic pathway. In contrast to CHS, STSs are only detected in stilbene-producing plants and catalyse the formation, in a single enzymatic reaction, of exactly the same linear tetraketide intermediate (from p-coumaroyl-CoA and three malonylCoAs) produced by CHS in the flavonoid pathway but with a different cyclization that lead

45

to the production of stilbenes rather than chalcones (Figure 1.4). STSs, together with CHSs, represent the most studied enzymes of the plant type III PKS family despite the existence of numerous other type III PKSs proteins. For this reason this group is often referred to as CHS/STS type III PKS family. STSs are classified into two types: (a) p-coumaroyl-CoAspecific type, such as resveratrol synthase (EC 2.3.1.95) or (b) cinnamoyl-CoA-specific type such as pynosylvin synthase (EC 2.3.1.146) depending on their preferential starting molecule. The former type occurs mainly in angiosperms such as peanut (Schnöpper et al., 1988), grapevine (Melchior and Kindl, 1991) and sorghum (Yu et al., 2005), while the latter type is typically found in gymnosperms such as P. sylvestris (Fliegmann et al., 1992), P. strobus (Raiber et al., 1995), and P. densiflora (Kodan et al., 2002). Nevertheless enzyme activity and kinetic analyses of recombinant STSs from gymnosperms revealed that different STSs, although exhibiting a preference for a given substrate, may also accept even different cinnamic acid derivatives and can be responsible for the production of different stilbenes depending on the starter molecule (Kodan et al., 2002).

1.5.3 Stilbene synthase and chalcone synthase catalyse the formation of the same polyketide intermediate The first step in the synthesis of the polyketide intermediate involves the binding of the starter molecule p-coumaroyl-CoA to the enzyme CHS or STS. The CoA group found in each of the substrates (p-coumaroyl-CoA and malonyl-CoA) provides a common recognition feature for the active site of the enzyme. Once bound, an active site essential cysteine residue (Cys-164) reacts with the p-coumaroyl-CoA molecule, releasing CoA and leaving the p-coumaroyl group attached to the enzyme via a thioester linkage (Jez and Noel, 2000). Next, extension of the molecule begins with binding of the first malonyl-CoA molecule to CHS. A catalytic histidine (or asparagine) in the CHS active site catalyzes decarboxylation of the malonyl-CoA to give rise to the reactive acetyl-CoA anion. This reactive intermediate acts as a nucleophile to attack the thioester bond of the enzyme-bound p-coumaroyl group. This reaction extends the polyketide chain by one acetate unit, with the diketide (acetate coumaroyl) reattaching to the active site cysteine and releasing CoA. The entire process is repeated two more times, generating triketide and tetraketide chains. At this point the reaction can go through the flavonoid pathway yielding naringerin-chalcone

46

or allternatively the biosyntthetic flow can enter the t stilbene pathway reesulting in stilbenes (Jez et al., 20011; Yu et al.,, 2008). Thhese differen nt products derive by ddifferent cy yclization proceesses operaated by CH HS or STS S: while CHS C cyclisees this inteermediate using u an intram molecular Claisen C conndensation between carbons C6 and C1 (nnumbering from the cysteeine thioesster), STS generates the stilbeene produccts resveraatrol or piinosylvin (depeending on the t starting substrates, p-coumaro oyl-CoA annd cynamoyyl-CoA resp pectively) by liinking C2 and C7 via an intraamolecular aldol conddensation, aaccompanieed by an addittional decarrboxylative loss of thee C1 carbon n as CO2 (A Austin et al., 2004; Shomura et al., 2005). 2 Austtin et al. (20004) compaared, in dettail, the cycclization proocesses in CHS C and STS.. A combinaation of X-rray crystallography an nd various mutants m of thhe enzymess showed that the STS alldol-type cyyclization is mainly du ue to electrronic effectts rather th han steric e actiive site. In the case of STS, a thhiolase esteerase-like hydrogenfactoors in the enzyme bondding networkk is involveed, which inncludes a waater molecuule into the ccatalytic site.

Figure 1.44 - Generaal phenylprropanoid pathway F p annd flavonoiid and stillbene b branching p pathways. T enzymees in these pathways The p arre shown as follows: PAL, P p phenyl amm monia-lyasee; C4H, cinnnamate-4-h hydroxylasee; 4CL, 4-ccoumaroyl--CoA s synthase; C CHS, chalconne synthasee; STS, stilb bene synthasse

47

1.5.4 Stilbene synthase evolved from chalcone synthase The STS protein was firstly extracted and purified in 1984 from stressed cell suspension cultures of peanut (Arachis hypogaea; Schnöppner and Kindl, 1984). The enzyme was found to be a dimer of estimated molecular weight 90 kDa with an iso-electric point (pI) of 4.8. Similar to CHS, STS are proteins of approximately 390 amino-acid residues, depending on the species. A conserved cysteine residue, located in the central section of these proteins has been shown to be essential for the catalytic activity of both STS and CHS enzymes and represents the binding site for the p-coumaroyl-CoA starting substrate (Lanz et al., 1991). The region around this active site is well conserved and can be used as a signature pattern for CHS and STS. This shared domain, indicated in PROSITE (http://expasy.org/prosite) as the CHS/STS active site has the following pattern (PS00441; Sigrist et al., 2010): R-[LIVMFYS]-x-[LIVM]-x-[QHG]-x-G-C-[FYNA]-[GAPV]-G-[GAC]-[STAVK]-x-[LIVMF]-[RAL].

The two proteins show a high degree of similarity based on sequence homology, which reaches approximately 75% depending on the species, on the gene structure and by comparison of their crystallographic structures (Ferrer et al., 2008). Gene structure is also conserved between members of the two gene families, with a single intron at exactly the same position, i.e within the triplet coding for Cys-60 (Schröder et al., 1988). Phylogenetic analyses of the STS and CHS families indicated that STSs of Scots pine, peanut and grapevine do not form a separate cluster but instead cluster with the CHSs proteins from the same or related plants (Schröder et al., 1988). This observation suggests there was not an ancestral STS gene in the strict sense and that STS evolved from CHS several times in the course of evolution (Tropf et al., 1994). This hypothesis was reinforced by the observation that only three amino acids exchanges were required within the N-terminal 107 aa of a CHS to STS function in an chimeric protein obtained from a fusuion of CHS and STS protein fragments.

1.5.5 Stilbene synthases in grapevine are a large gene family To date, STS genes have been cloned from peanut (A. hipogaea), Scots pine (P. sylvestris), Eastern white pine (P. strobus), Japanese red pine (P. densiflora), grapevine (Vitis vinfera L.) and sorghum (Sorghum bicolor), which is the only monocotyledon in

48

which an STS has been found. In many of these plant species STS genes exist as a family of closely related genes. For example, two STS genes have been found in peanut and Eastern white pine (Schröder et al., 1988; Raibert et al., 1995), Scots pine, has a small multigene family of at least five pynosylvin synthase genes (PST1, PST2, PST3, PST4 and PST5) (Preising-Müller et al., 1999) and Japanese red pine posses three members (PdSTS1, PdSTS2 and PdSTS3) (Kodan et al., 2002). Apart from Sorghum, for which only one STS member has been identified (Yu et al., 2005), grapevine represents the only stilbene producing plant species for which the entire genome has been sequenced (Jaillon et al., 2007; Velasco et al., 2007). Sparvoli et al. (1994), performing a molecular characterization of structural genes involved in anthocyanins and stilbene biosynthesis in V. vinifera had previously suggested that, based on Southern blot experiments, STSs and PALs, are present as large gene families consisting of 15-20 copies per haploid genome. They hypothesized that these gene families probably arose from the same ancestral gene and that subsequent gene duplications and molecular divergence may have contributed to the establishment of functionally distinct genes. Analyses of the first published drafts of the grapevine genome confirmed these observations, but were in disagreement on the size of the VvSTS family. Forty-three VvSTS members were predicted with GAZE and JIGSAW prediction tools in the 8.4 X coverage genome draft of the PN40024 genotype (French-Italian consortium) while only twenty-one members were predicted from the genome sequence of the PN ENTAV 115 genotype (IASMA). These observations are quite surprising: considering the higher heterozygosity of the ENTAV line compared to the PN40024, which might be expected to lead to the prediction of a higher number of VvSTS family members in the more heterozygous genotype (Table 1.1). Table 1.1 - Stilbene synthase gene predicted on grapevine genome database from the French-Italian consortium and from the Istituto Agrario di S. Michela all’Adige.

Line Assembly Coverage Genome Size Predicted annotation STS predictions

French-Italian Consortium PN40024 8.4X 12X V0 12X V1 487,1 Mb 487,1 Mb 487,1 Mb 33,434 26,346 26,346 43 21 42

IASMA PN ENTAV 115 6.5X + 4.2X 504,6 Mb 29,585 21

49

1.6

Regulation of stilbene biosynthesis

1.6.1 Transcriptional regulation of stilbenes synthesis The synthesis of major classes of phenolic compounds such as lignins, flavonoids and stilbenes represents a strictly regulated process both in space and in time during plant development and in the plant-environment interaction. Regulation of gene expression at the level of transcription is the predominant way by which plants control the production of these secondary metabolites. This is achieved through the action of a class of proteins, referred as “transcription factors” (TFs) that are able to recognise DNA in a sequencespecific manner and to regulate the frequency of initiation of transcription upon binding to specific sites in the promoter of target genes (Stracke et al., 2001). Transcription factors, which can act as activators, repressors or both, are generally composed at least of four discrete domains: DNA-binding domain, nuclear localization signal (NLS), transcription activation domain and oligomerization site. On the basis of similarities in the DNA binding-domain, TFs are grouped into different families such as MYBs, helix-loop-helix, zinc finger, helix-turn-helix, leucine zipper, scissors, MADS cassettes etc (Du 2009). In recent years a growing number of TFs responsible for the regulation of flavonol, lignin or anthocyanins biosynthesis have been isolated including the R2R3-MYBs, a sub-group of the MYB TFs super family, and the basic helix-loop-helix (bHLH) transcription factors (Boudet 2007). However, to date, no TF involved in the regulation of the stilbene biosynthetic pathway has been identified.

1.6.2 The MYB gene family MYB transcription factors are one of the largest and most important families of transcription factors described in plants. They are exclusive to Eukaryotes and the first member isolated was the oncogene v-Myb derived from the avian myeloblastosis virus (Kiempnauer et al., 1982). Subsequently three related genes were isolated in vertebrates: cMyb, A-Myb and B-Myb, which are thought to be involved in the cell cycle control (Weston, 1998). Homologous genes were also identified in insects, fungi, and slime moulds (Lipsick et al., 1996). Whereas MYB function in animals appears to be restricted to the control of cell proliferation and differentiation (Weston 1998), in plants, they are involved

50

in the control of a vast range of specific processes and the large size of the MYB family in plants is surely related to this multiplicity of different processes they have to regulate. The first MYB gene isolated from plants, C1, was cloned from Zea mays in 1987 and encodes a c-MYB-like transcription factor that is involved in the regulation of anthocyanin biosynthesis (Paz-Ares et al., 1987). A common feature of all MYB TFs is the presence of a module responsible for the DNA binding that is conserved among animals, plants and yeasts (Lipsick et al., 1996). This DNA binding domain typically consists of one to three imperfect adjacent repeats (designated R1, R2 and R3). Each repeat is approximately 50-53 aa long and encodes three α-helices, with the second and the third ones giving a helix-turn-helix (HTH) structure which intercalates the DNA major groove. Three regularly spaced tryptophan residues, which form a tryptophan cluster in this three dimensional HTH structure, are characteristic of a MYB repeat (Ogata et al., 1995). MYB factors have been classified in three major groups based on the number of adjacent imperfect repeats: R1R2R3-MYB, with three adjacent repeats, R2R3-MYB, with two adjacent repeats and finally R1-MYB, a heterogeneous group also called “MYB-related proteins” which usually, but not always contain a single MYB repeat (Braun et al., 1999; Kranz et al., 1998; Stracke et al., 2001). The C terminus of the MYB proteins appears to be related with the specificity of function, and, based on C-terminus conserved amino acid sequence motifs, which may facilitate the identification of functional domains, the plant MYB TFs have been divided in 22 subgroups. Members of the same subgroup are thought to posses similar functions (Stracke et al., 2001).

1.6.3 The R2R3-MYB subgroup MYB genes containing two repeats (i.e. R2R3-MYBs) constitute the largest MYB gene family in plants. In Arabidopsis thaliana the analysis of the complete genome sequence led to the identification of 198 genes belonging to the MYB super family. Among them 5 R1R2R3-MYBs, 126 R2R3-MYBs, 64 MYB-related R1-MYBs and three are atypical MYBs. A similar analysis of the Oryza sativa genome sequence led to the identification of a total of 183 MYB genes comprising 4 R1R2R3-MYBs, 109 R1R2-MYBs and 70 R1-MYBs (Yanhui et al., 2006). Recently, a genome-wide characterization of the grape R2R3-MYB

51

subgroup based on the annotated genome sequence of the homologous PN40024 genotype of V. vinifera cv. Pinot noir, revealed at least 108 R2R3-MYB members (Matus et al., 2008). The R2R3-MYB gene family has been extensively studied and been shown to be involved in several physiological and biochemical processes such as the regulation of secondary metabolism (Nesi et al., 2001; Baudry et al., 2004), control of cell morphogenesis (Lee and Schiefelbein, 1999, 2001; Higginson et al., 2003), meristem formation and floral and seed development (Shin et al., 2002; Steiner-Lange, 2003) and the control of the cell cycle (Ito et al., 2001; Araki et al., 2004). Moreover, some R2R3-MYB TFs were also found to be involved in the response of plant cells to biotic and abiotic stress (Abe et al., 2003; Denekamp and Smeekens, 2003; Nagaoka and Takano, 2003) and in light and hormone signalling pathways (Newman et al., 2004). R2R3-MYB TFs can be subdivided into three major subgroups based on the DNA-binding domain sequence: subgroup A whose members are c-Myb-like or similar to other animal MYB proteins, subgroup B that has only four members in A. thaliana, and subgroup C that represents a large group, with 70 members identified in A. thaliana (Romero et al., 1998). Some R2R3-MYB proteins require a basic helix-loop-helix (bHLH) partner to function properly. These proteins share a conserved interaction motif [DE]LX2[RK]X3LX6LX3R located on helices 1 and 2 of the R3 repeat that are thought to be involved in the interaction with the bHLH protein (Zimmermann et al., 2004).

1.6.4 A protein complex is required for initiation of transcription Frequently, but not always, eukaryotic gene expression appears to be regulated, not by single TFs, but rather by multi-protein complexes involved in the activation of target-gene transcription. This kind of transcriptional regulation, which involves protein-DNA and protein-protein interaction, is referred to as combinatorial control, and is thought to facilitate the complex eukaryotic regulatory network (Wolberger, 1999). The regulation of phenylpropanoid structural genes, and, in particular, those involved in the biosynthesis of anthocyanidins and proanthocyanidins, represents a significant example of this regulation mechanism. In all plant species analysed to date, the regulatory proteins involved in these multi-protein transcription complexes include members of protein families containing R2R3-MYB domains, basic helix-loop-helix (bHLH) domains, also referred to as MYC

52

proteins, and WD40 factors (Koes et al., 2005). In Z. mays, for example, the transcriptional activation of anthocyanin biosynthetic genes by the R2R3-MYB proteins ZmC1 and ZmP1 requires involvement of bHLH proteins from the R/B gene family (Goff et al., 1992). Yeast two-hybrid assays indicated these proteins can mutually interact, suggesting they are part of one transcription activation pathway (Zimmermann et al., 2004). The regulation of phenylpropanoid pathway by MYB proteins, in combination with bHLH proteins, appears to be conserved throughout the plant kingdom, as demonstrated by the interaction between the MYB protein PhAN2 and the bHLH proteins PhJAF13 and PhAN1 in Petunia hybrida or by the ability of strawberry FaMYB1 to interact with the maize heterologous bHLH protein ZmR (Aharoni et al., 2001; Quattrocchio et al., 1999). Examples of the combinatorial action between MYB factors and bHLH proteins are also documented in Arabidopsis: both TT8/AtBHLH042 and TT2/AtMYB123 are involved in the expression of genes DFR and BAN involved in flavonoid biosynthesis in developing seeds (Nesi et al., 2000, 2001). Furthermore, the over-expression of PAP1/AtMYB75 and PAP2/AtMYB90 as well as heterologous over-expression of the bHLH EGL3/AtBHLH002 (MYC-146) or of GL3/AtBHLH001 in petals of a white flowered mutant of Matthiola incana resulted in activation of anthocyanin biosynthesis (Ramsay et al., 2003). In A. thaliana the bHLH family comprises 162 members (Bailey et al., 2003). Among them GL3, EGL3 and TT8 are orthologous to R/B-like proteins from maize and cluster together in subgroup III. Finally, based on recent result it appears that in the model organism Arabidopsis, at least, several MYB TFs and bHLH proteins work together with the WD40 protein transparent testa glabra (TTG1) in a regulatory network that controls not only the phenylpropanoid pathway, but also the epidermal cell differentiation in root hairs and trichomes. WD40 proteins seem to be conserved throughout the plant kingdom in terms of sequence and regarding their role in the anthocyanin pathway. An emerging model is that in the combinatorial interaction between WD40, bHLH and R2R3-MYB, the ubiquitous proteins WD40 have a wideranging interaction; bHLHs affect overlapping subsets of the flavonoid network, whereas the MYB proteins are the key specific components providing the specificity for the downstream effects (Zhang et al., 2003).

53

1.6.5 Transcriptional control of flavonoid biosynthesis by R2R3-MYB factors The flavonoid biosynthetic pathway is considered one of the best systems available for studying regulation of plant gene expression (Davies and Schwinn 2003). As a consequence, the last decade has seen the characterization of a large number of TFs controlling, in a co-ordinated way, different sets of structural genes involved in this specific pathway. So far, many R2R3-MYB TFs have been identified for several model plants such as maize, Antirrhinum, tobacco, Petunia, and Arabidopsis. The first characterized plant R2R3-MYB TF was COLOURLESS1 (C1) from maize, which regulates genes encoding enzymes of the anthocyanin biosynthetic pathway (Paz-Ares et al., 1987). The heterologous expression of this gene in tomato led to the expression of almost all the genes required for the production of flavonols and anthocyanins (GomezMaldonado et al., 2004). Both Antirrhinum majus genes AmMYB305 and AmMYB340 promote the transcription of PAL, the first gene of the general phenylpropanoid pathway and also of two other genes involved in flavonol synthesis: CHI and F3H (Moyano et al., 1996). In sorghum, the R2R3-MYB TF y1 was shown to regulate the expression of CHS, CHI and DFR, all structural genes required for the biosynthesis of 3-deoxyflavonoids (Duthie et al., 2000). Through PCR-based and T-DNA tagging approaches, R2R3-MYB TFs

that

specifically

regulate

anthocyanin

production

(PRODUCTION

OF

ANTHOCYANIN PIGMENT1 AtMYB75/PAP1 and AtMYB90/PAP2) (Borevitz et al., 2000), flavonol (AtMYB11, AtMYB12, AtMYB111) (Mehrtens et al., 2005; Stracke et al., 2007) and tannin synthesis (REANSPARENT TESTA 2 AtMYB123/TT2) (Nesi et al., 2001) have been identified from Arabidopsis.

1.6.6 Several R2R3-MYB TFs regulate the general phenylpropanoid pathway in response to stresses Accumulation of flavonoids and activation of the phenylpropanoid pathway biosynthetic genes is a process that occurs naturally at several stages of plant development, but also in response to biotic and abiotic stresses, as a part of the general plant defense/stress response related to the phytoalexin accumulation.

54

Several R2R3-MYB TFs isolated from tobacco and carrot have been shown to be involved in this process, regulating phenylpropanoid structural genes in response to biotic and abiotic stresses or to treatment with stress-related hormones such as jasmonates. The NtMYB2 TF from tobacco is induced by wounding and is involved in the control of PAL and other defence-related genes which have a 13bp motif and L-box as a cis-element within their promoter region (Sugimoto et al., 2000). Similarly NtMYBJS1 is involved in the jasmonate signalling transduction and in the accumulation of PAL and C4H transcripts (Gàlis et al., 2006). Finally, the carrot R2R3-MYB factor DcMYB1 is induced by treatment with a fungal elicitor and UV-B exposure and positively interacts with the Box-L-like ciselement in the PAL promoter (Maeda et al., 2005).

1.6.7 Regulation of the flavonoid pathway in grape Grapevine is one of the most studied crop plants in terms of the regulation of the flavonoid biosynthesis pathway in developing berries by R2R3-MYB TFs (Figure 1.6). Transcriptional regulators of flavonoid biosynthesis have also been identified in other fruit crop species such as strawberry (FAMYB1) (Aharoni et al., 2001) and apple (MdMYB10, MdMYB1, MdMYBA) (Takos et al., 2006; Ban et al., 2007; Espley et al., 2007). Recent studies in grapevine have demonstrated the key role of VvMYBA1 and VvMYBA2 TFs in the regulation of the UDP-Glc:flavonoid-3-O-glucosyltransferase (UFGT) gene, which encodes an enzyme responsible for the conversion of anthocyanidins in anthocyanins (Kobayashi et al., 2002; Walker et al., 2007). Bogs et al. (2007) isolated and characterised VvMYBPA1, which is mainly involved in the regulation of proathoanthcyanidins (PA) biosynthesis. As well as activating the promoters of the two PA specific genes VvANR and VvLAR, VvMYBPA1 also activates the promoters of general flavonoid pathway genes, such as VvLDOX, VvF3’H and VvCHI. VvMYB5a and VvMYB5b are two closely related homologoues that are also involved in the transcriptional regulation of general branches of the flavonoid pathway, interacting with the promoters of the general flavonoid genes VvLAR, VvANS, VvF3’H and VvCHI (Deluc et al., 2006, 2008). Finally in 2009, a grape AtMYB12-like gene designated as VvMYBF1 was shown to complement the flavanoldeficent Arabidopsis mutant myb12 underlining its role in the regulation of this branch of the flavonoid pathway and in the interaction with the flavonol aglycone biosynthetic gene

55

VvFLS1 (Czemmel et al., 2009). For all these R2R3 3-MYB TFs, interactioon with a bHLH b ( wass essential for f their abillity to activ vate gene exxpression. protein (EGL3)

Figure 1.6 - Scheematic reprresentation of the braanching patthways for flavonoidss and R3-MYB traanscription factors knoown to be iinvolved in their stilbeness productionn and R2R regulatioon. The enzymes in these t pathw ways are sh hown as follows: PAL L, phenylalanine ammonia-lyase; C44H, cinnam mate-4-hydrooxylase; 4C CL, 4-coum maroyl-CoA synthase; CHS, chalconee synthase; STS, stilbeene synthasse; CHI, ch halcone isom merase; F3H H, flavanon ne-3bhydroxyylase; FLS, flavonol syynthase; LA AR, leucoan nthocyanidiin reductasee; UFGT, UDPU Glc:flavoonoid-3-O glucosyltran g nsferase; AN NR, Anthoccyanidin redductase.

56

1.7

Aims of the study Stilbene synthases are present as a large multigenic family in grapevine, and are

thought to be involved in the response to biotic and abiotic stresses. Understanding the response dynamics of members belonging to this gene family and the mechanisms leading to the activation of these genes could provide an important tool to shed light on this particular stress-response in grapevine and on the possible contribution of this gene family to defence against pathogen attack. The main goal of this study could be divided into two principal components: (a) investigation of the genome organization of the entire STS family in grapevine and analyse the transcription of each family member in different tissues, at different developmental stages and under different stress conditions, in order to determine if different members are characterised by specific patterns of expression and, (b) identification and characterization of TFs that may be involved in the regulation of the stilbene synthase biosynthetic pathway in grapevine. The final section of this thesis presents the results of an additional study that has been performed during this Ph.D. involving an analysis of the genetic diversity and differentiation pattern of an endangered northeastern Italian germplasm using chloroplast microsatellites, to enable an adequate strategy for future germplasm conservation. The specific objectives described in this study were: 1. Genome-wide analyses of STS gene family in grapevine by: I.

Identification, annotation and phylogenetic analyses

II. III.

mRNA-seq expression analyses under different biotic and abiotic stresses Microarray expression analysis in different tissues and developmental stages

2. Identification of candidate R2R3-MYB TFs involved in the regulation of the STS pathway in grapevine by: I.

Analysis of R2R3-MYB family expression profile in Illumina and microarray dataset

II. III.

Real time expression analyses of selected VvSTSs and VvMYB TF genes Gene reporter assay to confirm interaction between selected promoter regions of

selected VvSTS genes and VvMYBs TF candidates

57

IV.

Functional study of candidate VvMYB TFs by silencing and over-expression in grape hairy roots

3. Assessment of the genetic diversity and origin of an endangered Italian grapevine germplasm collection using Chloroplast microsatellite markers

58

Chapter 2 – General Material and Methods

2.1

Materials

2.1.1 General solutions and growth media All chemicals used were analytical or molecular biology grade and obtained from BDH or Sigma. Solutions and growth media used in this project are listed Table 2.2. Solutions were prepared with nanopure and autoclaved when appropriate. Restriction endonucleases were obtained from New England Biolabs®, Fermentas® or Roche®. The Sources of any other supplies used in this project are indicated in the “relevant methods” section.

Table 2.1 - Suppliers of chemicals, enzymes, growth media and other miscellaneous consumables. Amersham Biosciences

Castle Hill, NSW, Australia

Bioline

Alexandria, NSW, Australia

Fermentas

Distributed by Quantum Scientific and M-Medical S.r.l.

Invitrogen

Mount Waverley, Vic, Australia

M-Medical S.r.l.

Milano, Italy

Promega

Annandale, NSW, Australia; Milano, Italy

Qiagen

Clifton Hill, Vic, Australia; Milano, Italy

Quantum Scientific

Paddington, QLD, Australia

Roche Diagnostic

Castle Hill, NSW, Australia; Monza (MB), Italy

BDH

Milan, Italy

Sigma

Milan, Italy

Duchefa S.r.l.

Milan, Italy

Duotech S.r.l.

Milan, Italy

59

Table 2.2 - General solutions and growth media. Solution DNA loading dye (10X) RNA loading dye (5X) LB (liquid growth media) LB Agar (Solid growth media)

Composition 78% (w/v) glycerol, 0.25% bromophenol blue, 0.25% (w/v) xylene cyanol, 10 mM EDTA 90% (V/V) deionised formamide, 10% (v/v) DNA loading dye 1% (w/v) bacto-tryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl, (pH 7) 1% (w/v) bacto-tryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl, 1.2% (w/v) bacto-agar (pH 7)

TAE Buffer

40 mM Tris-acetate, 1mMEDTA (pH 8)

TBE Buffer

90 mM Tris-HCl, 90 mM Borate, 2 mM EDTA (pH 8.3)

TE Buffer (pH 7.6)

10 mM Tris-HCl, 1 mM EDTA (pH 8)

Denaturation solution (Southern blot)

0.5 M NaOH,1.5 M NaCl

Neutralization solution (Southern blot)

0.5 M Tris (pH 7.5), 3M NaCl

Maleic acid tampon (pH 7.5) (Southern blot)

0.1 M Maleic acid, 0.15 M NaCl,

Pre-hybridization solution (Southern blot)

0.5 M Phosphate buffer (pH 7.2), 7% (w/v) SDS, 10 mM EDTA

Hybridization solution (Southern blot)

0.5 M Phosphate buffer (pH 7.2), 7% (w/v) SDS ,10 mM EDTA, 1% (w/v) BSA

2X washing solution (Southern blot)

SSC 2X, 0.1% (w/v) SDS

0.5X washing solution (Southern blot)

SSC 0.5X, 0.1% (w/v) SDS

0.1X washing solution (Southern blot)

SSC 0.1X, 0.1% (w/v) SDS

Washing buffer (Southern blot)

0.3% Tween 20 in maleic acid buffer

20X SSC (pH 7)

3M NaCl, 0.3M Citrate

60

2.1.2 Oligonucleotide primers Oligonucleotide primers used in this project were obtained from Sigma-Aldrich (Milan, Italy), Invitrogen S.r.l. (Milan, Italy) and GeneWorks (Hindmarsh, SA, Australia) and their sequences are reported in Table 2.3. Degenerate oligonucleotide were designed using CODEHOP software (ConsensusDegenerate

Hybrid

Oligonucleotide

Primers;

Rose

http://bioinformatics.weizmann.ax.il/blocks/codehop.html). designed

using

Primer3Plus

software

All

et other

(Untergasser

et

al.,

1999;

primers

were

al.,

2007;

http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) or manually with the assistance of Oligo Calculator (http://mbcf.dfci.harvard.edu/docs/oligocalc.html) for estimating the Tm. Table 2.3 - Oligonucleotide primers used in this study. Underlined sequences correspond to specific restriction enzyme sites. Mixed base codes: R (AG), Y (CT), H (GT), S (GC), W (AT), H (ACT), B (GCT), V (AGC), D (AGT), N (AGCT). Primer

Description

Sequence (5'-3')

B26

3' RACE PCR

GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT

EF1-F

Quantitative RT-PCR

CGGGCAAGAGATACCTCAAT

EF1-R

Quantitative RT-PCR

AGAGCCTCTCCCTCAAAAGG

SP6

Clone screening

TTAGGTGACACTATAGAATCTC

T7

Clone screening

GTAATACGACTCACTATAGGG

Vv18S Fw

Quantitative RT-PCR

CAACAAACCCCGACTTCTG

Vv18S Rev

Quantitative RT-PCR

TGTCACTACCTCCCCGTG

VvCHS-deg-Fw

Degenerate PCR

CCGKCARGACATGGTGGTG

VvCHS-deg-Rev

Degenerate PCR

CRAGRTCCTTGGCAAGG

VvERF-1a

Degenerate PCR

GAGGCTTGAGAAGAAGNCCNTGGGG

VvERF-1c

Degenerate PCR

GAGGCGTGAGAAGACGNCCNTGGGG

VvERF-2a

Degenerate PCR

CTGGGGCAAGTTCGCNGCNGAAAT

VvERF-2g

Degenerate PCR

CTGGGGCAAGTTCGCNGCNGAGAT

VvJAZ2-F

Quantitative RT-PCR

TAACGGAAGGATCTGCGTTT

VvJAZ2-R

Quantitative RT-PCR

GGAGGTTGCTTCCATCCTATT

VvMYB14-ATG-Xho

Clone full lenght cDNA GCGCTCGAGAAAATGGGGAGAGCTCCTTG

VvMYB14F

Quantitative RT-PCR

VvMYB14-hp1-attB1-F

Clone full lenght cDNA GGGGACAAGTTTGTACAAAAAAGCAGGCTAGACACTCTCTTGATGCGTC Clone full lenght cDNA GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCATATTTCTGATAATTCATGC

VvMYB14-hp1-attB2-R

TCTGAGGCCGGATATCAAAC

VvMYB14R VvMYB14-STOPBamHI

Quantitative RT-PCR

GGGACGCATCAAGAGAGTGT

VvMYBA1-2 Rev

Quantitative RT-PCR

GTTCAAACCTTGGCAAGGCTT

M13F

Clone screening

GTAAAACGACGGCCAG

M13R

Clone screening

CAGGAAACAGCTATGAC

Clone full lenght cDNA CGCGGATCCTTCTTCCCTCATATTTCTGATAATT

61

Table 2.3 – (Continued)

62

Primer

Description

Sequence (5’-3’)

VvMYBA3-Rev

Quantitative RT-PCR

CCAGAGGCTTGCGAGACTTT

VvMYBA3-Xba-Rev

Clone full lenght cDNA

CGATCTAGATCACCTCCCTGGATTTGTTC

VvMYBA3-Xho-Fw

Clone full lenght cDNA

TGACTCGAGTCGATGGAGAGCTTAGGAG

VvMYBA-Fw

Quantitative RT-PCR

GAGTTTGCATTAGACGAGGTTG

VvMYBA-Rev

Degenerate PCR

CTGTGTTGCAGTTTCTTCTGTC

VvMYBdeg3aF

Degenerate PCR

CATAGGTGCGGAAARWSATGYMG

VvMYBdeg3cF

Degenerate PCR

CATAGGTGCGGAAARWSCTGYMG

VvMYBdeg3gF

Degenerate PCR

CATAGGTGCGGAAARWSGTGYMG

VvMYBdeg3tF

Degenerate PCR

CATAGGTGCGGAAARWSTTGYMG

VvMYBdeg4R

Degenerate PCR

TTCTTAAGATGGGTGTTCCARTARTTYTT

VvMYBdeg5aR

Degenerate PCR

AACTTCGTTATCAGTNCKNCCAGG

VvMYBdeg5cR

Degenerate PCR

AACTTCGTTATCAGTNCKNCCCGG

VvMYBdeg5gR

Degenerate PCR

AACTTCGTTATCAGTNCKNCCGGG

VvMYC-2 F1

Quantitative RT-PCR

AAATGGAAGGGAAGAGCCATT

VvMYC-2 R1

Quantitative RT-PCR

TTGTCCGACTCTGCACTTTG

VvSTS26pF-Sal

Clone promoter sequence

GCGGTCGACAAAACCCCAACTTAGGAAAGC

VvSTS26pR-Not

Clone promoter sequence

GCGGCGGCCGCTTCTACACCGGAGGTTGTAC

VvSTS22F

Quantitative RT-PCR

AAGAAATCACTCAAGAAAGAAAATATC

VvSTS22pSAL-F

Clone promoter sequence

GCGGTCGACTACCTCCTAAAGGTTCTTTCCT

VvSTS22pNOT-R

Clone promoter sequence

GCGGCGGCCGCTGCTGCTACTCCAATTGGAA

VvSTS22R

Quantitative RT-PCR

AAAGCTTCTCCTTATGACTTTTCT

VvSTS36F

Quantitative RT-PCR

CTTGAAGGGGGAAAATGCT

VvSTS36R

Quantitative RT-PCR

TTACTGCATTGAAGGGTAAACC

VvSTS36p1SAL-F

Clone promoter sequence

GCGGTCGACCAGCGCGAATACATAAACAC

VvSTS36p2SAL-F

Clone promoter sequence

GCGGTCGACTTATTTCGTGGATATTTGATGG

VvSTS36p4SAL-F

Clone promoter sequence

GCGGTCGACCACGCTTAAGTGATGAATGAC

VvSTS36p5SAL-F

Clone promoter sequence

GCGGTCGACTAACATTAGTTATTGACCGCC

VvSTS36pNOT-R

Clone promoter sequence

GCGGCGGCCGCGCTAGATACGTAATTGAATTGAAG

VvSTS36pSAL-F

Clone promoter sequence

GCGGTCGACCCGGATTGAAATCTAATAAAG

VvSTS35p-seq

Clone promoter sequence

GGAGGGACATGCATCACT

VvSTSdegFw

Degenerate PCR

GGTGACTAAGTCCGANCAYATGAC

VvSTSdegRev

Degenerate PCR

GACTTTGGCTGTCCCCAYTCYTT

VvMYBA1-F

Quantitative RT-PCR

CTTTTCGGCTTCTGGAGAGA

VvMYB real R

Quantitative RT-PCR

CAAGAACAACTTTTGAACTTAAACAT

VvMYB5AF

Quantitative RT-PCR

CTAGAACTGTCTGGGAACCT

VvMYB5AR

Quantitative RT-PCR

TGCAAGGATCCATTTCACATAC

VvMYB5BF

Quantitative RT-PCR

TGACAGCCGGTGTTCTTTAAT

VvMYB5BR

Quantitative RT-PCR

AGCATACTAACACAACAACACAACC

VvMYBPA1F

Quantitative RT-PCR

AGATCAACTGGTTATGCTTGCT

VvMYBPA1R

Quantitative RT-PCR

AACACAAATGTACATCGCACAC

VvMYB12 F

Quantitative RT-PCR

GGTGCCGGAGGTTGAGGGGT

VvMYB12 R

Quantitative RT-PCR

GGGGAAGAGCAGGAGGGCCA

VvMYB15aF

Quantitative RT-PCR

GGCGTCAGATTTCCCAGCA

VVMYB15AR

Quantitative RT-PCR

GAAAACTATGCATCACTATGTTCAG

2.1.3 Bacterial strains All cloning procedures were performed using Escherichia coli strains XL1-Blue (Stratagene, Cedar Creek, TX) or DH5α (InvitrogenTM) depending on the cloning procedure.

2.1.4 Grapevine tissue For mRNA-sequencing and Southern blot analyses leaves were obtained from field grown vines at the “Lucio Toniolo” experimental Farm of the University of Padova (Legnaro, PD, Italy). V. vinifera cv. Pinot noir plants (clone 115 on K5BB rootstock) were obtained from a certified nursery (Vitis Rauscedo, Pordenone, Italy). For real-time PCR analyses leaves, berries, cell cultures and in vitro plantlets of V. vinifera L. were obtained and samples from potted glasshouse vines at the Waite Campus (Adelaide, South Australia, latitude 34°56’ south, longitude 138°36’ east). Grapevines were propagated from dormant Shiraz cuttings obtained from the Riverland Vine Improvement Committee (Monash, South Australia) and stored at 4°C before use. The base of each cutting was dripped in Clonex Hormone Rooting Gel (Growth technology, Western Australia) and transferred to pots containing the following potting mix: composted pine bark (1:2 v/v) supplemented with 1 gL-1 ferrous sulphate and 4 gL-1 Osmocote slow release fertilizer (Yates, Australia). After 3-4 weeks incubation in a 25°C heat bed containing Perlite with a light watering every two days rooting and bud-burst occurred. Rooted cuttings were subsequently transferred into temperature controlled glasshouses with a minimum air temperature of 23°C and a maximum temperature of 25°C. Each pot was irrigated with a single drip emitter with two irrigations per day.

2.1.5 Plasmopara viticola culture and maintenance A field isolate of P. viticola was maintained on glasshouse-grown potted vines. Infected leaves were removed and incubated upside down on moist 3MM filter paper in large Petri dishes overnight at 22°C under a 12h light / 12h dark cycle to facilitate sporulation. In order to collect spores, leaves exhibiting sporulation were placed in a 50 mL Falcon tube containing 5 ml water and agitated to displaces the conidia. The leaf was

63

removed and the process repeated with other infected leaves until the water was visibly cloudy. A haemocytometer was used to estimate the sporangia concentration and the solution was diluted to a concentration of 1 x 105 sporangia ml-1. In order to maintain the inoculum the sporangia solution was sprayed on the abaxial surface of Cabernet Sauvignon detached leaves placed upside down on large Petri dishes. The leaves were incubated 7 days under at the same conditions mentioned above in order to obtain new sporangia.

2.2

Methods The following section contains general methods used during this research project and is

essentially as described by Sambrook et al. (1989) or according to the manufacturer’s instructions. Methods modified significantly or specific to individual experiments are outlined in the relevant chapter.

2.2.1 Polymerase Chain Reaction (PCR) Amplification of DNA was carried out with different Taq polymerase enzymes depending on the specific requirement. Routine amplifications on genomic, plasmid or cDNA templates were performed using the pre-optimized reaction mix MangoMix (Bioline) containing Mango Taq DNA Polymerase. The reactions were performed in a 15 μl volume with 2 μl of cDNA or 10ng of DNA and oligonucleotide primers at a concentration between 200 and 500 nM. Alternatively the BIOTAQ Red DNA Polymerase was used as follows: DNA template (cDNA 2ul, genomic DNA 10ng), oligonucleotide primers (200-500 nM), 1x NH4 buffer, 200 uM dNTPs (Invitrogen), 1.5 mM MgCl2 and 0.25 unit of BioTaq Red DNA Polymerase in a 15ul volume. Thermal cycling generally consisted of 3 min at 94 °C (1 cycle); 30 s at 94 °C, 30 s at 50-60 °C, 30–90 s at 72 °C (2635 cycles); 10 min at 72 °C (1 cycle). For proofreading amplifications Platinum® Taq DNA Polymerase High Fidelity (InvitrogenTM) was used, according to manufacturer’s instructions. Thermal cycling generally consisted of 3 min at 95 °C (1 cycle); 30 s at 94 °C, 30 s at 50-60 °C, 30–90 s at 72 °C (26-35 cycles); 10 min at 72 °C (1 cycle). Alternatively Velocity DNA Polymerase (Bioline) was used according to manufacturer’s instructions. Reactions were carried out in

64

50 ul volume with the following cycle conditions: 2 min at 96 °C (1 cycle); 30 s at 96 °C, 30 s at 57 °C, 40 s at 72 °C (33 cycles); 10 min at 72 °C (1 cycle).

2.2.2 Agarose gel electrophoresis EasyCast horizontal minigel tanks (OWLScientific Inc., Cambridge, UK) were used for gel electrophoresis of DNA. Agarose gels, 0.7-2.0% w/v were prepared with TBE Buffer (Table 2.1), and contained 0.5 μg mL-1 ethidium bromide. Before loading, DNA loading dye (Table 2.1) was added to each sample to a final concentration of 2x. Gels were run at approximately 100 V in TBE running buffer and visualized using a short wavelength UV transilluminator. For electrophoresis of RNA samples the gel tanks, trays, and combs were pre-treated with 0.2 M NaOH for 1-2 hours. Samples were heated at 70°C for 2 min in the presence of RNA loading dye (table 2.1) to denature samples, chilled on ice for 2 mins and loaded onto 1.2% w/v agarose gel.

2.2.3 Purification of DNA fragments from agarose gels Purification of specific DNA fragments from agarose gels after visualization by trans illuminator was achieved using a QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions or a PureLinkTM Quick Gel Extraction Kit (InvitrogenTM). DNA was eluted in 30 μl of TE (Table 2.1) diluted 1:10 in sterile water and visualized by electrophoresis on an ethidium bromide-stained agarose gel (Section 2.2.2).

2.2.4 Dephosphorylation of DNA 5’ termini Antarctic phosphatase (New England Biolabs) was used for the removal of 5’ phosphate groups from restriction-digested vector DNA to avoid self-ligation according to manufacturer’s instructions. Antartic phosphatase (5 units) was added to restricted DNA fragments with the appropriate buffer and incubated at 37 °C for 15 min. The enzyme was inactivated by incubation at 65 °C for 5 min.

65

2.2.5 Purification of DNA samples following enzymatic reactions Purification and concentration of DNA samples after restriction enzyme digestion, PCR (Section 2.2.4) and dephosphorylation (Section 2.2.4) reactions was achieved using a PureLinkTM Quick Gel Extraction Kit according to the manufacturer’s instructions.

2.2.6 DNA ligation Purified PCR products were ligated into the T-tailed vectors pGEM T-Easy (Promega) or pDRIVE (Qiagen) using the pGEM T-Easy Vector System I (Promega) and the PCR Cloning Kit (Qiagen) according to the manufacturer’s instructions. Cloning of blunt-ended PCR products generated with proof-reading Taq polymerase (Velocity DNA Polymerase or PfuUltraTM II Fusion HS DNA Polymerase) was carried out using the Zero Blunt® PCR cloning kit (InvitrogenTM) according to the manufacturer’s instructions. All ligations were carried out in 10 μl reaction volumes containing an insert : vector ratio of approximately 6:1, 10 units of T4 DNA ligase (New England Biolabs.) in the supplied buffer and incubated overnight at 16 °C.

2.2.7 Butanol precipitation of ligation reactions Ligation reactions were precipitated with n-Butanol to eliminate salt from the ligation buffer to increase transformation efficiency and eliminate arcing of cuvettes. The ligation was transferred in a 1.5 ml tube and 1ml of n-butanol added. After a brief vortex (5s), the mixture was centrifuged at 11,300 g for 10 min at room temperature. The supernatant was decanted, 200 μl of 70% (v/v) ethanol added and the sample re-centrifuged at 11,300 g for 10 min at room temperature. After decanting the supernatant, the pellet was dried under vacuum for 15 min and resuspended in 2-10 ul of nanopure water (Table 2.1).

66

2.2.8 Preparation of electro-competent E. coli cells LB (500 mL) was inoculated with 5 mL of an overnight culture of E. coli XL1-blue or DH5α cells and grown at 37 °C with shacking until it reached an optical density (OD600) of 0.5. Cells were chilled on ice for 10 mins and centrifuged for 10 mins at 4°C at 5000 g. Cells were resuspended in 500 ml of sterile ice-cold water and centrifuged again. The cells were washed and centrifuged again in 250 ml sterile ice-cold sterile water and resuspended in 10 ml of ice-cold sterile 10% (v/v) glycerol. The cells were transferred to a new 50 ml falcon tube and centrifuged again. The cells were finally resuspended in 2 ml of ice-cold sterile 10% (v/v) glycerol. Aliquots of 40 μl were placed into ice-cold eppendorf tubes, snap frozen in liquid nitrogen, and stored at -80 °C.

2.2.9 Transformation of bacteria with recombinant plasmids Electro-competent E. coli XL1-blue or DH5α cells were transformed by electroporation using a Gene-Pulsar apparatus (Bio-Rad, CA, USA). Approximately 10 ng of plasmid DNA or 1ul ligation reaction (up to 5 μl if the ligation had been precipitated in n-butanol) was mixed with a 40 μl aliquot of cells and transferred to an ice-cold cuvette (path length = 1mm; Invitrogen). The cuvette was given a single pulse in the Gene Pulser (1.8 KV, 125 μFD, 200 Ohms), and immediately resuspended in 800 μl of LB (Table 2.1). After incubation at 37 °C for 50 min with gentle shaking, the transformed cells were spread on LB agar plates (Table 2.1) with the appropriate antibiotic and incubated at 37 °C overnight.

2.2.10 Preparation of plasmid DNA High quality plasmid DNA for constructs preparation and DNA sequencing was prepared from 2-4 ml overnight bacterial cultures using PureLink™ Quick Plasmid Miniprep Kit (Invitrogen) according to manufacturer’s instructions. Large-scale preparation of plasmid DNA for transient transformation of grapevine cell cultures was achieved using QIAfilter Plasmid Midi Kit and HiSpeed Plasmid Midi Kit (Qiagen) according to manufacturer’s instructions.

67

2.2.11 Preparation of bacterial glycerol stocks Glycerol stocks of bacterial cultures were prepared by adding 1 vol of 40% (v/v) sterile glycerol to an overnight culture, snap-freezing in liquid nitrogen, and storing at -80 °C.

2.2.12 Preparation of DNA samples for sequencing DNA sequencing reactions were carried out using an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, Norwalk, CT, USA) according to the manufacturer’s instructions. Extension products were precipitated by adding 80 μl of 75% (v/v) isopropanol, incubating at room temperature for 30 min in the dark and centrifuging for 20 min in a microfuge at maximum speed (∼ 16000 g). After discarding the supernatant and adding 250 μl of 75% (v/v) isopropanol, tubes were centrifuged for 5 min at maximum speed. The supernatant was aspirated carefully and samples dried in a vacuum centrifuge for 10-15 min. Sequencing reactions were analysed at the Australian Genome Research Facility (Urrbrae, South Australia). Alternatively samples were dehydrated in miniAmp® at 60 °C and sent to the sequencing spin-off of CRIBI (University of Padova, Italy). Generally oligonucleotide primers used for sequencing were M13 forward or reverse and T7 or SP6 depending on the specific plasmid used for cloning (Table 2.3). Sequence chromatograms were analysed by Vector NTI software (Invitrogen).

2.2.13 Extraction of genomic DNA For routine amplifications, genomic DNA was extracted from approximately 100 mg of fresh grapevine tissues using the “Plant DNeasy MINI Kit (Qiagen) according to manufacturer’s instructions.

2.2.14 Extraction of total RNA Total RNA was extracted from fresh or frozen grapevine tissues using the “SpectrumTM Plant total RNA Kit (Sigma) according to manufacturer’s instructions. Tissue samples obtained from leaves, berries and roots were ground in liquid nitrogen and 80-110 mg of powder were used for extraction. Total RNA was quantified spectrophotometrically using a

68

NanodropTM 1000 Spectrophotometer (Wilmington, USA) and integrity checked by agarose gel electrophoresis.

2.2.15 First strand cDNA synthesis Total RNA (1μg) was reverse transcribed using the SuperScript III First Strand Synthesis System for RT-PCR (Invitrogen) with the oligo (dT)20 primer according to manufacturer’s instructions. Before use in RT-PCRs, cDNA were diluted 1:20 in autoclaved water. Alternatively the Transcription First Strand cDNA Synthesis Kit (Roche) was used.

2.2.16 Sequence analysis and manipulation DNA sequences were analysed using various basic local alignment search tools (BLAST) served at the National Centre for Biotechnology Information (NCBI) website (http://blast.ncbi.nlm.nih.gov/) and at the Genoscope Grape Genome Browser site (http://www.genoscope.cns.fr/externe/GenomeBrowser/Vitis/).

Multiple

sequence

alignments were performed by Vector NTI software using clustalW and displayed and further manipulated using Jalview software or GeneDoc software (Nicholas et al., 1997; Waterhouse et al., 2009). Protein domains and functional sites were predicted by mean of PROSITE database (Sigristd et al., 2010; http://expasy.org/prosite/). Cis acting regulatory elements in promoter regions were identified using PLACE (Plant Cis Acting Regulatory DNA Element; http://www.dna.affrc.go.jp/PLACE/index.html).

69

70

Chapter III: Genome-wide analysis of STS genes in grapevine

3.1

Introduction To date, stilbene synthase genes have been isolated from peanut, sorghum, several pine

species such as Pinus sylvestris, Pinus densiflora and Pinus strobus and grapevine. In the majority of this species STS genes are organized in multigenic families, except for sorghum, which has been demonstrated to posses just a single STS gene based on the analysis of its genome sequence. While in the other species these STS multigenic families are composed of two, three or five members, grapevine is predicted to posses an higher number of STS genes, ranging from a minimum of 21 members, based on the genome sequence obtained from genotype PN ENTAV 115 (Velasco et al., 2007) to a maximum of 43 members based on the 8.4 X assembly coverage of the PN40024 genotype provided by the French-Italian Consortium (Jaillon et al., 2007). The main aim of this chapter is characterization of the grapevine STS gene family commencing with the identification, annotation and phylogenetic analysis of all family members. In order to achieve this objective, different approaches were used. The Hidden Markov Model for the CHDS/STS active site was used as a query for blast searches on all available releases of the grapevine genome (8.4X, 12X V0 and 12X V1) with the aim of identifying all gene predictions with a putative CHS/STS function. These analyses were complemented with ILLUMINA transcriptional data kindly provided by the Institute of Applied Genomic (IGA, Udine, Italy) and used by the French-Italian Consortium to validate and confirm predictions obtained with GAZE and JIGSAW software. To extend and validate the bioinformatic analysis, southern blot analyses on genomic DNA isolated from V. vinifera cv. Pinot noir leaves, were also undertaken. In all, a total of thirty-six grapevine stilbene synthase genes were identified, annotated and studied from a phylogenetic point of view. The second part of the characterization of the VvSTS gene family focused on the transcriptional profile of each gene member identified in response to different biotic and abiotic stress conditions. Due to the high sequence conservation amongst members of the VvSTS gene family, it’s difficult to clearly discriminate between individual members using

71

PCR-based expression analyses. Therefore, an mRNA-seq next generation sequencing approach (Illumina) was employed. The entire transcriptome profile of wounded, UV-C treated and downy mildew-infected leaf discs obtained from V. vinifera cv. Pinot noir was analysed to investigate the expression dynamics of each individual VvSTS gene in response to these stresses. To complement and complete the whole-family expression analysis, a study of the temporal and spatial expression of each VvSTS gene during grapevine development was undertaken using a grapevine expression atlas kindly provided by the Prof. Mario Pezzotti (University of Verona, Italy). The grapevine expression atlas was generated using a microarray approach based on prediction obtained from the 12X V1 coverage assembly of the PN40024 genotype. Numerous tissues at different developmental stages were analysed confirming and extending our mRNA-seq data and providing interesting information about the constitutive or developmental-stage specific accumulation of VvSTS transcripts in grapevine. The microarray analysis also included RNA samples extracted from berries undergoing post-harvest withering which is used in the production of dessert and fortified wines. This withering process has been shown to induce a strong dehydration stress response resulting in the high level expression of genes involved in stress protection mechanisms including stilbene synthases (Zamboni et al. 2008).

72

3.2

Materials and methods

3.2.1 Database search, gene structure determination and chromosomal locations of grapevine STS genes Protein sequences encoded by STS genes in grapevine were identified using BLAST (Altschul et al., 1990) at the Genoscope BLAST server (http://www.cns.fr/cgibin/blast_server/projet_ML/blast.pl), providing the 8.4X and 12X V0 assembly coverage of the PN40024 genotype, and at the National Centre for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). The search was also extended by consulting an uploaded version of the PN40024 12X assembly coverage indicated as V1 and kindly provided by Prof. Giorgio Valle (University of Padova, Italy). A BLASTP search of the proteome database of the Genoscope Genome Project (http://www.genoscope.cns.fr/cgibin/blast server/projetML/blast-info.pl) was also carried out using the HMM (Hidden Markov Model) for the CHS/STS active site obtained from Prosite (PS00441; http://expasy.org/prosite/; Sigrist et al., 2010). An e-value of 1e-3 was set to avoid false positives. To further increase the extent of the database search results, tBLASTN search of the genome sequence was also performed in an attempt to capture VvSTS members that might have been missed in the GAZE and JIGSAW predictions and not included in the grapevine proteome database. Sequences were edited and analysed using Vector NTI suite 9.0 and gene structure was deduced from Genoscope gene annotation or from manual annotation based on the genomic sequences provided by Genoscope and comparison with the corresponding EST and deduced protein sequences for paralogous VvSTS genes. The chromosomal location of VvSTS genes was deduced using the BLAT server and additional physical localization tools at the Genoscope Genome Browser. Scaling chromosomes according to the position of the loci was performed to graphically represent the physical chromosomal locations of STS genes. Gaps in the sequence of three predictions obtained from the 12X V1 assembly (JGVv100.34, JGVv100.35 and JGVv10.47) were completed by analysing the information available from the IASMA sequencing project at the NCBI database server (Velasco et al., 2007).

73

3.2.2 Phylogeny reconstruction and bootstrap analysis Phylogenetic and evolutionary analyses were performed using MEGA version 5.0 (Tamura et al., 2007). The complete predicted amino acid sequences of VvSTS genes were aligned using the BLOSUM matrix of the ClustalW algorithm-based AlignX module from the Vector NTI Suite 9.0. The phylogenetic tree was constructed using the Neighbour Joining Tree Method in MEGA v5. Reliability of the tree obtained was tested using bootstrapping with 1000 replicates. Resulting trees were edited and modified using Treedyn software (http://www.treedyn.org/).

3.2.3 Southern blot analysis for STS members DNA was extracted from approximately 2 g of fresh young leaves of V. vinifera cv. Pinot noir using the Doyle and Doyle (1987) method. Approximately 5 μg of genomic DNA for each reaction was digested with three different endonucleases: two rare cutter restriction enzymes EcoRI and HindIII, and the frequent cutter AluI. All digestions were performed over night at 37 °C. Digested DNA was separated by electrophoresis on an agarose gel then transferred to a Nylon membrane according to Sambrook and Russell (1989). The 206 bp probe used for hybridization, was designed to a region characterized by a high conservation amongst all VvSTS gene sequences and was amplified from Pinot noir genomic DNA using primers VvSTSpFw and VvSTSpRev (Table 2.3). Labelling of the probe was performed by normal PCR using The DIG system for filter hybridization (Roche) protocol. Pre-hybridization and hybridization steps were performed at 65 °C to increase the stringency of reaction and the specificity of the signal.

3.2.4 mRNA-seq samples preparation and sequencing For mRNA-seq analysis, leaf discs (15 mm diameter) were punched from healthy leaves detached from V. vinifera cv. Pinot noir glasshouse-grown vines. Discs were randomly selected from the third/forth leaves collected from different vines, treated with abiotic and biotic stresses as described below and incubated upside down on moist 3MM filter paper in large Petri dishes. Punching of discs was considered as a wounding treatment per se, and as a control for other treatments. The UV-C treatment was achieved by exposing

74

the abaxial surface of the discs to 30W UV-C light for 10 mins at a distance of 10 cm. Downy mildew infection was carried out spraying a solution containing downy mildew sporangia at concentration of 105 sporangia ml-1 (Section 2.1.5). Pinot noir leaf discs were sampled at 0, 24 and 48 h after each treatment and total RNA extracted as indicated in Section 2.2.14. RNA samples obtained from different plants were pooled, and retrotranscribed as indicated in section 2.2.16. In a first screening the general induction of VvSTS gene family was evaluated using a degenerate approach. Degenerate oligonucleotides VvSTSdegF and VvSTSdegR were designed by CODEHOP software (Consensus-Degenerate

Hybrid

Oligonucleotide

Primers)

(Rose

et

al.,

1999;

http://bioinformatics.weizmann.ax.il/ blocks/codehop.html) to be sure we obtained desired induction in studied genes. Subsequently, 5 μg of the same RNA pools used for the degenerate PCRs were sent to the Institute of Applied Genomic (IGA, Udine, Italy) for mRNA-seq library preparation and Illumina sequencing. Each library had an insert size of 200bp, and 36 to 39 bp paired ends reads were generated on an Illumina genome analyzer IIx (GAIIx).

3.2.5 Alignment and analysis of Illumina reads against the V. vinifera genome Paired end reads obtained by Illumina mRNA-seq sequencing were aligned using both the 8.4X and 12X V1 coverage assembly of the PN40024 genotype sequence. Alignment of reads against the 8.4X reference genome assembly was carried out using CLC Genomic Workbench software (http://www.clcbio.com) provided by CLC bio (Katrinebjerg, Denmark) at the Institute of Applied Genomics (IGA, Udine, Italy). Sequence alignment against the 12X V1 coverage was kindly performed by Dr. Alberto Ferrarini (University of Verona, Italy) with ELAND, an un-gapped alignment software package, which is part of the Illumina pipeline version 1.32. In both the alignments a maximum of two mismatches per read was set and, for an accurate measurement of gene expression, both unique reads and reads that occur up to ten times were included, to avoid underestimating the number of genes with closely related paralogues such as VvSTS.

75

3.2.6 Differentia D al gene expressio e on analysis Thee evaluationn of gene expression e w perform was med on thee mRNA-seeq data obttained from thee 8.4X and the 12X V1 coverage respectivelly with CLC C Genomicc workbench h and ERANG GE 3.1 proggrams (http://woldlab.ccaltech.edu//RNA-seq; Mortazavi et al., 2008 8). In both casses, the trannscriptional activity of each gene was definedd as the num mber of maapped reads per kilobase of o exon per million mappped reads (RPKM).

Bothh programs compute thhe normalizzed gene loccus expressiion level byy assigning reads to their site s of origiin and counnting them. In I the case of reads thaat match equually in mu ultiple loci, they are distribbuted propoortionally too the weigh ht of expression level ggiven by speecific single-m matching reaads. This means that iff there are 10 reads thaat match twoo different genes g with equual exon lenngth, the twoo reads willl be distribu uted accordiing to the nnumber of un nique matches for these tw wo genes. The T gene thhat has the highest h num mber of uniqque matchess will thus get a greater prroportion off the 10 reaads. If a read d has more hits than sppecified with h this m number of hits settting, it willl be ignored d. Expressioon values w were graphiically maximum represennted

by

mean

of

Mevv,

Multi

Experim ment

Vieewer

soft ftware

(http://w www.tm4.orrg/mev/; Saeeed et al., 20006).

3.2.7 Analysis A o a gene of e express sion atlas of V. vin nifera cv. Corvina develo opment Thee expressionn patterns of o VvSTS geenes predictted from thhe analysis oof the grapevine genome releases was w analyzed in a gllobal V. viinifera cv. Corvina ((clone 48) gene expression atlas of different orrgans at varrious develo opmental sttages. Microoarray data were kindly provided p froom Prof. Maario Pezzottti (Universitty of Veronna, Italy). Saampling enttailed the colleection of 166 organs, split in differeent stages of o developm ment. Buds w were collectted at five diffferent stagess, from dorrmancy to bud b burst. The T prompt bud splits iinto three laateral buds to form leavees together with eitheer a tendril or infloresscence. Theese organs were collectedd at three sttages of devvelopment for f leaves and a tendrils,, and four fo for infloresccence.

76

Flowers were collected as anthers, pollen, carpels and petals. Berries were sampled during five stages of development from fruit set to full maturity at harvest. After harvest, when berries undergo withering, sampling was carried out after the first, second and third months of this withering phase. Multiple tissues were collected at each berry stage: skin, flesh and seed, to further investigate the features of this organ. Rachis tissue was also collected at the same five stages of berry development. Stems were collected at both the green and woody stage of the cane. Some tissues like roots and seedling were collected from grapevines cultivated in vitro. In all a total, this project involved the hybridization of 162 samples (including biological replicates). Data were expressed graphically by means of Mev (Multi Experiment Viewer) software (http://www.tm4.org/mev/; Saeed et al., 2006).

77

3.3

Results

3.3.1 Identification, annotation and chromosomal distribution of grapevine STS genes The genome sequence of the near-homozygous PN40024 genotype of V. vinifera cv. Pinot noir was searched for predicted STS gene sequences. These were predicted on the genome draft by combining ab initio models together with V. vinifera complementary DNA sequences, such as EST databases and alignment of gene/protein models from other species (Jaillon et al., 2007). The Hidden Markov model (H.M.M) for CHS/STS active site was obtained from PROSITE (PS00441; http://expasy.org/prosite) and used in a BLASTP search against the 8.4X, 12X V0 and 12X V1 proteome databases. In order to extend the search to identify putative gene family members not predicted by the GAZE and JIGSAW software programs, a tBLASTX search of the H.M.M and of the entire amino acidic sequence of previously identified VvSTS was also performed against the genome sequence. Three predictions carrying the H.M.M. for CHS/STS active site but representing chalcone synthase genes were excluded from further analyses leaving a total of forty-one predicted VvSTS gene sequences. Although the Genoscope integrated method for deducing proteins is very exhaustive, some gene annotations were found to be incorrect based in available EST sequences. In these cases the proposed gene structure was deduced by comparison between the genomic sequence and EST or alignment with paralogous VvSTS genes. In particular, and referring to the 12 X V1 coverage assembly, predictions designated as JGVv42.61, JGVv41.62 and JGVv42.63, are listed as three different genes in the proteome database, but they effectively represent a single unique VvSTS gene (Table 3.1). The same observation was made for gene prediction JGVv42.65 and JGVv42.66. Three genes, corresponding to predictions JGVv100.47,

JGVv100.35

and

JGVv100.34

were

complemented by analysing corresponding sequence from the PN ENTAV 115 genome because of gaps in the French-Italian assembly. Further analysis of the amino acid and nucleotide sequences performed using Vector NTI Suite 9 software led to the exclusion of several sequences that were considered as non-processed pseudogenes (or duplicated pseudogenes), which most probably originated from duplication of functional STS genes, but contained mutations introducing premature stop codons or frame-shifts that results in

78

loss of the fuunctional acctive site. These preedictions arre designattes as JGV Vv42.64, GVv100.46 and JGVv100.34 and d the gene resulting r froom JGVv42 2.65 plus JGVvv100.51, JG JGvvv42.66 in thhe 12X V1 assembly coverage. c With W the excclusion of tthese non-fu unctional gene sequence predictions, p a total of 36 3 predicted d VvSTS gene sequennces remaineed which weree designed VvSTS1 too VvSTS36 based on their chrom mosomal poosition (Taable 3.1). VvST TS1-4 are loocated in a region of approximaately 90 Kbb on chrom mosome 10, whereas VvST TS5-36 are located l in a region of 500 5 Kb in th he chromosoome 16 (Figgure 3.1).

Figu ure 3.1 - Chhromosomall clustering of VvSTS genes g in grapevine. Sccaling chrom mosomes accorrding to thee position of o the loci was perform med to grapphically reppresent the physical chrom mosomal loocations of VvSTS genees. All mem mbers belongging to the family B1 (VvSTS1( VvST TS4) are loccated in chrr10 (yellow w rectangle) while all other o membbers (familiees A and B2) are a located on chr16.

79

The genomic sequence of VvSTS genes ranges in size from a minimum length of 1315 nt (VvSTS9) to a maximum of 1566 nt (VvSTS1) depending on the length of the unique intron positioned within the triplet coding for Cys-60, as previously observed by Schröder et al. (1988). The VvSTS genes encode proteins ranging in size from 390 to 392 amino acids. Three of the VvSTS genes appear to encode truncated proteins: VvSTS1, which has a stop codon at amino acid position 234, VvSTS2 which has a stop codon at amino acid position 367 and VvSTS12, which has a stop codon at the position 185. In each case, the truncated protein still contains the conserved CHS/STS active site domain, and as such, may still be a functional protein and was kept as a part of the 36 predicted VvSTS gene sequences.

3.3.2 Phylogenetic analyses of the predicted VvSTS proteins In order to examine the phylogenetic relationships between the predicted VvSTS proteins a phylogenetic tree was constructed. The deduced amino acid sequences of the VvSTS genes were aligned using the BLOSUM matrix using the ClustalW algorithm-based AlignX module from Vector NTI Suite 9.0. The amino acidic sequence of a grape chalcone synthase (VvCHS) was used as out-group. Figure 3.2 shows that the VvSTS proteins cluster into 3 sub-families which have been designated group A, B1 and B2. Group A is composed of a group of genes located on chromosome 16 and appear to be the closest to the VvCHS protein in terms of sequence homology. Group B is comprised of two subgroups: B1, which is composed entirely of members located on chromosome 10 (i.e. VvSTS1-VvSTS4) and B2, which comprises the remaining VvSTS gene members located on chromosome 16.

80

Table 3.1 - All STS members identified basing on the 8.4X, 12X V0 and 12X V1 are reported. Genes have been named from VvSTS1 to VvSTS36 basing on chromosomal location. Corresponding identifier on the 8.4X, 12X V0 and 12X V1 are reported. Chromosome location and gene length are also indicated.

Gene

Locus Tag 8X

Locus Tag 12X V0

Chr

Chr location

lenght

10

14216112..14217677

1566bp

-

Locus Tag 12X V1 JGVv42.61 JGVv42.62 JGVv42.63 JGVv42.68

VvSTS 1

GSVIVT00031872001

GSVIVG00026213001

VvSTS 2

GSVIVT00031880001

VvSTS 3

GSVIVT00031883001

10

14284187..14285750

1564bp

-

JGVv42.69

10

14298957..14300520

1564bp

VvSTS 4

GSVIVT00031885001

VvSTS 5

GSVIVT00007364001

GSVIVG00026222001

JGVv42.70

10

14304787..14306350

1564bp

GSVIVG00010591001

JGVv100.52

16

16239028..16240564

VvSTS 6

1537bp

GSVIVT00007358001

GSVIVG00010590001

JGVv100.50

16

16268816..16270352

1537bp

VvSTS 7

GSVIVT00007357001

GSVIVG00010589001

JGVv100.49

16

16276570..16278105

1536bp

VvSTS 8

GSVIVT00007355001

JGVv100.47

16

16287924..16286955

1315bp

VvSTS 9

-

-

JGVv100.45

16

16335697..16337233

1537bp

VvSTS 10

-

GSVIVG00010585001

JGVv100.44

16

16344516..16343202

1315bp

VvSTS 11

-

GSVIVG00010584001

JGVv100.43

16

16347949..16346580

1370bp

VvSTS 12

GSVIVT00007353001

GSVIVG00010583001

JGVv100.42

16

16351428..16350059

1370bp

VvSTS 13

GSVIVT00004049001

GSVIVG00010582001

JGVv100.41

16

16368410..16366907

1504bp

VvSTS 14

GSVIVT00005194001

-

JGVv100.40

16

16387529..16386013

1517bp

VvSTS 15

GSVIVT00007779001

JGVv100.39

16

16398234..16399770

1537bp

VvSTS 16

-

GSVIVG00010580001

JGVv100.38

16

16406519..16405205

1315bp

VvSTS 17

-

GSVIVG00010579001

JGVV100.37

16

16409837..16408469

1369bp

JGVv100.35

16

16431392..16430833

1529bp

GSVIVT00004050001

GSVIVG00010578001

JGVv100.36

16

16413317..16411948

1370bp

VvSTS 18 VvSTS 19 VvSTS 20

GSVIVT00004047001

-

JGVv100.33

16

16468549..16467017

1533bp

VvSTS 21

GSVIVT00008256001

-

JGVv100.32

16

16478613..16477097

1517bp

VvSTS 22

GSVIVT00008253001

-

JGVv100.31

16

16493131..16491599

1535bp

VvSTS 23

GSVIVT00009243001

-

JGVv100.30

16

16505168..16503636

1533bp

VvSTS 24

GSVIVT00009242001

-

JGVv100.29

16

16509479..16507944

1538bp

VvSTS 25

GSVIVT00009241001

GSVIVG00010572001

JGVv100.28

16

16511216..16512602

1384bp

VvSTS 26

GSVIVT00009238001

GSVIVG00010568001

JGVV100.25

16

16527862..16526328

1535bp

VvSTS 27

GSVIVT00009234001

GSVIVG00010565001

JGVv100.22

16

16557435..16555945

1491bp

VvSTS 28

GSVIVT00009232001

GSVIVG00010563001

JGVv100.21

16

16588984..16587449

1536bp

VvSTS 29

GSVIVT00009228001

-

JGVv100.20

16

16617258..16615702

1557bp

VvSTS 30

GSVIVT00009226001

-

JGVv100.19

16

16624624..16623088

1537bp

VvSTS 31

GSVIVT00009225001

GSVIVG00010561001

JGVv100.18

16

16629091..16627538

1556bp

VvSTS 32

GSVIVT00009223001

-

JGVv100.17

16

16645747..16644192

1558bp

VvSTS 33

-

GSVIVG00010557001

JGVv100.16

16

16675524..16673988

1539bp

VvSTS 34

GSVIVT00009221001

GSVIVG00010556001

JGVv100.15

16

16684264..16682711

1556bp

VvSTS 35

-

GSVIVG00010554001

JGVv100.13

16

16699842..16698305

1540bp

VvSTS 36

GSVIVT00009216001

-

JGVv100.12

16

16711818..16710283

1538bp

81

Figure 3.2 - Phylogenetic trree of preddicted STS proteins inn grapevinee. The treee was generateed after seqquence alignnment withh clustalW using the Neighbour N joining meethod. Reliabiliity of the obtained tree t was teested using bootstrappping with 1000 repliccates. Differennt backgrounnd colours indicate i thrree main sub bfamilies. VvCHS V (chalcone syntthase) was usedd as out-grooup.

82

3.3.3 Southern blot analysis of the VvSTS gene family To complement and complete the genomic analysis of entire VvSTS gene family and to clarify which genome predictions (i.e. Those predicted from the PN40024 or PN ENTAV 115 genome sequences) are more accurate in terms of number of family members, a Southern blot analysis was performed to estimate the copy number of VvSTS genes. The aim of this analysis was two-fold. Firstly, to confirm with a molecular approach the abundance of VvSTS genes in grapevine, as previously carried out by Sparvoli et al., (1994) but with a more detailed knowledge of the VvSTS gene sequences based on the genome sequence analysis. Secondly, to determine which of the two grape genome sequences most accurately predicted the number of VvSTS genes. Genomic DNA from V. vinifera cv. Pinot noir was digested with three different restriction enzymes (EcoRI, HindIII and AluI), and, after transfer to a nylon membrane, was hybridized with a 206 bp probe designed to a highly conserved region obtained from the alignment of all VvSTS gene sequences predicted from the 8.4X assembly coverage of the PN40024 genotype. The choice to design the probe based on predictions obtained with the French-Italian genome sequence rather than the IASMA sequence is due to the will to work rounding up rather than rounding down, considering in the alignment also members eventually overestimated rather than leaving out some others. Figure 3.3 shows that probing grape genomic DNA with the VvSTS probe results in a complex hybridization pattern with multiple bands in all three lanes corresponding to different digestions. Up to 23 individual hybridizing bands were observed in the lane corresponding to DNA digested with HindIII. Several bands showed a higher signal compared to other ones, which could be due to the presence of multiple hybridizing bands of similar size. These results more closely support the number of predicted VvSTS gene family members based on the analysis of the PN40024 genome sequence rather than the significantly lower number of VvSTS genes predicted from the analysis of the PN ENTAV 115 genome sequence.

83

Figure 3.3 – Southern blot analysis of genomic DNA (Pinot noir) digested with three different restriction enzymes. The blots were hybridized with a probe designed in a high conserved region of identified VvSTS. Arrows indicate detected bands.

84

3.3.4 Expression analysis of the VvSTS gene family 3.3.4.1 mRNA-seq analysis of stress-induced expression The expression pattern of all 36 VvSTS gene sequences predicted in the PN40024 genome sequence was investigated under biotic and abiotic stress conditions. In order to overcome the difficulty posed by the high sequence conservation between these genes, which makes it difficult to clearly discriminate between individual members using PCRbased expression analyses, we performed an mRNA-seq analysis using Next Generation Sequencing (NGS) technology. Leaf discs obtained from V. vinifera cv. Pinot noir were collected at 0, 24 and 48 h after wounding, UV-C exposure and infection with P. viticola. Seven pools of RNA samples, representing each treatment and the control sample, which was common for the three treatments, were used to build libraries for high-throughput parallel sequencing using an Illumina genome analyser IIx (GAIIx). A total of 325,519,708 sequence reads were generated, each 36 to 39 bp in length. Each treatment was represented at least by 32 millions reads, a tag density sufficient for quantitative analysis of gene expression (Morin et al., 2008; Zenoni et al., 2010). The sequence reads were aligned on the PN40024 reference genome (Jaillon et al., 2007). The alignment was performed on the 8.4X assembly coverage of the genome, as the predictions for VvSTSs were found to be more accurate in this release of the genome sequence than in the 12X V0 prediction. The alignment was performed by CLC Genomic Workbench software program set to allow two base mismatches and a maximum of ten multiple matching for each reads. Subsequently the alignment was performed also in the 12X V1 assembly coverage, provided later, using the ELAND software. Table 3.2 summarises the results of the analysis using the PN40024 8.4X sequence as the reference genome. It should be noted that the data shown for the VvSTS gene family were produced by alignment with the 12X V1 reference genome, while data shown in Chapter 4 of the R2R3-MYB gene family were obtained by alignment of the NGS output with the 8.4X coverage as genome-wide analysis of the R2R3-MYB gene family was previously performed by Matus et al. (2009) on this release. The primary goal of this transcriptome sequencing was to compare VvSTS gene expression levels in different samples treated with different stresses. For robust conclusions about biological differences among samples is important to utilize biological replicates. Unfortunately, due to the high cost of RNA-seq the analysis was limited to single biological samples consisting of RNA

85

isolated from pooled tissues from different plants. Nevertheless, this analysis provided preliminary data on the behaviour of stilbene synthase genes and other gene families (see Chapter 4) from which selected gene members were selected for more detailed validation by quantitative RT-PCR. Figure 3.4 shows a graphical representation of the expression pattern of all VvSTS genes in response to the three stress treatments. A general analysis of the expression data across all treatments indicated that of the three stress treatments, UV-C exposure leads to the highest induction of VvSTS gene members, followed by downy mildew infection and wounding. Similarly Borie et al. (2004), comparing the level of expression of VvSTSs in response to abiotic (UV-C exposure and chemical treatment) and a biotic (B. cinerea infection) stresses using Northern blot analysis, also found the largest and fastest response upon UV-C treatment. The low level of induction detected in downy mildew infected discs could be due to the fact that the specific VvSTS response to the pathogen attack take place later, therefore the response observed within 48 h represents mainly a wound-induced response rather than a response to the pathogen, as confirmed by specific quantitative RT-PCR analyses illustrated in Chapter 4. On the contrary, the UV-C light response is much faster (Borie et al., 2004) and led to a massive increase in the VvSTS accumulation within 24 h.

Table 3.2 - Summary of read number obtained by alignment of NGS reads on the 8.4X assembly coverage of the PN40024 genome using CLC software.

Mapped reads - uniquely - non-specifically Unmapped reads Total reads

86

Control

Wound 24h

Wound 48h

Downy 24h

Downy 48h

UV-C 24h

UV-C 48h

36,147,892 16,140,214 20,007,678 6,194,462 42,342,354

40,994,305 19,275,370 21,718,935 9,755,257 50,749,562

41,599,106 19,306,248 22,292,858 12,184,922 53,784,028

27,707,019 13,244,978 14,462,041 8,844,257 36,551,276

21,973,861 10,351,827 11,622,034 10,654,633 32,628,494

44,705,460 20,517,648 24,187,812 13,711,920 58,417,380

38,576,545 17,583,614 20,992,931 12,470,069 51,046,614

E i images of thhe completee VvSTS geene family. The treatm ments Fiigure 3.4 Expression (w wounding, exposure to t UV-C and downy y mildew infection) are displaayed veertically abbove each column. Genes are displayed d too the rightt of each row. r Exxpression data d are exppressed as thhe number of mapped reads per K Kb of exon n per m million mappped reads (R RPKM).

87

Figure 3..5 Expressiion represenntation of the t complete VvSTS gene g familiees. The treeatments (woundingg, exposuree to UV-C and downyy mildew infection) i a considerred separattely and are displayed vertically above eacch column. Genes are displayedd to the riight of eacch row. Expressioon data are expressed e inn million off reads per kb k (RPKM) and are orddered basing g on the level of expression. e A: Woundded samplees; B: UV-C exposed samples; C: downy mildew infected samples.

Figure 3.5 3 shows thhe pattern off expressionn of VvSTS genes in ressponse to thhe three diffferent stress treeatments orrganised in terms of siize of inducction from lowest l to hiighest. Notee that the relative expressiion scale off each panell (i.e. stress)) in Figure 3.5 is differrent based on o the minimum m and maxiimum expreession valuee of each paarticular treaatment. Thiis graphical view is usefull for comparring the indduction of eaach memberr upon the three t differeent stresses.. The results indicated i thhat the mosst responsivvee VvSTS genes are the t same inn all treatm ments, despite with differrent degrees of intenssity. These gene mem mbers are thhose locateed on chromossome 16 andd belongingg to the B2 subgroup (F Figure 3.2). In particullar, VvSTS36 and

88

VvSTS7 were found to be the most highly expressed members in all treatments examined, with RPKM values approaching 100 upon wounding, 200 in downy mildew-infected discs and approaching 1900 (approximately 15 fold increase) in expression UV-C treated discs within 24 h after treatment. VvSTS genes belonging to the subgroup A, together with those belonging to subgroup B1 (Figure 3.2) did not respond to stresses with the same intensity of members of the B2 subgroup. Thus, members belonging to the A subgroup showed an induction at 24 h after UV-C treatment (the time point leading to the strongest VvSTS induction) ranging from a minimum RPKM value of approximately 10 (VvSTS11) to the maximum one 300 (VvSTS12). Induction of VvSTS gene members belonging to the subgroup B1 was even lower. Despite a low induction ranging between approximately 10 and 120 RPKM was detectable in samples treated with UV-C radiation, no significant changes in RPKM values were observed in wounded or infected samples. Another interesting observation from this data is that B1 subgroup members were the only VvSTS genes showing a low but significant level of constitutive expression. Within the B1 subgroup VvSTS3 was the most highly expressed gene in the control sample with an RPKM value close to 100, whereas VvSTS2 did not show any significant expression. A lower but still detectable expression in unstressed leaf discs was detectable for several members belonging to the A subgroup, but no constitutive expression was detected for those members belonging to the B2 subgroup.

89

3.3.4.2 Microarray analysis of the VvSTS expression during grapevine development and post-harvest berry withering In order to complement and extend the VvSTS expression profile obtained by mRNAseq analysis of biotic and abiotic stressed leaf discs, a study of the temporal and spatial expression of the whole VvSTS family was performed. The expression patterns of VvSTS genes predicted from the analysis of the grapevine genome releases were analysed in a global V. vinifera cv. Corvina (clone 48) gene expression atlas of different organs at various developmental stages. Microarray data were kindly provided from Prof. Mario Pezzotti (University of Verona, Italy). The grapevine expression atlas was generated using a microarray technology developed by Roche-NimbleGen 12x135K, which enables hybridization of up to 12 independent samples on a single slide and is based on gene prediction obtained from the 12X V1 coverage assembly of the PN40024 genotype. Numerous tissues at different developmental stages were analysed and are indicated in Table 3.3. Buds were collected at five different stages, from dormancy to bud burst. The prompt bud splits into three lateral buds to form leaves together with either a tendril or inflorescence. These organs were collected at three stages of development for leaves and tendrils, and four for inflorescence. Flowers were collected as anthers, pollen, carpels and petals. Berries were sampled during five stages of development from fruit set to full maturity at harvest. Multiple tissues were collected at each berry stage: skin, flesh and seed, to further investigate the features of this organ. Rachis tissue was also collected at the same five stages of berry development. Stems were collected at both the green and woody stage of the cane. Some tissues like roots and seedling were collected from grapevines cultivated in vitro. The expression profiles of VvSTS genes were obtained by expression data previously analysed by Dr. Marianna Fasoli (University di Verona, Italy) and adjusted by MeV software (http://www.tm4.org/mev/; Saeed et al., 2006) using the “Mean center genes/rows” tool, which normalise each gene expression value by the mean of values of the same gene in all samples analysed.

90

Table 3.3 – Organs and tissues utilised in the microarray analysis with the relative number of temporal or developmental stages. Sample/organ Anther Berry Berry flesh Berry skin Bud Carpel Inflorescence Leaf Petal Pollen Rachis Root (“in vitro”) Seed Seedling Stem Tendril Total

Number of developmental stages collected pool 8 7 7 5 pool 4 3 pool pool 5 pool 4 pool 2 3 54

Figure 3.6 shows a graphical representation of the expression pattern of each predicted VvSTS gene obtained with the same software. Interestingly, results did not show an significant increase in the VvSTS expression in berry during both veràison and ripening stages, in contrast with previously reported data, which had showed that healthy grape berries synthetise stilbenes compounds under natural environmental conditions (Versari et al., 2001; Burns et al., 2002; Hall and De Luca, 2007; Gatto et al., 2008). Nevertheless, the level of stilbenes probably represents the grape response to soil composition and climate and appeared to be cultivar specific (Burns et al., 2002, Landrault et al., 2002), so it could be argued that the V. vinifera cv. Corvina doesn’t accumulate high levels of stilbenes and VvSTS transcripts in grape berries during berry natural developmental stages. According to this result, Versari et al., (2001), measuring the changes of phenolic compounds in V. vinifera cv. Corvina berry skin during the developmental phases, were not able to detect any amount of resveratrol during véraison phase and detected only a very low concentration (1.5 μg/g) at the ripening stage.

91

Figure 3.6 - Expression im mages of the complete VvSTS gene g family. Diffferent organs/tissues are displaayed vertically aabove each colum mn. Genes are diisplayed to the right of each ro ow. Expression data d are normalised basing on the t mean expresssion value of eaach gene in all ttissues/organs an nalysed. Samplees collected from m berries underg going withering are indicated byy the “phw” exteension. 92

In contrast, an important increase in VvSTS transcript level was detected in leaves, particularly at the senescence stage, in roots propagated in vitro and in all stages of the rachis development, with the highest transcript level corresponding to the ripening phase. The expression at the level of roots is in accordance with the detection of high levels of oligostilbenes in this organ (Korhammer et al., 1995). Moreover, the propagation of this organ in vitro is an artificial procedure that could represents a stress for plant, leading to an induction of stress-associated genes such as STSs. On the contrary, expression of VvSTS genes in leaves is quite surprising and it appears to be restricted to the members belonging to the sub-families A and B1 in young stages, with the highest transcript accumulation for those members belonging to the sub-family B1 (VvSTS1-4), as previously observed in mRNA-seq analysis of stressed tissues (control sample; section 3.3.4). Passing from the young-leaf stage to senescence stage also members belonging to the A sub-family increased their expression and finally, in the senescent leaf, almost all predicted VvSTS members appeared to be induced. It would be tempted to suggest that also the VvSTS induction detected in senescent leaf should be considered as a stress-induced response rather than a natural accumulation of VvSTS transcript. During senescence leaf are subjected to a range of dramatic events, such as attack by pathogens, wounding and accumulation of ROS, that could be related to the induction of stress-induced defence genes. The V. vinifera cv. Corvina gene expression atlas also included a set of samples collected after berry harvest, during the process of berry “withering” which is a drying process used in the production of dessert and fortified wines to alter must quality characteristics and increase the concentration of simple sugars. Sampling was carried out after the first, second and third month of this withering phase. Results obtained from the expression atlas of V. vinifera cv. Corvina clearly showed there is a remarkable induction of the majority of VvSTS genes in the berry at all withering phases. This organ appears to accumulate VvSTS transcripts within the exocarp tissue, whereas the expression is lower at the level of the flesh.

93

3.4 Discussion To date, STS genes have been isolated from several plant species including peanut, sorghum, pine and grapevine (Morales et al., 2000). In the majority of plants species STS genes appear to be organized in multigenic families composed of two, three or five members. Grapevine is predicted to posses a much higher number of STS genes, ranging from a minimum of 21 members, based on the genome sequence obtained from the PN ENTAV 115 genotype (Velasco et al., 2007) to a maximum of 43 members based on the 8.4X assembly coverage of the PN40024 genotype provided by the French-Italian Consortium (Jaillon et al., 2007). The general aims of this chapter were (a) the characterization of the grapevine STS gene family commencing with the identification, annotation and phylogenetic analysis of all family members, and (b) the transcriptional analysis of the whole STS family in grapevine in response to biotic and abiotic stress conditions and in unstressed healthy tissues at different developmental stages (in collaboration with the University of Verona). The search for STS genes in the grapevine genome of the homozygous PN40024 genotype of V. vinifera cv. Pinot noir allowed the identification of 36 genes belonging to this family. Sequences lacking the CHS/STS active site, which contains a conserved cysteine essential for the binding of p-coumaroyl-CoA and for the functionality of both CHS and STS (Lanz et al., 1991), were not included in this analysis as they were considered to be nonfunctional. Predicted genes were designated VvSTS1 to VvSTS36 based on their chromosomal position (Table 3.1), with genes VvSTS1-4 located in a region of approximately 90 Kb on chromosome 10, and genes VvSTS5-36 located in a region of 500 Kb in the chromosome 16 (Figure 3.1). A Southern blot approach coupled to this genomewide analysis confirmed the abundance of STS genes in grapevine and also verifyied that the grapevine genome sequence obtained from the PN40024 genotype by the French-Italian consortium most accurately predicted the number of VvSTS genes (Figure 3.2). A Southern blot analysis had been previously carried out by Sparvoli et al. (1994) but without a detailed knowledge of the VvSTS gene sequences based on the genome draft sequence analysis. The genomic sequence of VvSTS genes ranged in size from a minimum length of 1315 nt (VvSTS9) to a maximum of 1566 nt (VvSTS1) depending on the length of the unique intron positioned within the triplet coding for Cys-60, as previously observed by Schröder et al.

94

(1988). The majority of VvSTS genes were found to encode proteins of 392 amino acids in length, apart from VvSTS25 and VvSTS18, lacking respectively one and two amino acids and 3 truncated VvSTS proteins corresponding to VvSTS1, with stop codon at amino acid position 234, VvSTS2 with a stop codon at amino acid position 367 and VvSTS12, with a stop codon at the position 185. The C-terminus of both STS and CHS is important for their catalytic activities because it contains some highly conserved amino acid residues (Jez et al., 2000; Suh et al., 2000a, 2000b). Kodan et al. (2001) comparing the enzymological properties of three STS (PdSTS1, PsSTS2 and PdSTS3) and one CHS (PsCHSX) from P. densiflora observed that PdSTS3, which has a frameshift mutation leading to a premature stop codon presents a functional divergence compared to the other to full-length STSs. In particular, the PdSTS3 protein showed poor solubility compared to PdSTS2, but despite being truncated, it still showed a high potential for pinsylvin production. Furthermore, neither pinosylvin nor pinocembrin inhibited the PsSTS3 activity in vitro, whereas they effectively inhibited PsSTS2 and PdCHSX. Kodan et al. (2001) hypothesized that the STS gene family in pine comprises a mixture of fully active and inactive members and, amongst active ones, different STS isoenzymes could exhibit distinct catalytic activities with different product inhibition. PdSTS3, in particular, has an increased biosynthetic activity and it appears to have lost inhibitory function. Something similar could be argued for the grapevine STS gene family, considering its large size in terms of number of gene members and the existence of the trouncated forms such as VvSTS1, VvSTS2 and VvSTS12. Sequence alignment and phylogenetic tree analysis using the full predicted protein sequences (Figure 3.2) revealed the existence of 3 subgroups, designated A, B1 and B2. Group A is composed of genes located on chromosome 16 and appear to be the closest in sequence homology to the VvCHS protein used as out-group in this analysis. Group B is comprised of two subgroups: B1, which is composed entirely of members located on chromosome 10 (i.e. VvSTS1-VvSTS4) and B2, which comprises the remaining VvSTS gene members located on chromosome 16. The majority of previous studies on the accumulation of stilbene compounds and expression of their biosynthetic genes performed on peanut and grapevine tissues, indicates that these genes are highly inducible in response to a number of biotic and abiotic stresses including mechanical damage (Chiron et al., 2000; Pezet et al., 2003), UV-C light

95

irradiation (Adrian et al. 2000; Wang et al. 2010), treatments with chemicals such as aluminium ions, cyclodextrins and ozone (Rosemann, 1991; Adrian et al., 1996; Zamboni et al., 2009) and the application of plant hormones such as ethylene and jasmonates (Belhadj, 2008a; Belhadj, 2008b). Although these studies provided an important contribution to the knowledge of the behaviour of stilbene biosynthetic genes, the lack of detailed knowledge of the STS-family size and of the strong sequence conservation amongst its members, led to the production of data that should now be reconsidered based on these new information. In particular, expression analyses based on conventional PCR techniques based on amplification with primers designed to cloned STS genes, may not accurately reflect the real patterns of a single unique member, because of the nonspecificity of the primers. Indeed, when the actual nucleotide sequences of predicted VvSTS members isolated in this project are compared with the primers sequences designed to STS “consensus” sequences or on sequences deposited at the NCBI that were utilized in previous publications, it’s clear that these primer sequences would not have been genespecific. Moreover, numerous studies have been performed using generic expression analyses such as Northern blot experiments, which provided a useful description of the general behaviour of the STS gene family, but does not provide any information about the specific pattern of each single member. The challenge of our investigation was to look at the expression pattern of each single gene member of the grapevine STS family in response to different biotic and abiotic stresses. The fact that VvSTS transcripts accumulate in response to a wide range of different elicitors, together with the observation that the kinetics of accumulation are, in some cases, characterized by a multiphasic induction (Borie et al., 2004; Liswidowati et al., 1991; Wiese et al., 1994), raises questions regarding the behaviour of individual VvSTS genes to the different stresses and whether different groups of VvSTS are characterized by similar expression patterns. To overcome the high VvSTS sequence conservation, which makes it difficult to investigate the transcription of individual VvSTS genes by conventional PCR-based thecniques, an mRNA-seq approach was utilised. This NGS Illumina technology is based on the wholetranscriptome sequencing and, given an annotated reference genome, allows screening the transcript accumulation of ach single prediction in the genome. The pattern of induction of all predicted genes belonging to the VvSTS family in response to mechanical wounding,

96

UV-C exposure and downy mildew (P. viticola) infection was studied in V. vinifera cv. Pinot Noir leaf discs at 0, 24 and 48 h after application of the stress treatments. A first, interesting consideration looking at the expression of VvSTS genes in the un-treated control samples is the fact that basal constitutive accumulation of transcript in grapevine tissues, appeared to be restricted to the B1 subgroup members which are located in the chromosome 10. Interestingly, members belonging to this subgroup also showed little or no induction in response to the three stress treatments applied. In fact, although a low level induction of VvSTS gene members belonging to subgroup B1 was still detectable UV-C treated samples, no significant changes in RPKM values were observed in wounded or downy-mildew infected samples. In contrast, a lower but still detectable constitutive expression was detected for several members subgroup A members, while no expression at all was observed for members of the subgroup B2. In terms of stress-induced expression (Figure 3.5), the results indicat that among the three stress treatments examined, UV-C exposure resulted in the highest VvSTS induction, followed by downy mildew (P. viticola) infection and wounding, confirming previously observations (Borie et al., 2004). The low level of induction detected in downy mildewinfected discs could be due to the fact that the specific VvSTS response to the pathogen attack takes place later because of the time taken for germination and penetration of the pathogen, so that the response observed within the first 48 h represent mainly a woundinduced response, as confirmed by specific quantitative RT-PCR analyses presented in Chapter 4. On the contrary, the UV-C light response is know to be faster (Borie et al., 2004) and in fact led to a massive increase in the VvSTS accumulation within 24 h. One possible reason for this may be that a much larger number of cells within the leaf disc are subjected to the UV-C exposure compared to the wounding and downy mildew treatments which are only affecting a subset of cells. Looking at the specificity of response of the VvSTS subgroups to the three different stresses, it appears that members showing the highest response to all stress treatments are restricted to B2 subgroup, whereas B1 subgroup members show a lower response while members of the A subgroup showed little or no transcriptional response to the three stress treatments tested. Therefore, we were not able to identify a stress-specific response among different gene members belonging to the VvSTS family, but rather a specificity between the

97

different subfamilies. The B2 subgroup, that is also the most distant from CHS in terms of amino acid sequence identity, shows the highest response to stress induction, whereas the other two groups appear to deviate from this behaviour showing an increase in the constitutive accumulation and a decrease in the ability to respond to stresses. Schröder et al. (1988) previously proposed that based on phylogenetic analysis of STS and CHS proteins from pine, grapevine and peanut, that were not an ancestral STS gene in the strict sense and that STS evolved from CHS several times in the course of evolution (Tropf et al., 1994). It is therefore tempting to hypothesize that VvSTS gene members that appear to be most similar to members of the VvCHS gene family may show a enzyme activity which is closer to the chalcone activity rather than the stilbene one. Large-scale biochemical and enzymological analyses of multiple members of the grapevine STS family woul be required to confirm this hypothesis. Thanks to the availability of an expression atlas of V. vinifera cv. Corvina kindly provided by Prof. Mario Pezzotti (University of Verona, Italy), it was possible to carry on an investigation of the VvSTS transcript accumulation in different grape tissues and under different conditions to those studied by the mRNA-seq approach. Data were produced using a microarray technology developed by Roche-NimbleGen 12x135K and numerous tissues at different developmental stages were analysed (Table 3.3). The expression pattern of the whole VvSTS gene family in grapevine was screened on this data set. Interestingly, the results did not show an significant increase in the VvSTS expression in berries during both veràison and ripening stages, in contrast with previously reported data, which had showed that healthy grape berries synthetise stilbenes compounds under natural environmental conditions (Versari et al., 2001; Burns et al., 2002; Hall and De Luca, 2007; Gatto et al., 2008). Nevertheless, the level of stilbenes probably represents the grape response to soil composition and climate and appeared to be cultivar specific (Burns et al., 2002, Landrault et al., 2002), so it may be argued that the V. vinifera cv. Corvina doesn’t accumulate high levels of stilbenes and VvSTS transcripts in grape berries during berry natural developmental stages. This is supported by the data of Versari et al. (2001), who measured changes in phenolic compounds in V. vinifera cv. Corvina berry skin during berry development and was not able to detect any amount of resveratrol during the véraison phase and detected only a very low concentration (1.5 μg g-1) at the ripening stage.

98

In contrast, a significant increase in VvSTS transcript level was detected in leaves, particularly at the senescence stage, in roots propagated in vitro and in all stages of the rachis development, with the highest transcript level corresponding to the ripening phase. The high level of VvSTS expression in roots is in agreement with the detection of high levels of oligostilbenes in this organ (Korhammer et al., 1995). Moreover, the propagation of this organ in vitro is an artificial procedure that could represents a stress for the plant, leading to an induction of stress-associated genes such as STSs. On the contrary, expression of VvSTS genes in leaves is quite surprising and it appears to be restricted to the members belonging to the subgroups A and B1 in young leaves, with the highest transcript accumulation for those members belonging to the sub-family B1 (VvSTS1-4), as previously observed in mRNA-seq analysis of stressed tissues (control sample; section 3.3.4). As leaves progressed from the young-leaf stage to the senescence subgroup A members were found to increase in expression and finally, in the senescent leaf, there ws a generalised induction of most VvSTS genes. The observed induction of VvSTS genes in senescent leaf tissue, may represent a stress-induced response rather than a natural accumulation of VvSTS transcript. During senescence, leaves are subject to a range of dramatic events, such as attack by pathogens, wounding and accumulation of reactive oxygen species (ROS), that may lead to the induction of stress-induced defence genes including VvSTSs. Similarly, the process of berry withering is an artificial process, designed to alter most quality characteristics and increase the concentration of simple sugars in the production of desserts and fortified wines. Drying of harvested grapes in this way results in dramatic induction of the majority of VvSTS genes in berry at al withering phases demonstrating that harvested grape berries are still capable of undergoing a significant stress response. More in detail, this organ appears to constitutively accumulate VvSTS transcripts at the level of the exocarp, whereas the expression is lower at the level of the flesh. A Similar induction, coupled with an increase in the resveratrol content in berry skin during wilting process was observed by Versari et al. (2001), under different traditional and artificial wilting conditions. More recently, Zamboni et al. (2008) observed that withering induced a stronger dehydration stress response in grape berries resulting in a high expression level of genes involved in stress protection mechanisms, such as dehydrin and osmolite accumulation. Genes involved in hexose metabolism and transport, cell wall composition,

99

and secondary metabolism (particularly the phenolic and terpene compound pathways) were similarly regulated in both processes. The higher VvSTS expression detected in this analysis at the level of the withering berry skin is also in accordance with the immunodetection of STS proteins performed on berry extracts by Fornara et al. (2008). This study showed that STS protein is located mainly in berry exocarp during the véraison phase and is detected only occasionally at the level of the mesocarp.

100

Chapter 4: Isolation and identification of R2R3-MYB transcription factors co-expressed with VvSTS genes under biotic and abiotic stress conditions

4.1 Introduction To date, no information has been published regarding transcription factors involved in the transcriptional regulation of structural genes involved in the stilbene synthase pathway. Nevertheless, a growing number of TFs controlling several step of the close flavonoid pathway have been isolated and characterized in grapevine (Figure 1.6). VvMYB5a and VvMYB5b are involved in the control of several branches of the pathway, regulating different structural genes belonging to this biosynthetic scaffold. VvMYBA1 and VvMYBA2 regulate VvUFGT (UDP-Glc:flavonoid-3-O-glucosyltransferase), which encodes an enzyme responsible for the conversion of anthocyanidins to anthocyanins (Kobayashi et al., 2002; Walker et al., 2007). VvMYBPA1 is another transcriptional regulator of different branches of this pathway (Bogs et al., 2007) and, most recently, the grape AtMYB12-like gene VvMYBF1 was shown to complement the flavanol-deficent Arabidopsis mutant myb12 underlining its role in the regulation of this branch of the flavonoid pathway and in the interaction with the flavonol aglycone biosynthetic gene VvFLS1 (Czemmel et al., 2009). All of the MYB TFs shown to regulate the flavonoid biosynthetic pathway belong to the plant R2R3-MYB subgroup and require interaction with a bHLH protein (EGL3), in order to activate gene expression. Based on a recent analysis of the PN40024 8.4X assembly coverage performed by Matus et al. (2008), grapevine appears to have at least 108 genes encoding R2R3-MYB TFs. In Chapter 3, a whole transcriptome analysis was performed on leaf discs subjected to biotic and abiotic stresses, focusing on the expression pattern of predicted VvSTS genes and identifying different subgroups of members based on their transcriptional response. In this Chapter, the same transcriptome data-sets were used to identify putative TFs co-expressed with VvSTS which may be potentially involved in their regulation. Considering the close relationship between the stilbene synthase and flavonoid biosynthetic pathway and considering that the latter appears to be controlled exclusively by TFs

101

belonging to the R2R3-MYB sub family, the investigation focused on this group, monitoring the expression pattern of all 108 members of the grapevine R2R3-MYB family. Two candidate R2R3-MYB genes were found. In particular one of these two R2R3-MYB TFs appeared to be strongly induced upon stresses, co-expressing with VvSTS genes in the mRNA-seq. The co-expression of this candidate R2R3-MYB factor with VvSTS genes was investigated in more detailed real-time analyses under different biotic and abiotic stresses.

102

4.2

Materials and methods

4.2.1 mRNA-seq analysis of the R2R3-MYB TF gene family in stressed tissues Data sets obtained from mRNA-seq (Illumina) analysis of V. vinifera cv. Pinot noir leaf discs treated by wounding, UV-C exposure and P. viticola infection (Section 3.2.3) were screened for the expression of the whole R2R3-MYB TFs gene family. Based on the genome-wide analysis performed by Matus et al. (2008) on the 8.4X assembly coverage of the PN40024 genotype, a total of 108 R2R3-MYBs were analysed. The mRNA-seq analysis was performed using the same PN40024 genotype assembly coverage as the reference genome (Section 3.2.3, section 3.2.4). To complement and extend these data, the expression pattern of candidate TFs identified by the mRNA-seq analysis was also screened in the expression atlas provided by the University of Verona (Section 3.3.5) to verify a coexpression with VvSTS genes. Graphical representations of expression values were obtained by means of MeV software.

4.2.2 Collection of material for quantitative real-time PCR expression analysis Leaf discs of 15 mm of diameter were punched from healthy leaves detached from glasshouse-grown V. vinifera cv. Shiraz vines (Section 2.1.4). Discs were obtained from leaves belonging to different plants and showing similar age based on size and node positions in plants, treated with different biotic and abiotic stresses (Sections 3.2.4.1, section 3.2.4.2 and section 3.2.4.3) and incubated upside down on 3MM moist filter paper in large Petri dishes until harvest at which point discs were immediately frozen in liquid nitrogen and stored at -80 °C until RNA extraction.

4.2.2.1 Wounding treatment The punching of discs was considered as a wounding treatment. In a first experiment, performed for looking at the expression of selected VvSTS and R2R3-MYB

103

genes, discs were sampled at 0, 4, 8, 16, 24, 48, 72 and 96 h after treatment. In order to check the expression pattern of other R2R3-MYB TF genes known to be involved in the flavonoid pathway, a second time course was carried out. In this case, discs were sampled at early stages post-wounding: 0, 1, 5, 9, 17 and 25h. Control discs (0 h) corresponded to an unwounded leaf straight detached from a healthy vine. For the early wounding time course, discs were sampled at 0, 0.5, 1, 2, 4 h after wounding.

4.2.2.2 UV-C exposure Discs were punched immediately after detaching of leaves from plants and placed on 3MM moist filter paper, abaxial side up in large square Petri dishes. Discs were irradiated at 254 nm (0.36J cm-3) for 10 min, at a distance of 10 cm from the UV-C source. Efficiency of the elicitation treatments under different experimental conditions was determined histochemically evaluating the intensity of auto-fluorescence of discs mounted with the under side up in a lactic acid, glycerol and water mixture (1:1:1, v/v/v) on glass slides under long-wave UV light (365 nm). The intensity of the blue fluorescence observed was correlated with the quantity of resveratrol present in samples. Control discs were not elicited and exposed to normal light conditions. After treatment, all samples were incubated in the dark at 22 °C. Five discs were randomly chosen from control and UV-C treatments 0, 4, 8, 16, 24 and 48 h after treatment and immediately frozen in liquid nitrogen.

4.2.2.3 P. viticola infection Discs were punched immediately after detaching of leaves from plants and placed on 3MM moist filter paper, abaxial side up, in large square Petri dishes. Discs were sprayed from a distance of approximately 20 cm with a solution containing P. viticola sporangia at a concentration of 105 sporangia ml-1 (Section 2.1.5). After approximately 1 hour the inoculum was checked under a light microscope in order to verify the vitality of zoospores. Control samples were sprayed with sterile water. All samples were incubated at 22 °C under 12 h light/ 12 h dark conditions. Five discs were randomly chosen from control and infected treatments at 0, 8, 16, 24, 48, 72 and 96 h after infection, dried with absorbent paper and immediately frozen in liquid nitrogen. In order to verify the presence of infection

104

in downy mildew-treated discs and the absence in control discs, remaining discs were maintained on Petri dishes until sporulation took place (approximately 5-6 days).

4.2.3 Quantitative real-time PCR analysis Expression analyses were carried by quantitative real-time PCR using a Sybr green method on a Rotor-Gene 3000 (Corbett Research, Mortlake, Australia) thermal cycler. Each 15ul PCR reaction contained 330 nM of each primer, 2ul of diluted cDNA (Section 2.2.15), 1X FastStart Sybr green (Roche) and sterile water. The thermal cycling conditions used were 94°C for 10 min followed by 40 cycles of: 95 °C for 30 s, 56 °C or 58 °C for 30 s, and 72 °C for 30 s, followed by a melt cycle with 1 °C increments from 55 to 96 °C. All primer pairs amplified a single product of the expected size and sequence, as confirmed by melt curve analysis, agarose gel electrophoresis (Section 2.2.2), and DNA sequencing (Section 2.2.16). After testing the suitability of 18S, actin and elongation factor EF1 for use of reference genes, elongation factor was selected for normalization of all samples analysed. The expression of each target gene was calculated relative to the expression of elongation factor in each cDNA using Rotor-Gene 6 Software (Corbett Research, Mortlake, Australia) to calculate CT values, observe melt profiles, extrapolate the concentration and measure primer pairs efficiencies. All primers sequences are described in table 2.3.

105

4.3 Results 4.3.1 Identification of a candidate R2R3-MYB TF gene induced in grapevine in response to biotic and abiotic stresses In order to isolate and identify R2R3-MYB TFs potentially involved in the regulation of stilbene synthase genes in grapevine, we analysed data sets obtained from the mRNA-seq analysis described in Chapter 3, for all the 108 R2R3-MYB TFs identified by Matus et al. (2008) for an expression pattern similar to that observed for VvSTS genes under stress conditions. A graphical representation of the expression pattern of all R2R3-MYB genes analysed is illustrated in Figure 4.1. Genes with a RPKM value lower than 0.1 were considered as not expressed and were removed from Figure 4.1 to simplify it. Of the 108 grape R2R3-MYB factors analysed, only two accessions displayed similar expression patterns to the inducible VvSTS genes. These two accessions, designated as GSVIVT000028596001 and GSVIVT0000020267001 on the 8.4X assembly coverage, have previously been assigned the gene names VvMYB14 and VvMYB15 respectively by Matus et al. (2008) based on their homology to the A. thaliana R2R3-MYB genes. As observed for VvSTS genes, UV-C treatment induced the largest increase in their expression. In particular, while the induction of VvMYB15 seemed to be restricted to this kind of stress, with a peak reaching a RPKM value close to 200 at 24 hour after treatment and with a very low induction upon wounding and downy mildew infection, VvMYB14 showed a dramatic increase in the expression upon all treatments. Again, the highest induction was reached 24 h after UV-C treatment, with a value approaching 800 RPKM. However, wounding and downy mildew infection also resulted in significant increases in the VvMYB14 expression with values ranging between 72-104 RPKM. Constitutive expression of VvMYB14 was also detectable in the control sample (0h) but this is probably the result of the fact that these control discs were actually sampled immediately before the application of the stress treatments but a period of time (approximately half an hour) after discs had been cut. Therefore some wound induction of the gene had already commenced prior to application of the other stress treatments.

106

Figure 4.1 - Expression image representation of the complete R2R3-VvMYB TFs gene family. The treatments (wounding, UV-C exposure and downy infection) are displayed vertically above each column. Annotations are displayed to the right of each row. Expression data are expressed in million of reads per kb (RPKM). Unexpressed members with a value < 0.1 RPKM were excluded from the figure to simplify.

In order to extend and validate the reliability of the mRNA-seq data we also investigated the VvMYB14 and VvMYB15 expression in the grapevine expression atlas kindly provided by Prof. Mario Pezzotti (University of Verona, Italy). Figure 4.2 illustrates a significant coexpression between VvMYB14, VvMYB15 and VvSTS in the microarray data.

107

Figure 4.2 - Expression representation obtained by MeV of the complete VvSTS gene family in different tissues and developmental stages of Vitis Vinifera cv Corvina. Data on the expressions of VvMYB14 and VvMYB15 are also represented (bottom two rows) and correlate with patterns observed for VvSTS genes.A with a number of VvSTS genes, both VvMYB14 and VvMYB15 were found to be constitutively expressed in the rachis, roots and in senescing leaves. There was also a very good correlation between VvSTS and VvMYB14/15 expression in berries undergoing post-harvest withering which was strongly localised in the berry skin. 108

4.3.2 VvMYB14 and VvSTS genes are co-expressed in cell cultures treated with jasmonates Further confirmation of the strong correlation between VvMYB14 and selected VvSTS genes was also obtained by analysing published and unpublished data from a microarray analysis of V. vinifera cv. Cabernet Sauvignon cell-cultures treated with methyl-jasmonate (MeJA), MeJA plus salicylic acid (SA) and Jasmonic acid (JA). This data were obtained in part from a previously published paper (D’Onofrio et al., 2009) and in part from unpublished data kindly provided Dr. Paul Boss (CSIRO Plant Industry, Waite Campus, South Australia). All three treatments led to an induction of the VvSTS genes represented by probes on the Affymetrics Vitis Vinifera GeneChip with an intensity varying between 7 and 27 time fold increase (Table 4.1). Published microarray data (D’Onofrio et al., 2009) indicated that, among all R2R3-MYB TF genes known to be involved in the regulation of the flavonoid pathway, only VvMYBPA1 (GSVIVT00008644001), an R2R3-MYB involved in the regulation of tannin biosynthesis was differentially expressed more than 5 fold in response to MeJA treatment. Despite the increase in the transcript level after MeJa treatment, the other two treatments with MeJA + SA and Jasmonic acid didn’t lead to any increase in the expression of VvMYBPA1, indicating a different response of this MYB TF compared to VvSTS genes. VvMYB5a (VvMYBCs1; GSVIVT00025459001), another R2R3-MYB involved in the regulation of flavonoids biosynthesis, showed a 3-5 fold increase in all treatment, while VvMYBA1 (GSVIVT00038762001), a TF known to be involved in the regulation of anthocyanin biosynthesis, did not show any variation in the transcript level in response to the hormone treatments. Accessions corresponding to other R2R3-MYB genes known to be involved in the regulation of the flavonoid biosynthesis pathway, such as VvMYB5b (GSVIVT00024797001) and VvMYBF1 (VvMYB12; GSVIVT00028082001) were not detected on the array. In contrast to the other R2R3-MYB, VvMYB14 showed a strong response to all hormone treatments, with a 50 fold increase after MeJA treatment, a 100 fold increase after MeJA + SA treatment, and an 80 fold increase in JA treated cells (Table 4.1).

109

Table 4.1 – Fold increase calculated from the average expression values from three arrays used for each treatment and from the controls. MeJA, methyl jasmonate; MeJA+SA, methyl jasmonate and salicylic acid; JA, jasmonic acid. A dash indicates this gene was not present on the Affymetrix gene chip. Gene Stilbene synthase

R2R3-MYBs VvMYBCS1 VvMYB5b VvMYBPA1 VvMYBF1 VvMYBA1 VvMYB14 VVMYB15

PN40024 8.4X identifier

Fold relative to control

MeJA

MeJA + SA

JA

GSVIVT0004047001 GSVIVT0009238001 GSVIVT0005194001 GSVIVT0009218001 GSVIVT0009229001 GSVIVT0009216001

7,09 12,22 14,02 7,02 20,25 11,96

6,89 13,91 12,01 7,23 26,94 13,94

6,48 11,52 12,35 7,19 26,98 12,64

GSVIVT00025459001 GSVIVT00024797001 GSVIVT00008644001 GSVIVT00028082001 GSVIVT00038762001 GSVIVT00028596001 GSVIVT00020267001

3 20,08 1 50 -

3 1,12 1 100 -

5 3,59 1 80 -

4.3.3 Sequence homology of VvMYB14/15 with other R2R3-MYB transcription factors VvMYB14 encodes a protein of 269 aa in lenght and its deduced amino acid sequence analysis confirmed it contains the N-terminal R2R3 imperfect adjacent repeats that corresponds to the DNA-binding domain of plant R2R3-MYB-type proteins. Alignment of the predicted protein products of all of the R2R3-MYB TFs identified in V. vinifera with the R2R3-MYB TF family from A. thaliana, together with several TFs functionally characterized from N. tabaccum showed that both VvMYB14 and VvMYB15 cluster with a group of proteins including AtMYB13, AtMYB14, AtMYB15, NtMYBJS1 and NtMYB2 (Fig. 4.3).

110

Figu ure 4.3 - (A A) Phylogeenetic relatioonship betw ween VvMY YB14, VvM MYB15, an nd R2R3MYB B factors from f A. thaaliana and several MYBs M functtionally chaaracterized from N. tabacccum. Thee figure reepresents a small brranch of the t entire phylogeneetic tree. Phylogenetic annalyses were performedd using thee neighbourr joining meethod by th he Vector NTI software. (B B) Protein sequence s alignment off VvMYB14 and VvMYB B15a & b with w other R2R3-MYB facctors from A. A thaliana and a several MYB factoors functionally charactterized in g and N. taabaccum. Iddentical resiidues are shhown in blaack, conserrved residuees in dark grey, simillar residues in light greey.

111

Both the Arabidopsis and tobacco TFs in this cluster have been shown to respond to abiotic stresses (Gàlis et al., 2006; Chen et al., 2008). Furthermore NtMYBJS1 and NtMYB2 are known to be involved in the regulation of upstream genes in the phenylpropanoid pathway such as PAL and C4H (Sugimoto et al., 2000; Gàlis et al., 2006). Similarly to the over 100 members of the R2R3-MYB protein family in Arabidopsis, the R2R3 repeat region of VvMYB14 is highly conserved and contains the motif [D/E]Lx2[R/K]x3Lx6Lx3R for interaction with bHLH proteins. Interestingly all of putative TFs clustering with VvMYB14/15 also share two conserved domains in the C-terminal (Figure 4.3 B) domain, which are not found in any other R2R3-MYB TFs and may be important in their regulatory function.

4.3.4 Quantitative RT-PCR analysis of VvSTSs and a VvMYB14 expression in response to abiotic and biotic stresses The analysis of mRNA-seq data from samples treated by wounding, UV-C exposure and P. viticola infection, together with analysis of the gene expression atlas in V. vinifera cv. Corvina indicated that there is a strong correlation between the expression pattern of those stilbene synthase genes able to accumulate transcript under these different conditions and the R2R3-MYB TF VvMYB14. To confirm and investigate these observations in more detail, the transcript level of two highly responsive stilbene synthase genes VvSTS36 and VvSTS22 and the VvMYB14 TF was monitored using a quantitative RT-PCR in wounded, UV-C irradiated and P. viticola infected leaf discs. The selection of reference genes in order to normalize the cDNA represents a critical step in any quantitative RT-PCR analysis. In this analysis, elongation factor EF1 was selected as the reference gene after testing 18S and β-actin. The expression of elongation factor was the most stable of three candidates in the wounded and UV-C irradiation treatment and was selected as comparison gene for this analysis. In contrast, the expression of the 18S reference gene was stable in wounded samples, but showed a strong decrease in UV-C treated samples.

112

4.3.4.1 Quantitative RT-PCR analysis of VvMYB14, VvSTS22 and VvSTS36 expression in wounded grapevine leaves Glasshouse grown Shiraz leaves were used in order to obtain leaf discs of 15 mm of diameter. Leaves of a similar age were collected based on similar size and node position. The punching of discs from leaves was considered as the wounding treatment. Discs were sampled at random from a mixture of discs obtained from different leaves at 0 (unwounded leaf), 4, 8, 16, 24, 48, 72 and 96 h after treatment. Total RNA was extracted from these samples and the expression of VvSTS36 and VvSTS22 and VvMYB14 determined using quantitative RT-PCR.

Changes in mRNA transcript levels over time in response to

wounding are presented in Figure 4.4. Looking at the VvSTSs expression, in the control sample (0 h), a very low constitutive expression of both VvSTS36 and VvSTS22 was detected, but considered as not relevant compared with the expression levels detected following wounding. VvSTS36 showed a gradual increase in expression with a peak around 8 h, followed by a slight decrease and a second increase in expression at 96 h. VvSTS22 showed a similar pattern of induction, although the first peak of expression appeared later compared to VvSTS36. The pattern of expression of the R2R3-MYB TF VvMYB14 was similar to that observed for the VvSTS genes with the important difference that its peak level of induction was earlier than for the two VvSTS genes. A significant induction of VvMYB14 was detected within 4 h of wounding followed by a general decrease in expression until 72 h and a second increase again at 96 h after treatment. An elevated level of VvMYB14 transcription was maintained throughout the treatment period. Thus, this first analysis confirmed the co-induction of VvMYB14 and the selected VvSTSs.

113

Figure 4.44 - Quantitattive RT-PC CR analysis of o VvMYB114 (A), VvST TS22 (B) and VvSTSS36 (C) in wounded Shiraz S leaf discs over a 96 h perriod. All values werre normalized to the exxpression of elongationn factor andd each is the averagge of one sample s tested in tripliicate. Errorr bars repreesent the standard errror. Primerr sequences are reported in Table 2.3. 2

114

4.3.4.2 Quantitative RT-PCR analysis of VvMYB14, VvSTS22 and VvSTS36 expression in UV-C exposed grapevine leaves Shiraz leaf discs irradiated under UV-C light (231 nm) at 10 cm distance from the light source for 10 min. The duration of the exposure and the distance from the UV-C source were determined empirically. Initial experiments were undertaken in which leaf discs were exposed at different distances (8cm, 10cm) from the UV-C light for 8, 10 and 12 mins. Subsequently, the resveratrol accumulation was monitored histochemically evaluating the auto-fluorescence of the discs irradiated under the different conditions. The exposure at 10 cm distance for 10 min was chosen because it resulted in the least amount of UV damage while resulting in notable resveratrol accumulation. Following UV-C treatment, discs were incubated in the dark at 22°C and sampled at 0, 4, 8, 16, 24 and 48h. Non-irradiated leaf discs were incubated under the same conditions and sampled at the same time points. Changes in mRNA transcript levels over time in response to UV-C treatment are presented in Figure 4.5. All three genes showed extremely high transcript accumulation when compared to the transcript level reached in wounded discs. The VvSTS expression pattern indicated the presence of two peaks: the first lower peak around 8h after treatment and the second much higher peak at 48 h. The same pattern and timing of expression was followed by VvMYB14, that, as observed in wounded samples, closely correlated with stilbene synthases transcript accumulation. Previous studies had shown the presence of a double peak of VvSTS induction in response to UV-C stress (Wang et al., 2010). Similar results had been reported in Pinot noir, Chardonnay (Borie et al., 2004) and grape cell suspensions (Liswdowati et al., 1991; Wiese et al., 1994). Liswidowati et al. (1991) and Wiese et al., (1994) have suggested that the STS gene family may be divided into two groups: some are expressed early with rapid degradation of the mRNA produced, and other are expressed later and slowly activated, but with more stable mRNA. The pattern of expression of the R2R3-MYB TF VvMYB14 was closely related to the expression pattern observed for the VvSTS genes with a significant induction already detectable at within 4 h after stress treatment.

115

Figuree 4.5 - Quaantitative RT-PCR R annalysis of VvMYB14 V ( (A), VvSTSS22 (B) and d VvSTS336 (C) in UV-C U treatedd Shiraz leaaf discs oveer a 48h perriod. Data ffor transcrip pt levels in i un-irradiiated controol discs sam mpled at the same time points are also shown n. All vallues were normalized n to the exppression of elongation factor and each is the average of one saample testeed in tripliccate. Error bars repressent the stanndard errorr. 2 Primerr sequences are reportedd in Table 2.3.

116

Analyses appear to suggest a biphasic pattern also for VvMYB14 with a first peak that is detectable within 8/16 h and a second high increase within 48 h. This study now demonstrates that the biphasic induction is also displayed by a single unique VvSTS, suggesting the existence of different regulation mechanisms laading to the activation of these genes or, eventually of different signalling pathways controlling the induction of VvMYB14. 4.3.4.3 Quantitative RT-PCR analysis of VvMYB14, VvSTS22 and VvSTS36 expression in downy mildew infected grapevine leaves Transcript levels of VvMYB14, VvSTS22 and VvSTS36 were measured in leaf discs infected with grapevine downy mildew (P. viticola). Discs of 15mm diameter were punched from healthy V. vinifera cv. Shiraz and sprayed on the abaxial surface with a solution containing downy mildew sporangia at concentration of 105 sporangia ml-1 as described in section 4.2.5. Following inoculation, discs were incubated at 22°C under 12h light / 12 h dark conditions and sampled at 0, 8, 16, 24, 48, 72 and 96 h. Non-inoculated leaf discs were sprayed with water alone and incubated under the same conditions and sampled at the same time points. Changes in mRNA levels over time in response to downy mildew infection are presented in Figure 4.6. Again, as observed in wounded and UV-C irradiated samples, all genes showed a very similar pattern of expression. Within the first 24 h the induction of both VvSTS22 and VvSTS36 appears to be due to the wounding stress rather than pathogen infection. This is evident by comparison of the transcript levels in infected and wounded discs that are almost equivalent (Figure 4.6). During the following hours, corresponding to the 48, 72, and 96 h time points, there was a gradual increase in the expression of both VvSTS genes. As a similar increase was not observed in the wounded leaves, it would appear that the increased transcription is in response to downy mildew infection and spread through the leaf discs. The maximum peak in the expression was reached at 96h corresponding to the sporulation of P. viticola on the abaxial surface of the discs. VvMYB14 showed exactly the same expression pattern, confirming the co-expression of VvMYB14 and VvSTS genes during pathogen infection.

117

Figurre 4.6 - Quantitative Q RT-PCR analysis off VvMYB144 (A), VvSSTS22 (B) and VvST TS36 (C) in downy milldew infecteed Shiraz leeaf discs ovver a 96h pperiod. Dataa for transccript levels in un-infeccted controll discs samp pled at the same time points are also show wn. All valuees were norrmalized to the expresssion of elonngation factor and eacch is the avverage of one o sample tested in trriplicate. Errror bars reppresent the standard errror. Primeer sequencees are reportted in Tablee 2.3.

118

4.3.3.4 Quantitative RT-PCR of VvSTS36, VvMYB14 and other R2R3-MYB factors involved in the regulation of flavonoid pathway In order to look more closely at the timing of the stress-induced increase in transcription of VvMYB14 relative to VvSTS, a second time course experiment was performed in which Shiraz leaf discs were sampled at 0, 1, 5, 9, 16 and 25 hours after wounding. Transcript levels of VvMYB14 and VvSTS36 were measured by quantitative RTPCR. In addiction, expression of all other R2R3-MYB genes known to be involved in the regulation of flavonoid synthesis (VvMYBA1, VvMYB5a, VvMYBCs1, VvMYBPA1 and VvMYB12) was also monitored (Figure 4.7). VvSTS36 transcript level showed an increase within the first 5 h after wounding, reaching the peak at 16 h of treatment. Subsequently it showed a decrease corresponding to the 25 h time point. On the R2R3-MYB TF genes examined, only VvMYB14 showed a strong increase in transcription prior to the increase in VvSTS36 transcription. VvMYB14 transcription increased within 1 h of wounding and continued to increase reaching a peak at 5 h after which point it showed a gradual decline. No other R2R3-MYB genes showed any significant induction under these conditions except for VvMYBPA1, which showed a slight induction after wounding, but with timing totally different from the VvSTS36. In fact, the transcript accumulation of VvMYBPA1 showed a low progressive increase, which reached its peak at 25 h after treatment. This result confirmed that (a) the induction of VvMYB14 transcription in response to wounding precedes the observed increase in wound-induced VvSTS36 transcription and (b) it is unlikely that any of the R2R3-MYB genes known to be involved in the regulation of flavonoid synthesis are involved in the direct transcriptional regulation of VvMYB14.

119

Figuree 4.7 - Quaantitative RT-PCR anaalysis of VvvMYB14, VvSTS36 Vv andd other R2R R3MYB factors f know w to be invoolved in thee regulation n of the flavvonoid pathw way All vallues were normalized n t the expreession of ellongation faactor and each is the aaverage of one to o samplee tested in trriplicate. Errror bars reppresent the standard errror. Primerr sequences are reporteed in Table 2.3. 2

120

4.3.4 Discussion In Chapter 3, a mRNA-seq whole-transcriptome analysis was performed on leaf discs subjected to biotic and abiotic stresses, focusing on the expression pattern of predicted VvSTS genes and identifying different subgroups based on their transcriptional response. In this Chapter, the same transcriptome data sets were used to identify putative transcription factors (TFs) co-expressed with VvSTS, which may be potentially involved in the transcriptional regulation of the stilbene synthase pathway in grapevine. To date, no information has been published regarding transcription factors involved in the transcriptional regulation of structural genes involved in the stilbene synthase pathway. Nevertheless, a growing number of TFs controlling several step of the close flavonoid pathway have been isolated and characterized in grapevine (Figure 1.6). VvMYB5a and VvMYB5b are involved in the control of several branches of the pathway, regulating different structural genes belonging to this biosynthetic scaffold. VvMYBA1 and VvMYBA2 regulate VvUFGT (UDP-Glc:flavonoid-3-O-glucosyltransferase), which encodes an enzyme responsible for the conversion of anthocyanidins to anthocyanins (Kobayashi et al., 2002; Walker et al., 2007). VvMYBPA1 is another transcriptional regulator of different branches of this pathway (Bogs et al., 2007) and, most recently, the grape AtMYB12-like gene VvMYBF1 was shown to complement the flavanol-deficent Arabidopsis mutant myb12 underlining its role in the regulation of this branch of the flavonoid pathway and in the interaction with the flavonol aglycone biosynthetic gene VvFLS1 (Czemmel et al., 2009). All of the MYB TFs shown to regulate the flavonoid biosynthetic pathway belong to the plant R2R3-MYB subgroup and require interaction with a bHLH protein (EGL3), in order to activate gene expression. Based on a recent analysis of the PN40024 8.4X assembly coverage performed by Matus et al. (2008), grapevine appears to have at least 108 genes encoding R2R3-MYB TFs. Considering the close relationship between the stilbene synthase and flavonoid biosynthetic pathway and considering that the latter appears to be controlled exclusively by TFs belonging to the R2R3-MYB subgroup, this investigation focused specifically on this group, monitoring the expression pattern of all 108 members of the grapevine R2R3-MYB family in mRNA-seq data sets obtained from leaf discs of V. vinifera cv. Pinot Noir wounded, exposed to UV-C radiation and infected with downy mildew (P. viticola). Of the 108 grape R2R3-MYB factors analysed, only two accessions

121

displayed a significant induction with similar expression patterns to the inducible VvSTS genes.

These

two

accessions,

designated

as

GSVIVT000028596001

and

GSVIVT0000020267001 on the 8.4X assembly coverage, have previously been assigned the gene names VvMYB14 and VvMYB15 respectively by Matus et al. (2008) based on their homology to the A. thaliana R2R3-MYB genes. Both genes have not been previously characterised from a functional point of view. Again, as observed for VvSTS genes, UV-C treatment induced the largest increase in their expression. In particular, while the induction of VvMYB15 appeared to be restricted to this kind of stress, with a peak reaching a RPKM value close to 200 at 24 h after treatment and with a very low induction upon wounding and downy mildew infection, VvMYB14 showed a dramatic increase in the expression in response to all stress treatments reaching a peak at 24 h after UV-C treatment, with a value approaching 800 RPKM. Constitutive expression of VvMYB14 was also detectable in the control sample (0h) but this is probably the result of the fact that these control discs were actually sampled immediately before the application of the stress treatments but a period of time (approximately half an hour) after discs had been cut. Therefore some wound induction of the gene had already commenced prior to application of the other stress treatments. Further confirmation of the strong correlation between VvMYB14 and selected VvSTS genes was also obtained by analysing published and unpublished data from a microarray analysis of V. vinifera cv. Cabernet Sauvignon cell-cultures treated with methyljasmonate (MeJA), MeJA plus salicylic acid (SA) and Jasmonic acid (JA). This data indicated that, among all R2R3-MYB TF genes known to be involved in the regulation of the flavonoid pathway, only VvMYB14 showed a strong response to all hormone treatments which also led to dramatic induction of VvSTS transcription, with a 50 fold increase after MeJA treatment, a 100 fold increase after MeJA + SA treatment, and a 80 fold increase in JA treated cells (Table 4.1). A significant co-induction of VvMYB14 and VvSTS was detected also by analysing other published microarray data. Zamboni et al. (2009) analysed the transcriptome changes of Vitis riparia × Vitis berlandieri grapevine cells in response to the modified β-cyclodextrin, DIMEB, a resveratrol elicitor, 2 and 6 h after treatment using a suppression subtractive hybridization experiment and a microarray analysis respectively. By analysing supplemental data provided by Zamboni et al. (2009), a 9.7 fold increase in VvMYB14 expression was observed in cell cultures treated with DIMEB. Similarly, the

122

screening for the expression of VvMYB14 in microarray data obtained from an experiment which compared gene expression in susceptible (V. vinifera) and resistant (V. riparia) grape species infected with P. viticola (Polesani et al. 2010), showed a 10 time fold increase in the resistant cultivars, that is also associated to a higher accumulation of VvSTS transcripts. VvMYB14 encodes a protein of 269 aa in lenght and its deduced amino acid sequence contains the N-terminal R2R3 imperfect adjacent repeats that corresponds to the DNAbinding domain of plant R2R3-MYB-type proteins. Alignment of the predicted protein products of all of the R2R3-MYB TFs identified in V. vinifera with the R2R3-MYB TF family from A. thaliana, together with several TFs functionally characterized from N. tabaccum showed that both VvMYB14 and VvMYB15 cluster with a group of proteins including AtMYB13, AtMYB14, AtMYB15, NtMYBJS1 and NtMYB2 (Fig. 4.3). As with the over 100 members of the R2R3-MYB protein family in Arabidopsis, the R2R3 repeat region of VvMYB14 is highly conserved and contains the motif [D/E]Lx2[R/K]x3Lx6Lx3R for interaction with bHLH proteins. Interestingly all of the putative TFs clustered in the AtMYB14 group also share two conserved domains in the C-terminal (Figure 4.3 B) domain, which are not found in any other R2R3-MYB TFs and may be important in their regulatory function. Little information is available regarding the function of the AtMYB13, AtMYB14 and AtMYB15 genes apart from the work of Ding et al. (2009) showing that overexpression of AtMYB15 improves drought and salt tolerance in Arabidopsis possibly by enhancing the expression levels of the genes involved in ABA biosynthesis and signalling and those encoding the stress-protective proteins. NtMYBJS1 and NtMYB2 have also been shown to be stress-induced and are known to be involved in the regulation of upstream genes in the phenylpropanoid pathway such as PAL and C4H (Sugimoto et al., 2000; Gàlis et al., 2006). These observations appear to support the hypothesis that VvMYB14 and VvMYB15 may be involved in the regulation of key steps of the flavonoid pathway in grapevine and, in particular of the stilbene biosynthesis by directly or indirectly controlling VvSTS transcription. The putative role of VvMYB14 in VvSTS transcription was further supported by the results of time-course analyses of VvMYB14 and VvSTS expression in V. vinifera cv. Shiraz leaf discs treated with biotic and abiotic stresses (downy mildew infection, UV-C exposure and wounding). In all treatments analysed, VvMYB14 expression was found to correlate with

123

expression of two selected highly responsive VvSTS genes (VvSTS22 and VvSTS36) in terms of pattern and timing. Whenever VvSTS genes were induced, VvMYB14 was also found to be induced, and, most importantly, the induction of VvMYB14 always preceded the initial induction of VvSTS genes. This observation was particularly evident in the early wound response, which was investigated more in detail looking not only at the expression of selected STS gene and candidate VvMYB14 TF, but also at the induction of the other R2R3-MYB factors known to be involved in the regulation of other structural genes of the flavonoid pathway such as VvMYB5a, VvMYB5b, VvMYBPA1, VvMYBA1 and VvMYB12 (Figure 4.7). VvMYB14 was the only R2R3-MYB TF that correlated with the induction of VvSTS36. Taken together, these results strongly suggest a role for VvMYB14 (and possibly VvMYB15) in the regulation of stilbene biosynthesis in grapevine.

124

Chapter 5: Functional demonstration of regulation of VvSTS transcription by VvMYB14

5.1 Introduction In Chapter 4 a candidate TF VvMYB14 belonging to the R2R3-MYB sub-family was identified, which is co-expressed with VvSTS genes in stressed grape tissues. Quantitative RT-PCR analysis of VvMYB14 expression together with VvSTS36 and VvSTS22 in detailed time courses experiments following wounding, UV-C exposure and downy mildew infection indicated a strong correlation between VvMYB14 and VvSTSs expression. All elicitations leading to an increase of stilbene synthase transcript level also lead to an increase in VvMYB14 expression. Moreover, the induction of VvMYB14 precedes the induction of stilbene synthases. In this chapter a number of different approaches have been used to try and demonstrate a functional link between VvMYB14 transcription and VvSTS induction. To obtain direct demonstration of the regulation of VvSTS promoter activity by VvMYB14 gene, reporter assays were performed using a dual luciferase assay system. This approach has been used successfully to demonstrate the interaction of R2R3-MYB TFs with promoters of genes encoding members of the flavonoid biosynthetic pathway (Bogs et al., 2007; Deluc et al., 2008; Czemmel et al., 2009). A preliminary attempt was also made to obtain in planta evidence for the role of VvMYB14 in the regulation of stilbene synthesis by transformation of grapevine with hairy root system. Unfortunately, stilbene synthase genes are characteristic of a reduced number of plant species and are not present in the model organism A. thaliana. Moreover, stable transformation of grapevine for testing function of genes such as VvMYB14 is a complicate and time-expensive process. For these reasons, in order to obtain an in planta confirmation for the role of VvMYB14 in the control of the stilbene synthase pathway, we developed an alternative strategy, using a grapevine hairy root system. Due to their fast growth rates and biochemical stability, ‘hairy root’ cultures represent a good experimental model in plant metabolic engineering and in the functional characterization of candidate genes (Shanks and Morgan 1999). Thus, VvMYB14 over-expressing and silenced hairy root lines were produced in order to monitor the effect of VvMYB14 on the transcript level of stilbene synthase genes.

125

5.2 Materials and methods 5.2.1 Solutions and growth media for hairy root transformation Solutions and growth media used for the initiation and maintenance of grapevine hairy root cultures are reported in Table 5.1. All solutions were filter sterilised and stored at 4 °C. All media was autoclaved. Table 5.1 - Solutions and growth media for hairy root culturing and maintenance.

Solution

SM Medium

10x SM Macros

1000x MS Micros

1000x B5 Vitamins

200x Fe/EDTA

126

Composition

1L

10x SM Macros 1000x MS Micros 1000x B5 vitamins 200x Fe/EDTA 1.5% sucrose 1% agar pH 5.7 with 1M KOH NH4NO3 CaCl2.2H2O MgSO4.7H2O KNO3 KH2PO4 H3BO3 MnSO4.4H2O ZnSO4.7H2O KI Na2MoO4.2H2O CuSO4.5H2O CoCl2.6H2O Myo-inosytol Thiamine-HCl Nicotinic acid Pyridoxine-HCl Na2EDTA.2H2O FeSO4.&H2O

100ml 1ml 1ml 5ml 15g 10g 1.6g 4.1g 3.7g 23.25g 3.4g 6.2g 22.3g 8.6g 8.6g 0.25g 25mg 25mg 100g 10g 1g 1g 7.44g 1.86g

Table 2.2 – (continued) Solution

10x Macronutrients

LG0 Medium

250x C1 vitamin mix

GC Medium

Composition KNO3 (NH4)2SO4 CaCl2.2H2O MgSO4.7H2O NaH2PO4.2H2O 10x Macronutrients Casein hydrolysate ½ MS 250x C1 Vitamin mix Sucrose pH 5.8 with 1M KOH Phytoagar Myo-inositol Nicotinic acid Thiamine-HCl Pyridoxine-HCl Biotin Gamborg’s B5 Basam Medium Sucrose Casein hydrolysate 1000μM Kinetin 1000μM NAA pH 5.7-5.8 with 1M KOH Agar 0.8%

1L 1.5g 0.15g 0.15g 0.25g 0.25g 100ml 0.5g 2.3g 4ml 25g 5g 25g 2.5g 2.5g 0.25g 0.0025g 3,21g 30g 0.25g 930μl 540μl 8g

5.2.2 Cloning of reporter constructs for transient promoter assays A reporter construct utilizing a firefly luciferase (LUC) reporter gene was used to assess the ability of VvMYB14 to activate the promoter of selected stilbene synthase genes VvSTS36 and VvSTS22. A 1815-bp DNA fragment of the VvSTS36 promoter was amplified by PCR from genomic DNA obtained from V. vinifera cv. Shiraz using Velocity DNA polymerase (Bioline) with the primers VvSTS36pSAL-F and VvSTS36pNOT-R as indicated in Section 2.2.1. A 2115 bp DNA fragment of the VvSTS22 promoter was amplified with the same procedure using primers VvSTS22pSAL-F and VvSTS22pNOT-R. These PCR fragments were gel purified, cloned into pBLUNT (InvitrogenTM) vector as described in section 2.2.7, and sequenced. For progressive promoter deletions of VvSTS36, fragments of respectively 1143bp, 716bp, 265bp and150bp were amplified from the 1815bp insert cloned into pBLUNT vector using Velocity DNA polymerase (Bioline) and primers VvSTS36p1SAL-F, VvSTS36p2SAL-F, VvSTS36p4SAL-F, and VvSTS36p5SAL-F. All primers used for these PCR reactions contained restriction sites for sub-cloning the

127

promoter fragment into the dual luciferase reporter vector pGreenII-0800-LUC (Hellens et al., 2005) as a NotI/SalI fragment. pBLUNT plasmids containing different promoter fragments were digested with NotI and SalI restriction enzymes and cloned between the respective sites of vector pGreenII-0800-LUC. For transient expression of VvMYB14, its ORF was amplified from cDNA obtained from UV-C irradiated Shiraz berry skins kindly provided by Dr. Ian Dry (CSIRO Plant Industry, Adelaide, SA). The amplification reaction was performed using Platinum(R) Taq High Fidelity DNA polymerase with primers VvMYB14-ATG-Xho and VvMYB14-STOP-BamHI. The PCR fragment was digested with XhoI and BamHI and ligated into the expression vector pART7 (Gleave, 1992) digested with the same restriction enzymes behind a Cauliflower mosaic virus (CaMV) 35S constitutive promoter. The VvMYB14 ORF fragment was sequenced before analysis in the transient assay system.

5.2.3 Transient transfection Experiments and dual luciferase assay A transient assay was developed using a cell suspension of a V. vinifera cv. Chardonnay petiole callus culture, maintained on Grape Cormier (GC) medium (Do and Cormier, 1991). Cells in log-phase growth were gently filtred onto sterile Whatman discs and placed on GC media. Gold particles were coated with a mixture of DNA constructs comprizing pGreenII-0800-LUC with VvSTS36 and VvSTS22 promoter fragments, pART7VvMYB14 and a plasmid expressing EGL3 (Genbank accession no. NM20235; kindly provided by Dr. Mandy Walker, CSIRO Plant Industry, Adelaide, SA), which encodes the Arabidopsis bHLH protein required for the correct activity of some R2R3-MYB TFs involved in the regulation of the flavonoid pathway in Arabidopsis (Ramsay et al., 2003; Walker et al., 2007). Chardonnay cells were bombarded with a total plasmid concentration 3 μg per shot (Ramsay et al.,2003) at 350 kPa helium, a vacuum of 75 kPa and a distance of 14 cm (Torregrosa et al., 2002). After incubation in the dark at 27°C for 48 h, the harvested cells were assayed for firefly and renilla luciferase activities using the dual-luciferase reporter assay system (Promega) measured with TD-20/20 Luminometer (Turner Design). The relative luciferase activity was calculated as the ratio between the firefly (Photinus pyralis) and the Renilla reniformis (control) luciferase activity. All transfection experiments were performed in triplicate and each set of promoter experiments was

128

repeated with similar relative ratios to the respective control.

5.2.4 Cloning of VvMYB14 for over-expression and silencing in grapevine hairy roots The ORF of VvMYB14 was inserted in the binary vector pART27uGFP (Appendix 1; kindly provided by Mandy Walker, CSIRO PI, Adelaide, SA) for expression of the gene in grapevine hairy roots. The pART27uGFP binary vector is modified from the binary vector pART27 (Gleave, 1992) by the introduction of a GFP reporter gene driven by the Arabidopsis ubiqutin-10 gene promoter (UBQ10). The expression cassette 35S-VvMYB14OCS was obtained by digesting the pART7-VvMYB14 construct (Section 5.2.2) with the restriction enzyme NotI, gel purified, treated with alkaline phospatase and ligated into pART27uGFP digested with the same restriction enzyme. The presence of the GFP reporter gene in the pART27 binary vector selection of transformed hairy roors lines by observation with a fluorescence microscope. For production of a VvMYB14 silencing construct, the ORF of VvMYB14 was inserted into the pHELLSGATE 12 vector. This vector use GatewayTM recombinational cloning (InvitrogenTM) for high-throughput construction of hairpins targeting and silencing the gene of interest (Helliwell and Waterhouse 2003). The VvMYB14 ORF fragment was amplified with flanking attB1 and attB2 sites was amplified from pART7-VvMYB14 construct (Section

5.2.2)

using

Velocity

DNA

polymerase

(Bioline)

with

the

primers

VvMYB14_hp1_attB1_F and VvMYB14_hp1_attB2_R containing the attB1 and attB2 sequences. The resulting fragment was recombined with the plasmid pDONR-221, which contains attP1 and attP2 sites, giving rise to the pENTR vector with the inserted VvMYB14 ORF with flanking attL1 and attL2 sites. A second recombination reaction was then carried out to insert the target sequence into the attR1 and attR2 sites in the pHELLSGATE vector. Finally, the silencing cassette was digested with the restriction enzyme SbfI and cloned the GFP-containing binary vector pCLB130NH (Appendix 1; kindly supplied by Dr. Ian Dry, CSIRO Plant Industry, Adelaide, SA) digested with the same restriction enzyme.

129

5.2.5 Grapevine hairy root transformation The VvMYB14 expression and silencing constructs were electroporated into Agrobacterium rhizogenes A4 strain as described in Section 2.2.10 and incubated at 28°C with shaking (130 rpm) for approximately 1 hour. Bacteria were spread onto LB or MGL plates with the desired antibiotic (kanamycin) and allowed to grow for 3-5 days at 28°C until single colonies were visible. To produce a culture for hairy root transformation, a single A. rhizogenes A4 colony was inoculated into 3 ml of LB or MGL with the selective antibiotic and incubated with shaking at 28 °C for 24-48 h, until the culture reached an OD600 of 0.5. Control hairy roots lacking the VvMYB14 vectors were generated using untransformed A. rhizogenes A4 cultures. Two different procedures were used to obtain transformed hairy roots. In the first procedure, the apices of in vitro Chardonnay plantlets were cut off along with leaf petiole down the stem and the upper 5mm of the stem/petiole were crushed with long forceps previously dipped in the bacterial suspension. After inoculation, plantlets were incubated at 25 °C with a 14 h photoperiod for tissue callus to develop. After about 2/3 weeks, the stem/petiole was cut 5mm below the callus and placed onto LG0 plates with the stem-side down into medium so the callus was touching the surface. Plates were then left in the growth room under dappled light. In the second procedure young healthy leaves were cut from in vitro Chardonnay plantlets with the petiole intact. Leaves were placed onto SM medium plates with 750 μg ml-1 Timentin with the waxy surface in contact with medium and the petiole facing upwards. A drop of A. rhizogenes suspension was placed onto the end of the petiole, with the drop running down the length of the petiole. The inoculated leaves were incubated in the light at 28 °C for 5 days and than transferred with petiole onto SM plus Timentin 750 μg ml-1 with the petiole inserted into the agar. Hairy roots appeared after approximately 1 month and then transferred onto new plates of SM plus timentin 750 μg ml-1 at 28 °C in the dark. Roots were screened for the presence of GFP using Leica MZ12 light microscope with a Fluorescence attachment. GFP-positive roots were selected and subcultured every four weeks, maintaining timentin but reducing the concentration to 500 μg ml-1.

130

5.2.6 Quantitative real-time PCR analysis on wounded hairy roots Selected transformed and un-transformed hairy roots were wounded by cutting them into small pieces of approximately 2mm in length and incubating them in the dark. Tissue was sampled at 0, 2 and 4 hour after wounding, RNA extracted and cDNA synthetised as described in Sections 2.2.14 and 2.2.15. The expression of VvSTS36 and VvMYB14 was evaluated by quantitative real-time PCR using a Sybr green method on a Rotor-Gene 3000 (Corbett Research, Mortlake, Australia) thermal cycler. Each 15ul PCR reaction contained 330nM of each primer, 2ul of diluted cDNA (Section 2.2.15), 1X FastStart Sybr green (Roche) and sterile water. The thermal cycling conditions used were 94 °C for 10 min followed by 40 cycles of: 95 °C for 30 s, 56 °C or 58 °C for 30 s, and 72 °C for 30 s, followed by a melt cycle with 1 °C increments from 55 to 96 °C. Both primer pairs amplified a single product of the expected size and sequence, as confirmed by melt curve analysis, agarose gel electrophoresis (Section 2.2.2), and DNA sequencing (Section 2.2.16). Elongation factor was selected for normalization of all samples analysed. The expression of each target gene was calculated relative to the expression of elongation factor in each cDNA using Rotor-Gene 6 Software (Corbett Research, Mortlake, Australia) to calculate CT values, observe melt profiles, extrapolate the concentration and measure primer pairs efficiencies. All primers sequences are described in Table 2.3.

5.3 Results 5.3.1 VvMYB14 activates promoters of VvSTS22 and VvSTS36 To investigate whether VvMYB14 activates the transcription of VvSTS genes directly, a transient expression assay was established using a grape suspension cell culture and the dual luciferase assay system. In this system, grape cells are co-transfected with a plasmid carring the R2R3-MYB TF and a dual luciferase reporter plasmid pGreenII-0800-Luc containing the plant promoter fragment. This allows quantification of the promoter activity by measuring firefly luciferase activity, which is under control of the plant promoter, and normalising against the Renilla luciferase activity, which is under control of a CaMV 35S promoter. The VvMYB14 ORF was ligated into the pART7 expression vector under the control of the 35S promoter. The promoter fragments corresponding to approximately 2 kb

131

upstream of the strt codon of VvSTS36 and VvSTS22 were amplified from Shiraz genomic DNA and cloned into the pGreenII-0800-Luc such that the firefly luciferase reporter gene was under the transcriptional control of the VvSTS promoter fragments. The grapevine VvSTS36 and VvSTS22 promoters were then tested as potential targets for VvMYB14 activation. Figure 5.1 and 5.2 show a representative one of at least three indipendent experiments conducted with each VvSTS promoter. Each experiment was done with three technical replicates, i.e. three indipendent bombardments per treatment. Considering the average values of three idipendent experiments performed with each VvSTS promoter, Chardonnay cell suspensions transiently expressing VvSTS promoterluciferase expression constructs showed statistically significant increases of approximately 3 fold in activity when co-transformed with pART7-VvMYB14 plasmid DNA in comparison to control bombardments with empty pART7 plasmid DNA (Control 1) and with pGreenII-0800-Luc empty vector (i.e without any promoter fragment upstream the firefly luciferase) in presence of VvMYB14 (Control 2). These findings clearly indicated that VvMYB14 can enhance the expression of at least two structural genes involved in the stilbene synthase pathway.

132

Figurre 5.1 – Acctivation off VvSTS36 promoter by b VvMYB B14. Contro ol 1 indicaates the actiivity of the VvSTS36 prromoter in the t absence of VvMYB B14. Contrrol 2 indicaates the actiivity of lucciferase withhout any V VvSTS prom moter fragm ment in thhe reporter construct.. Each traansfection contained the 35S:E EGL3 consttruct encodiing the bHL LH protein EGL3 from m Arabidop psis. The normalised n luciferase activity a wass calculatedd as the rattio between n the fireflyy and Reniilla luciferaase activity. Each coluumn repressents the mean m ratio of o at least thhree bombaardments peer treatmentt with error bars indicaating SES.

133

Figure 5.22 – Activaation of VvvSTS22 prom moter by VvMYB14. V . Control 1 indicates thhe activity of the VvST TS22 promo oter in the absence a of V VvMYB14. Control 2 indicates thhe activity of o luciferase without any a promoteer fragmentt in the repoorter construuct. Each traansfection contained c thhe 35S:EGL L3 constructt encoding the bHLH H protein EGL3 E from m Arabidoppsis. The normalised d luciferase activity was calculatedd as the ratiio between the firefly and Renillaa luciferase activity. Eaach colmn represents the mean ratio of at least threee bombardm ments per treeatment withh error bars indicating SES.

134

5.3.2 Progressive deletions in the VvSTS36 promoter lead to a decrease in the promoter activity The VvSTS36 promoter region of 1815bp was analysed using the Plant DNA cis-element (PLACE)

database

(Higo

et

al.,

1999;

http://www.dna.affrc.go.jp/htdocs/

PLACE/signalscan.html) and found to contain numerous consensus sequences of the DNAbinding sites of MYB transcription factors (Figure 5.3 A). Among them we identified multiple MYBCORE cis-elements (CNGTTR, PLACE Accession no. S000176). The core MYB site is recognized by the plant transcription factor MYB Ph3 from Petunia (Solano et al., 1995), which is involved in the regulation of the flavonoid biosynthesis. Another important MYB-related cis element identified in the VvSTS36-promoter was the consensus sequence MYBPLANT (PLACE accession no. S000167). This plant MYB binding site is related to box P in promoters of phenylpropanoid biosynthetic genes such as PAL, CHS, CHI, DFR (Sablowsky et al., 1994). Other MYB-related cis elements identified were MYBST1 and MYBZM (GGATA, PLACE Accession no. S000180; CCWACC, Accession no. S000179). Using the same approach described in the previous section a transient expression assay was performed to examine the effect of progressive deletions of promoter regions containing the putative MYB-related cis elements on the promoter activity. Figure 5.3 B shows the relative luciferase activity obtained using promoter fragment of 1815 bp, 1143 bp, 716 bp, 265 bp and 150 bp in length in the presence and absence of the VvMYB14 TF. Interestingly, deletion of 672 nt from the 5’ end of the VvSTS36 promoter fragment actually led to an increase in promoter activity, suggesting the existence of some form of repression mechanism related to this region. Subsequent deletions led to a progressive decrease in the promoter activity but did not indicate the presence of any specific region within the VvSTS36 promoter (or MYB-related cis element) that was absolutely required for VvMYB14 activation of the promoter. Even the 150 bp promoter fragment, which does not appear to posses any known MYB-related cis element according to the PLACE database analysis was significantly induced in the presence of VvMYB14. Again, these results support a role for candidate VvMYB14 in the transcriptional regulation of stilbene synthase genes in grape.

135

Figurre 5.3 – Eff ffect of VvSSTS36-prom moter deletio ons on prom moter activitty. A: Posittion of putatiive MYB-reelated cis elements e ideentified in a 1815bp region r usingg Plant DN NA ciselemeent (PLACE E). MYBC CORE: PLA ACE Accession no. S0000176; M MYBST1: PL LACE Accession no. S000180; MYBZM M ( (PLACE acccession noo. S0001799); MYBPL LANT (PLA ACE accession no. S0000167). B:: Activation n of VvSTSS36 promotter fragmen nts by VvMYB14. Conntrol indicattes the actiivity of the respective promoter iin the absen nce of VvMYB14. Eacch transfecttion containned the 35S S:EGL3 construct enccoding the bHLH proteiin EGL3 (Genbank accession a noo. NM2023 35) from Arabidopsis. A . The norm malised lucifeerase activiity was callculated as the mean ratio betw ween the firrefly and Renilla R lucifeerase activitty. Each coolmn repressents the ratio of at least three boombardmen nts per treatm ment with errror bars inssicating SES S.

136

5.3.3 Silencing of VvMYB14 in grapevine hairy roots affects the induction of VvSTS36 expression in response to wounding To ascertain a putative function for VvMYB14 in an in planta system, we tried to overexpress and silence this gene in a hairy root system. The choice to use hairy root as a model for studying the role of candidate R2R3-MYB factors was due to the fact that this method is easy to develop and it’s characterized by fast hormone-independent growth and an high genetic stability. Both the VvMYB14-overexpression and VvMYB14-silencing constructs were cloned into binary vectors carrying the GFP reporter gene, in order to select transformed hairy root lines for further analysis. No transgenic hairy root lines containing the VvMYB14-overexpression construct were obtained. However, a high number of transgenic hairy root lines containing the VvMYB14-silencing construct were obtained as demonstrated by the presence of fluorescing GFP protein (Figure 5.4). GFP positive branching roots were cut off and propagated separately. Transgenic hairy roots containing the VvMYB14-silencing construct showed no apparent differences in growth compared to un-transformed hairy roots generated with untransformed A. rhizogenes A4 (data not shown). The effect of VvMYB14 silencing on stilbene synthase expression was examined by quantitative RT-PCR after wounding. Unfortunately, because of time constraints we were only able to do the experiment once so the results must only be considered as preliminary observations. Figure 5.4 A shows the VvMYB14 transcript level within 2 h after wounding treatment, in two untransformed hairy root lines (grey coloured) and in 7 individual transgenic lines transformed with the VvMYB14-silencing construct (represented by different colours). As expected by previous analysis in wounded leaf discs discussed in Chapter 4, wounding resulted in an large induction of VvMYB14 with a 8-15 fold increase in expression 2 h after treatment compared to control (0 h). In contrast, there appeared to be a reduction in the expression of VvMYB14 in the hairy root lines transformed with the VvMYB14-silencing construct compared to the two control lines ranging from approximately 2 to 20 fold at 2 h after wounding. A lower accumulation of VvMYB14 transcript in transformed hairy roots compared to untransformed lines was also observed in the control sample (0 h).

137

Figure 5.4 B shows the VvSTS36 transcript level under the same wounding treatment considered for VvMYB14 expression analysis. Again, untransformed hairy root lines are represented in grey and the 7 individual transgenic lines transformed with the VvMYB14silencing construct are represented by bars of different colours. This first screening indicates that silencing of VvMYB14 led to a significant decrease in VvSTS36 expression. This correlation was most obvious in silenced hairy root lines 5, 6, and 7, that show the highest levels of VvMYB14 silencing and at the same time the lowest induction of VvSTS36. Taken together these results appear to confirm a functional role for VvMYB14 in the transcriptional regulation of the stilbene synthase genes in grapevine.

138

Figure 5..3 – A: Exxamples of hairy rootss obtained following inoculation n with A. rhizogeness A4 transformed witth the VvM MYB14-silenncing constrruct; B: Trransgenic hairy rootts were confirmed by the t presence of GFP. Left picturres show haairy roots under norm mal light whhile right piictures show w the GFP signal s underr florescent light.

139

Figu ure 5.4 - Quantitative Q e RT-PCR analysis off VvMYB144 (A) and V VvSTS36 (B B) exprression in transgenic t h hairy roots. Roots weree wounded by slicing into ~ 2 mm m segm ments and incubating i for 2 h. Unntransformeed hairy root lines (coontrol) are in greyy while inddividual traansgenic linnes transforrmed with the VvMYB B14-silencin ng consstruct are represented r by differennt colours. All values were norm malized to th he exprression of EF1 E and eacch is the avverage of on ne sample tested t in tripplicate. Error barss represent the t standardd error.

140

5.3 Discussion In chapter 4 we identified VvMYB14, a candidate TF belonging to the R2R3-MYB subfamily, which is co-expressed with VvSTS genes in stressed tissues. The experiments detailed in this chapter were designated to obtain direct evidence of the role of VvMYB14 in the regulation of VvSTS transcription in grapevine. To obtain direct evidence of the regulation of VvSTS promoter activity by VvMYB14, gene reporter assay were performed using a dual luciferase assay system. Chardonnay cell suspensions transiently expressing VvSTS promoter-luciferase expression constructs showed a statistically significant increase in VvSTS promoter activity whenever cotransformed with VvMYB14 indicating a real interaction between this TF and transcription of VvSTS. Although statistically significant, the magnitude of the promoter activation observed with VvMYB14 was much lower than observed in previous studies investigating the activation of promoters of other phenylpropanoid pathway genes by other R2R3-MYB TFs (Bogs et al. 2007; Walker et al. 2007; Deluc et al. 2008). One reason for these results is that significant amounts of VvSTS promoter activity were detected in the negative controls i.e. in the absence of VvMYB14 (Control 1). This may result from the fact that the bombardment technique used to introduce the expression constructs of cells has activated the wound response pathway and this in turn has lead to an activation of the introduced VvSTS promoter construct by endogenous TFs. In order to determine if this “background” luciferase activity detected in the control treatment was real and not an artefact of the dual luciferase assay, a second negative control (Control 2) was included which involved bombardment with pGreenII-0800-Luc empty vector (i.e without any promoter fragment upstream the firefly luciferase) in presence of VvMYB14. Figures 5.1 and 5.2 indicate that the luciferase activity detected in the control 1 was much higher compared to the luciferase activity detected in the Control 2. This demonstrates that a component of the background level of luciferase activity observed in the absence of VvMY14 (control 1) is mediated by the VvSTS promoter. In an attempt to determine the site of interaction between VvMYB14 and the VvSTS36 promoter, a series of promoter-deletion constructs was generated and assayed using the same reporter system. Interestingly, a first deletion of about 800 bp in the 5’end of the promoter fragment led to an increase in the luciferase signal, suggesting the presence of

141

some form of repression linked to that region. Further deletions led to a progressive reduction in luciferase activity, with an activity that was still detectable with a 250bp promoter fragment. Stilbene synthase genes are characteristic of only a few plant species and are not present in the model organism A. thaliana. Moreover, stable transformation of grapevine for testing the function of genes such as VvMYB14 is complicated and time-expensive process. For these reasons, in order to obtain an in planta confirmation for the role of VvMYB14 in the control of the stilbene synthase pathway, an alternative strategy was developed using a grapevine hairy root system. Due to their fast growth rates and biochemical stability, ‘hairy root’ cultures represent a good experimental model in plant metabolic engineering and in the functional characterization of candidate genes (Shanks and Morgan 1999). VvMYB14 over-expressing and silenced hairy root lines were produced in order to monitor the effect of VvMYB14 on the transcript level of stilbene synthase genes. Unfortunately, no positive transgenic hairy root lines containing the VvMYB14 overexpression construct were obtained. This may not be surprising if VvMYB14 does control the production of resveratrol, because despite its protective role for plants, it is also phytotoxic if accumulated at high concentrations. On the contrary, a number of transgenic lines were obtained containing the VvMYB14-silencing construct in which endogenous VvMYB14 expression did appear to have been suppressed. The association between VvMYB14 and VvSTS36 expression was tested on transformed and untransformed hairy root lines in the early wound response and showed that those lines with the largest suppression of VvMYB14 transcription also had the lowest wound-induced induction of VvSTS36. This result provides the first preliminary confirmation of an effective role of VvMYB14 in the modulation of the stilbene biosynthesis in grape.

142

Chapter 6: General conclusions Plant stilbenes represent a relatively small group of phenylpropanoid compounds characterized by a diphenylethylene backbone and have been detected in only a few unrelated plant species, including pine, peanut, sorghum and grapevine (Morales et al., 2000). As with other phenylpropanoids, stilbenes and their biosynthetic enzymes accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals (Dixon and Paiva 1995). The structural enzyme responsible for the biosynthesis of stilbenes is known as stilbene synthase (STS), which produces resveratrol in a single enzymatic reaction utilizing p-coumaryl-CoA and three malonyl-CoA units as substrates (Schröder and Schröder 1990). The genome-wide analysis of the grapevine multigenic family performed in this Ph.D. project led to the identification of 36 VvSTS genes, that, based on amino acidic sequence, cluster in three principal subgroups designated as A, B1 and B2. The majority of these members (subgroup A and B2) are located on chromosome 16 whereas a few members (VvSTS1-4) are located on chromosome 10. mRNA-seq analysis of grapevine leaf discs treated under different biotic and abiotic stresses (wounding, UV-C exposure and downy mildew infection) revealed different behaviour of predicted VvSTS genes, with members showing a high response to all stresses (mainly those one belonging to the B2 family), members showing a moderate response (belonging to the B1 subgroup) and members characterised by the absence of a stress-response but showing a basal constitutive expression in un-stressed leaves (belonging to subgroup B1). The existence of VvSTS gene members encoding for truncated proteins, which, based on observation of Kodan et al. (2001) on pine STS, may exhibit distinct catalytic activities, together with the fact that VvSTS gene members more closely related to the VvCHS appear to show a different response to stress treatment in mRNA-seq data, raises questions about the existence of different enzymatic activity amongst members of the VvSTS gene family. A possible strategy for testing the catalytic activity of VvSTS gene members belonging to these different subgroups may be achieved by bacterial expression or expression of selected members in heterologous systems. Similar research is currently being undertaken by French research groups, who have expressed a number of different

143

VvSTS genes in a heterologous system to screen their enzymatic activity analysing their product accumulation (Philippe Hugueney, INRA Colmar, personal communication). Another interesting investigation may be a large-scale promoter analysis amongst all VvSTS gene members in order to identify cis element characteristic of subgroups showing different responses to stress treatments. For example undertake a comparison of the promoter regions of the highly responsive genes in subgroup B1 with genes in other subgroups to determine the basis for the observed differences in stress-induced response. The analysis of the whole R2R3-MYB TFs family in the same samples utilised for looking at the VvSTS behaviour in response to stresses, led to the identification of two R2R3-MYB TFs strongly co-expressed with VvSTS. These members have already been designated as VvMYB14 and VvMYB15 by Matus et al. (2008) based on their homology with R2R3-MYB TFs identified in Arabidopsis. This work focused on the characterization of VvMYB14, which showed the strongest induction upon stresses when compared with VvMYB15. Detailed quantitative real-time analysis in tissues treated with biotic and abiotic stresses, gene reporter assays to verify a relationship between VvMYB14 transcription and VvSTS induction and preliminary silencing experiments in grapevine hairy roots, all support a role for VvMYB14 in the transcriptional regulation of the VvSTS pathway. Future research will seek to validate the role for VvMYB14 in the regulation of the STS pathway through the generation of new transgenic VvMYB14-silenced and over-expression hairy roots cultures to confirm preliminary data obtained in this work on the interaction between VvMYB14 and VvSTS in vivo. Further research is also required to determine whether VvMYB14 interacts directly with the VvSTS promoter region or indirectly via another transcription factor. This could be investigated by looking at the physical interaction between the R2R3-MYB protein and the target promoter through band shift assays as used previously by Ban et al. (2007). Similar approaches should be used in order to investigate and verify a role also for VvMYB15, the other R2R3-MYB TF co-expressing with VvSTS in our analysis. The induction of the STS pathway in grapevine may be the results of the combined activity of both genes, or, in contrast, VvMYB14 and VvMYB15 may have different mechanisms of induction leading to the activation of VvSTS genes under different conditions.

144

This research has also raised a number of additional questions. For example, are VvMYB14 and VvMYB15 also involved in the regulation of upstream genes of the phenylpropanoid pathway such as PAL, C4H, as observed for other R2R3-MYB factors such as NtMYBJS1 and NtMYB2 which cluster in the same subgroup as VvMYB14/15. This question could be answered by doing dual reporter luciferase assays and co-bombardment experiments with promoters of genes belonging to the general phenylpropanoid pathway, such as PAL, C4H, 4CL. The role of the orthologous genes in Arabidopsis i.e. AtMYB13, AtMYB14 and AtMYB15 should be also investigated, as these have not been functionally characterized. Although Arabidopsis does not posses STS genes these R2R3-MYB TFs may be involved in the production of stress-related compounds or phytoalexins or in the activity of other genes belonging to phenylpropanoid pathway. In this case the analysis of Arabidopsis mutants could provide a starting point for future experiments, also considering the large number of scientific tools available for this model organism compared to the restricted set of tools available for grapevine. It will also be interesting to determine the possible role of jasmonates and ethylene in the control of VvSTS expression. Jasmonate and ethylene signals are involved in plant responses following wounding, chilling and biotic stresses. The fact that VvSTS and VvMYB14 both respond to JA treatment and to wounding (Chapter 4) led us to hypothesise that wound-induced VvSTS expression may be via JA induction of VvMYB14. This has been confirmed by qRT-PCR expression analysis using primers designed to grapevine orthologues of the JAZ2 and MYC2 genes, shown to be key genes in the jasmonate signalling pathway in Arabidopsis (data not reported in this thesis). Further analysis will be performed to determine the relative contribution of the JA and Ethylene pathway to the VvSTS activation and to determine if these two pathways activate specific VvSTSs or if their effects are additive and complementary. Finally, considering that different grapevine species are characterised by different degrees of susceptibility to fungal infection and are characterised by different levels of accumulation of stilbenes, we are interested in comparing the expression of selected VvSTS genes and VvMYB14/15 in V.vinifera genotypes showing different degrees of susceptibility and non-vinifera species characterized by resistance to downy mildew infection.

145

146

References Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, K. (2003). Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell. 15:63–78. Adrian M., Jeandet P., Bessis R., Joubert J.M. (1996). Induction of phytoalexins (resveratrol) synthesis in grapevine leaves treated with aluminium chloride (AlCl3). J. Agric. Food Chem. 44: 1979-1981. Adrian, M., Jeandet, P., Duillet-Breuil, A.C., Tesson, L. Bessis, R. (1997). Biological activity of resveratrol, a stilbenic compound from grapevines, against Botrytis cinerea, the causal agent for gray mold. J. Chem. Ecol. 23: 1689-1702. Adrian, M., Jeandet, P., Douillet-Breuil, A.C., Tesson, L., Bessis, R. (2000). Stilbene content of mature Vitis vinifera berries in response to UV-C elicitation. J. Agric Food Chem. 48:6103-6105. Adrian, M., Jeandet, P., Duillet-Breuil, A.C., Tesson, L. Bessis, R. (1997). Biological activity of resveratrol, a stilbenic compound from grapevines, against Botrytis cinerea, the causal agent for gay mold. J. Chem. Ecol. 23:1689-1702. Aharoni, A., De Vos, C.H.R., Wein, M., Sun, Z., Greco, R., Kroon, A., Mol, J.N.M., O’Connel, A.P. (2001). The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tabacco. Plant J. 28:319-332. Araki, S., Ito, M., Soyano, T., Nishihama, R., Machida, Y. (2004). Mitotic cyclins stimulate the activity of c-Myb-like factors for transactivation of G2/M phase-specific genes in tobacco. J Biol Chem. 279:32979–88.

147

Asada, K. (1994). Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol. 141:391-396. Austin, M.B., Bowmann, M.E., Ferrer, J.L., Schröder, J., Noel, J.P. (2004). An aldol switch discovered in stilbene synthases mediates cyclization specificity of type III polyketide synthases. Chem. Biol. 11:1179-1194. Austin, M.B., Noel, J.P. (2003). The chalcone synthase superfamily of type III polyketide synthases. Nat. Prod. Rep. 20:79-110 Bailey, J.A., Mansfield, J.W. (1982). Phytoalexins. New York: John Wiley and Sons. Bailey, P.C., Martin, C., Toledo-Ortiz, G., Quail, P.H., Huq, E., Heim, M.A., Jakoby, M., Werber, M., Weisshaar, B. (2003). Update on the basic helix-loop-helix transcription factor gene family in Arabidopsis thaliana. Plant Cell 15:2497-2502. Bais, A.J., Murphy, P.J., Dry, I.B. (2000) The molecular regulation of stilbene phytoalexin biosynthesis in Vitis vinifera during grape berry development. A. J. Plant Physiol. 27:425-433. Ban, Y., Honda, C., Hatsuyama, Y., Igarashi, M., Bessho, H., Moriguchi, T. (2007). Isolation and functional analysis of a MYB transcription factor gene that is a key regulator for the development of red coloration in apple skin. Plant Cell Physiol. 48:958970. Barnes, R.A., Gerber, N.N. (1955). The antifungal agent from osage orange wood. J. Am. Chem. Soc. 77:3259-3262. Baudry, A., Heim, M.A., Dubreucq, B., Caboche, M., Weisshaar, B., Lepiniec, L. (2004). TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J. 39: 366–80.

148

Baur, J.A., Sinclair, D.A. (2006). Therapeutic potential of resveratrol: the in vivo evidence. Nat. Rev. Drug Discov. 5:493-506. Behladj, A., Telef, N., Cluset, S., Bouscaut, J., Corio-Costet, M.F., Merillon, J.M. (2008a). Ethepphon elicits protection against Erisyphe necator in grapevine. J. Agr. Food Chem. 56:5781-5787. Behladj, A., Telef, N., Saigne, C., Cluzet, S., Barrieu, F., Hamdi, S., Merillon, J.M. (2008b). Effect of methyl jasmonate in combination with carbohydrates on gene expression of PR proteins, stilbene and anthocyanin accumulation in grapevine cell cultures. Plant Physiol. Biochem. 46:493-499. Beñová, B., Adam, M., Onderková, K., Králowsky, J., Krajícek, M. (2008). Analysis of selected stilbenes in Polygonum cupsidiatum by HPLC coupled with Courl Atrray detection. J. Sep. Sci. 31:2404-2409. Bogs, J., Jaffé, F.W., Takos, A.M., Walker, A.R., Robinson, S.P. (2007). The grapevine trnscription factor VvMYBPA1 regulates proanthocyanidin synthesis during fruit development. Plant Physiol. 143:1347-1361. Borevitz, J.O., Xia, Y.J., Blount, J., Dixon, R.A., Lamb, C. (2000) Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12:2383-2393. Boudet, A.M. (2007). Evolution and current status of research in phenolic compounds. Phytochemistry. 68:2722-2735. Braun, E.L., Grotewold, E. (1999). Newly discovered plant c-myb-like genes rewrite the evolution of the plant myb gene family. Plant Physiol. 121:21–24.

149

Breuil, A.C., Jeandet, P., Adrian, M., Chopin, F., Pirio, N., Meunier, P., Bessis, R. (1999). Characterization of a pterostilbene dehydrodimer produced by laccase of Botrytis cinerea. Phytopathology. 89:298-302. Bryant, J.P., Gregory, D.W., Reichardt, P.B., Lewis, V.E., McCarthy, M.C. (1983). Pinosylvin methyl ether deters snowshoe hare feeding on green alder. Science 222:10231025. Burns, J., Yokota, T., Ashiara, H., Lean, M.E.J., Crozier, A. (2002). Plant food and herbal sources of resveratrol. J. Agric. Food Chem. 50:3337-3340. Calabrese, J.C., Jordan, D.B., Boodhoo, A., Sariaslani, S., Vannelli, T. (2004). Crystal structure of phenylanine ammonia lyase: multiple helix dipoles implicated in catalysis. Biochemistry. 43:11403-11416. Calderon, A.A., Zapata, J.M., Pedreno, M.A., Munoz, R., Rods Barcelo, A. (1992). Levels of 4-hydroxystilbene oxidizing superoxidases related to constitutive disease resistance in in vitro-cultured grapevines. Electrophoresis. 11:507-508. Casati, P., Walbot, V. (2004). Crosslinking of ribosomal proteins to RNA in maize robosomes by UV-B and its effect on translation. Plant Physiol. 136:3319-3332. Chen, Y., Zhang, X., Wu, W., Chen, Z., Gu, H., Qu, L-J. (2008). Overexpression of the Wounding-Responsive Gene AtMYB15 Activates the Shikimate Pathway in Arabidopsis. J. Integr. Plant Biol. 48:1084-1095. Chiron, H., drouet, A., Lieutier, F., Payer, H.D., Ernst, D., Sandermann, H. (2000). Gene induction of stilbene biosynthesis in Scots pine in response to ozone treatment, wounding and fungal infection. Plant Physiol. 124:865-872.

150

Clausen, T.P., Reichardt, P.B., Bryant, J.P. (1986). Pinosylvin and pinosylvin methyl ether as feeding deterrents in green alder. J. Chem. Ecol. 12:2117-2131. Conrath, U., Beckers, G.J., Flors, V., Garcia-Agustin, P., Jakab, G., Mauch, F., Newman, M.A., Pieterse, C.M., Poinssot, B., Pozo, M.J., Pugin, A., Schaffrath, U., Ton, J., Wendehenne, D., Zimmerli, L., Mauch-Mani, B. (2006). Priming: getting ready for battle, Mol. Plant Microbe Interact. 19:1062-1071. Counet, C., Callemien, D., Collin, S. (2006). Chocolate and cocoa: new sources of transresveratrol and trans-piceid. Food Chem. 98:649-657. Czemmel, S., Stracke, R., Weisshaar, B., Cordon, N., Harris, N.N. Walker, A.R., Robinson, S.P., Bogs, J. (2009). The grapevine R2R3-MYB transcription Factor VvMYBF1 regulates Flavonol synthesis in developing grape berries. Plant Physiol. 151:1513-1530. Davies, K.M., Schwinn, K.E. (2003). Transcriptional regulation of secondary metabolism. Functional Plant Biology. 30:913-925. Deluc, L., Barrieu, F., Marchive, C., Lauvergeat, V., Decendit, A., Richard, T., Carde, J.P., Merillon, J.M., Hamdi, S. (2006). Characterization of a grapevine R2R3-MYB transcription factor that regulates the phenylpropanoid pathway. Plant Physiol. 140:499511. Deluc, L., Bogs, J., Walker, A.R., Ferrier, T., Decendit, A., Merillon, J.M., Robinson, S.P., Barrieu, F. (2008). The transcription factor VvMYB5b contributes to the regulation of anthocyanin and proanthocyanidin biosynthesis in developing grape berries. Plant Physiol. 147:2041-2053. Denekamp, M., Smeekens, S.C. (2003). Integration of wounding and osmotic stress signals determines the expression of the AtMYB102 transcription factor gene. Plant Physiol. 132:1415–1423.

151

D'Introno, A., Paradiso, A., Scoditti, E., D'Amico, L., De Paolis, A., Carluccio, M.A., Nicoletti, I., DeGara, L., Santino, A., Giovinazzo, G. (2009). Antioxidant and antiinflammatory properties of tomato fruits synthesizing different amounts of stilbenes. Plant Biotech. J. 7:422-429. Ding, Z., Li, S., An, X., Liu X., Qin, H., Wang, D. (2009). Transgenic expression of MYB15 confers enhanced sensitivity to abscisic acid and improved drought tolerance in Arabidopsis thaliana. J. Genet. Genomics 36:17-29. Dixon, R. A., Paiva, N. L. (1995). Stress-induced Phenylpropanoid metabolism. Plant Cell 7:1085-1097. Do, C.B., Cormier, F. (1991). Effects of high ammonium concentrations on growth and anthocyanin formation in grape (Vitis vinifera L) cell-suspension cultured in a production medium. Plant Cell Tiss. Org. 27:169-174. D'Onofrio, C., Cox, A., Davies, C., Boss, P.K. (2009). Induction of secondary metabolism in grape cell cultures by jasmonates. Funct. Plant Biol. 36:323-338. Douillet-Breuil, A.C., Jeandet, P., Adrian, M., Bessis, N. (1999). Changes in the phytoalexin content of various Vitis spp. in response to ultraviolet C elicitation. J. Agric. Food Chem. 47: 4456-4461. Du, H., Zhang, L., Liu, L., Tang, X.F., Yang, W.J., Wu, Y.M., Huang, Y.B., Tang, Y.X. (2009). Biochemical and molecular characterization of plant MYB transcription factor family. Biochemistry-Moscow 74:1-11. Duthie, G., Crozier, A. (2000). Plant derived phenolic antioxydants. Curr. Opin. Lipidol. 11:43-47. Emiliani, G., Fondi, M., Fani, R., Gribaldo, S. (2009). A horizontal gene transfer at the

152

origin of phenylpropanoid metabolism: a key adaptation of plants to land. Biology Direct 4:7. Espley, R.V., Hellens, R.P., Putterill, J., Stevenson, D.E., Kutty-Amma, S., Allan, A.C. (2007). Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J. 49: 414-427 Faccoli, M., Schlyter, F. (2007). Conifer phenolic resistance markers are bark beetle antifeedant semiochemicals. Agric. Forest Entomol. 9:237-245. FAO: http://www.fao.org/ Ferrer, J.L. Jez, J.M., Bowmann, M.E., Dixon, R.A., Noel, J.P. (1999). Structure of chalcone synthase and the molecular basis of plant polyketide biosynthesis. Phytochemistry. 62:271-286. Ferrer, J.L., Austin, M.B., Stewart, C., Noel, J.P. (2008). Structure and function of enzymes involved in the biosynthesis of phenylpropanoids. Plant Physiol. Biochem. 46:356-370. Fiorentino, A., D’Abrosca, B., Pacifico, S., Izzo, A., Letizia, M., Esposito, A., Monaco, P. (2008). Potential allelopatic affects of stilbenoids and flavonoids from leaves of Carex distachya Desf. Biochem. Systemat. Ecol. 36:691-698. Fliegmann, J., Schröder, G., Schanz, S., britsch, L., Schröder, J. (1992).Molecular analysis of chalcone and dihydropinosylvin synthase from Scots pine (Pinus sylvestris) and differential regulation of these and related enzyme activities in stressed plants. Plant. Mol. Biol. 18:552-557. Foyer, C.H., Lelendais, M., Kunert, K.J. (1994). Photooxidative stress in plants. Physiol. Plantarum. 92:696-717.

153

Fornara, V., Onelli, E., Sparvoli, F., Rossoni, M., Aina, R., Marino, G., Citterio, S. (2008). Localization of stilbene synthase in Vitis vinifera L. during berry development. Protoplasma 233: 83-93. Fung R.W.M., Gonzalo, M., Fekete, C., Kovacs, L.G., He, Y., Marsh, E., McIntyre, L.M., Schachtman, D.P., Qiu, W. (2008). Powdery mildew induces defense-oriented reprogramming of the transcriptome in a susceptible but not in a resistant grapevine. Plant Physiol. 146:236-249. Gàlis, I., Simek, P., Narisawa, T., Sasaki, M., Horiguchi, T., Fukuda, H., Matsuoka, K. (2006). A novel R2R3 MYB transcription factor NtMYBJS1 is a methyl jasmonatedependent regulator of phenylpropanoid- conjugate biosynthesis in tobacco. Plant J. 46:573-592. Gatto, P., Vrhovsek, U., Muth, J., Segala, C., Romualdi, C., Fontana, P., Prueafer, D., Stefanini, M., Moser, C., Mattivi, F., Velasco, R. (2008). Ripening and genotype control stilbene accumulation in healthy grapes. J. Agric. Food Chem. 56:11773-11785. Giovinazzo, G., D’Amico, L., Paradiso, A., Bollini, R., Sparvoli, F., De Gara, L. (2005). Antioxidant metabolite profiles in tomato fruits constitutively expressing the grapevine stilbene synthase gene. Plant Biothecnol. J. 3:57-69. Gleave, A.P. (1992)

A versatile binary vector system with a T-DNA organisational

structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol. Biol. 20:1203-1207. Goff, S.A, Cone, C.K., Chandler, V.L. (1992). Functional analysis of the transcriptional activator encoded by the maize B gene, evidences for a direct functional interaction between two classes of regulatory proteins. Genes Dev. 6:864-75.

154

Gomez-Maldonado, J., Avila, C., Torre, F., Canas, R., Canovas, F.M., Campbell, M.M. (2004). Functional interactions between a glutamine synthetase promoter and MYB proteins. Plant J. 39:513-526. Hall.

D.,

De

Luca,

V.

resveratrol/hydroxicinnamic

(2007). acid

Mesocarp

localization

glucosyltransferase

of

of

a

Concord

bi-functional grape

(Vitis

lambrusca). Plant J. 49:579-591. Hall, C., Yu, O. (2008). Potential for metabolic engineering of resveratrol biosynthesis. Trends Biotechnol. 26:77-81. Harborne, J. B. (1999). The comparative biochemistry of phytoalexins induction in plants. Biochem. Syst. Ecol. 27:335-367. Hart, J.H. (1981). Role of phytostilbenes in decay and disease resistance. Ann. Rev. Phytopathol. 19:437-45 Hart, J., Shrimpton, D.M. (1979). Role of stilbenes in resistance of wood to decay. Symp. Phytopathology 69:1138-1143. Hathway, D.E. (1962). The use of hydroxystilbene compounds as taxonomic tracers in the genus Eucalyptus. Biochem. 83:80-84. He, T., Wang, C., Pan, X., Yang, H., Lu, G. (2008). The non-linear optical properties and photoinduced anisotropy of a novel stilbene-containing fluorinated polymide. Dyes Pigments. 82:47-52. Hellens, R.P., Allan, A.C., Friel, E.N., Bolitho, K., Grafton, K., Templeton, M.D., Karunairetnam, S., Gleave, A.P., Laing, W.A. (2005). Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1:13.

155

Helliwell, C., Waterhouse P. (2003) Constructs and methods for high-throughput gene silencing in plants. Methods 30:289-295. Higginson, T., Li, S.F., Parish, R.W. (2003). AtMYB103 regulates tapetum and trichome development in Arabidopsis thaliana. Plant J. 35:177–192. Higo, K., Ugawa, Y., Iwamoto, M., Korenaga, T. (1999). Plant cis-acting regulatory DNA elements (PLACE) database. Nucl. Acid Res. 27:297-300. Hillis, W.E. (1972). Properties of eucalypt woods of importance to the pulp and paper industries. Appita. 26:113-122. Hipskind, J.D., Paiva, N.L. (2000). Constitutive accumulation of resveratrol-glucoside in transgenic alfalfa increases resistance to Phoma medicaginis. Mol. Plant Microbe Interact. 13:551-562. Hwang, E.I., Kaneko, M., Ohnishi, Y., Horinouchi, S. (2003). Production of plant specific flavanones by Escherichia coli containing an artificial gene cluster. Appl. Environ. Microbiol. 69:2699-2706. Ito, M., Araki, S., Matsunaga, S., Itoh, T., Nishihama, R. Machida, Y., Doonan, J.H., Watanabe, A. (2001). G2/M-phase–specific transcription during the plant cell cycle is mediated by c-Myb–Like transcription factors. Plant Cell 13:1891–1905. Jaillon O., Aury J.M., Noel B., Policriti A., Clepet C., Casagrande A., Choisne N., Aubourg S., Vitulo N., Jubin C., Vezzi A., Legeai F., Hugueney P., Dasilva C., Horner D., Mica E., Jublot D., Poulain J., Bruyere C., Billault A., Segurens B., Gouyvenoux M., Ugarte E., Cattonaro F., Anthouard V., Vico V., Del Fabbro C., Alaux M., Di Gaspero G., Dumas V., Felice N., Paillard S., Juman I., Moroldo M., Scalabrin S., Canaguier A., Le Clainche I., Malacrida G., Durand E., Pesole G., Laucou V., Chatelet P., Merdinoglu D.,

156

Delledonne M., Pezzotti M., Lecharny A., Scarpelli C., Artiguenave F., Pe M.E., Valle G., Morgante M., Caboche M., Adam-Blondon A.F., Weissenbach J., Quetier F., Wincker P., French-Italian Public Consortium for Grapevine Genome Characterization. (2007). The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature. 449: 463-467. Jayatilake, G.S. Jayasuriya, H., Lee, E.S., Koonchanok, N.M., geahlen, R.L., Ashendel, C.L., McLaughlin, J.L., Chang, CJ. (1993). Kinase inhibitors from Polygonum cupsidiatum. J. Nat. Prod. 56:1805-1810. Jeandet P., Bessis R., Gautheron B. (1991). The production of resveratrol

(3,5,4’-

trihydroxystilbene) by grape berries in differential developmental stages. Am. J. Enol.Vitic. 42:41-46. Jeandet, P., Bessis, R., Sbaghi, M., Meunier, P., Trollat, P. (1995). Resveratrol content of wines of different ages: relationship with fungal disease pressure in the vineyard. Am. J. Enol. Vitic. 46:1-4. Jeandet P, Douillt-Breuil AC, Bessis R, Debord S, Sbaghi M, Adrian M (2002). Phytoalexins from the vitaceae: biosynthesis, phytoalexin gene expression in transgenic plants, antifungal activity, and metabolism. J. Agric. Food Chem. 10:2731-2741. Jez, J.M., Noel, J.P. (2000). Mechanism of chalcone synthase: pKa of the catalytic cysteine and the role of conserved histidine in a plant polyketide synthase. J. Biol. Chem. 275:39640-39646. Jez, J.M., Ferrer, J.L., Bowmann, M.E., Austin, M.B., Schröder, J., Dixon, R.A., Noel, J.P. (2001b). Structure and mechanism of chalcone synthase-like polyketide synthases. J. Ind. Microbiol. Biotechnol. 27:393-398.

157

Kenrick P., Crane PR. (1997). The origin and early evolution of plants on land. Nature. 387:33-39. Kiempnauer, K.H., Gonda, T.J., Bishop, J.M. (1982). Nucleotide sequence of the retroviral leukemie gene v-myb and it’s cellular progenitor c-myb: the architecture of a trnsduced oncogene. Cell 31:453-464. Kobayashi, S., Ishimaru, M., Hiraoka, K., Honda, C. (2002). Myb-related genes of the Kyoto grape (Vitis labruscana) regulate anthocyanins biosynthesis. Planta. 215:924-933. Kodan, A., Kuroda, H., Sakai, F. (2002). A stilbene synthase from Japanese red pine (Pinus densiflora): implications for phytoalexins accumulation and down-regulation of flavonoid biosynthesis. Proc. Natl. Acad. Sci. USA. 99:3335-3339. Koes, R., Verweij, W., Quattrocchio, F. (2005). Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 10:236-242. Korhammer, S., Reniero, F., Mattivi, F. (1995). An oligostilbene from Vitis roots. Phytochem. 38:1501-1504. Kranz, H.D., Denekamp, M., Greco, R., Jin, H., Leyva, A., Meissner, R.C., Petroni, K., Urzainqui, A., Bevan, M., Martin, C., Smeekens, S., Tonelli, C., Paz-Ares, J., Weisshaar, B. (1998). Towards functional characterization of the members of the R2R3MYB gene family from Arabidopsis thaliana. Plant J. 16:263–276. Kuc, J. (1995). Phytoalexins, stress metabolism, and disease resistance in plants. Annu. Rev. Phytopathol. 33:275-297. Landrault, N., Larronde, F., Delaunay, J.C., Castagnino, C., Vercauteren, J., Merillon, J.M., Gasc, F., Cros, G., Teissedre, P.L. (2002). Levels of stilbene oligomers and astilbin in

158

French varietal wines and in grapes during noble rot development. J. Agric. Food Chem. 50: 2046-2052. Langcake, P. (1981). Disease resistance of Vitis spp. and the production of stress metabolites resveratrol, ε-viniferin, α-viniferin and pterostilbene. Physiol. Plant Pathol. 18:213-226. Langcake, P., McCarty, W.V. (1979). The relationship of resveratrol production to infection of grapevine leaves by Botrytis cinerea. Vitis 18:244-253. Langcake , P., Pryce, R.J. (1976). The production of resveratrol by Vitis vinifera and other members of the Vitaceae as a response to infection or injury. Physiol. Plant Pathol. 9:7786. Langcake, P., Pryce, R.J. (1977). A new class of phytoalexins from grapevines. Experentia. 33:151-152. Lanz, T., Tropf, S., Marner, F.J., Schröder, J., Schröder, G. (1991). The role of cysteines in polyketide synthases - site directed mutagenesis of resveratrol and chalcone synthases, 2 key enzymes in different plant-specific pathways. - J. Biol. Chem. 266: 9971-9976. Lee, M.M., Schiefelbein, J. (1999). WEREWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning. Cell 99:473–483. Lee, M.M., Schiefelbein, J., (2001). Developmentally distinct MYB genes encode functionally erquivalent proteins in Arabidiopsis. Development 128:1539-1546. Levadox, L. (1956). Les populations sauvages de Vitis vinifera L.. Ann. Amelior. Plantes. 6:59-118.

159

Lieutier, F., Savard, D., Brignolas, F., Picron, V., Yart, A., Bastien, C., Jay-Allemand, C. (1996). Changes in phenolic metabolites of Scots pine phloem induced by Ophiostoma brunneo-ciliatum, a bark beetle-associated fungus. Eur. J. For. Pathol. 26:145-158. Liswidowati, Melchior, F., Hohmann, F., Schwer, B., Kindl, H. (1991). Induction of stilbene synthase by Botrytis cinerea in cultured grapevine cells. Planta 183:307-314. Lipsick, J.S. (1996). One billion years of Myb. Oncogene 13:223-235. MacDonald, M.J., D’Cunha, G.B. (2007). A modern view of phenylanine ammonia lyase. Biochem. Cell Biol. 85:273-282. Maeda, K., Kimura, S., Demura, T., Takeda, J., Ozeki, J. (2005). DcMYB1 acts as a transcriptional activator of the carrot phenylalanine ammonia-lyase gene (DcPAL1) in response to elicitor treatment, UV-B irradiation and the dilution e ect. Plant Mol. Biol. 59:739-752. Matus, J.T., Aquea, P., Arce-Johnson, P. (2008). Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes. BMC Plant Biol. 8:83. Melchior, F., Kindl, H. (1991). Coordinate and elicitor-dependent expression of stilbene synthase and phenylanine ammonia-lyase genes in Vitis cv. Optima. Arch. Biochem. Biophys. 288:552-557. Mehrtens, F., Kranz, H., Bednarek, P., Weisshaar, B. (2005) The Arabidopsis transcription factor MYB12 is a flavonol-specific regulator of phenylpropanoid biosynthesis. Plant Physiology 138:1083-1096 McGovern, P. (2003). Ancient wine: The search for the origin of viticulture. In: Princeton Univ. Press. , Princeton, New Jersey, 365 p.

160

Mizuno, C. S., Schrader, K.K., Rimando, A.M. (2008). Algicidial activity of stilbene analogues. J. Afric. Food Chem. 56:9140-9145. Moyano, E., Martinez-Garcia, J.H., Martin, C. (1996). Apparent rendundancy in myb gene function provides gearing for the control of flavonoid biosynthesis in antirrhinum flowers. Plant Cell. 8:1519-1532. Morales, M., Barcelo, A.R. (1997). A basic peroxidase isoenzyme from vacuoles and cell walls of Vitis vinifera. Phytochemistry. 45:229–232. Morales, M., Ros Barcelo, A., Pedreno, M.A. (2000) Plant stilbenes: recent advances in their chemistry and biology. In: Hemantaranjan A (ed.) Advances in Plant Physiology. Vol. 3 (pp. 39-70) Scientific Publishers, Jodhpur, India Morales, M., Bru, R., Garcia-Carmona, F., Ros Barcelo, A., Pedreno, M.A. (1998). Effect of dimethyl-β-cyclodextrins on resveratrol metabolism in Gamay grapevine cell cultures before and after inoculation with Xylophylus ampelinus. Plant Cell Tissue Organ Cult. 53:179-187. Munro, A.W., Girvan, H.M., McLean, K.J. (2007). Variation on a (t)heme-novel mechanisms, redox partners and catalytic functions in the cytochrome p450 superfamily. Nat. Prod. Rep. 24:585-609. Nagaoka, S., Takano, T. (2003). Salt tolerance-related protein STO binds to a Myb transcription factor homologue and confers salt tolerance in Arabidopsis. J Exp Bot. 54:2231-2237. Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M., Lepiniec, L. (2000) The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12:1863-1878

161

Nesi, N., Jond, C., Debeaujon, I., Caboche, M., Lepiniec, L. (2001). The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 13:2099-2114. Newman, LJ., Perazza, D.E., Juda, L., Campbell, M.M. (2004). Involvement of the R2R3MYB, AtMYB61, in the ectopic lignification and dark-photomorphogenic components of the det3 mutant phenotype. Plant J. 37:239-50. Nicholas, K.B., Nicholas H.B. Jr., Deerfield, D.W. (1997). GeneDoc: Analysis and visualization of genetic variation. EMBNEW.NEWS 4:14. Nicoletti, I., De Rossi, A., Giovinazzo, G., Corradini, D. (2007). Identification and quantification of stilbenes in fruit of transgenic tomato plants (Lycopersicon esculentum Mill.) by reverse phase HPLC with photodiode array and mass spectrometry detection. J. Agric. Food Chem. 55:3304-3311. Noel, J.P., Austin, M.B., Bomati, E. K. (2005). Structure-function relationship in plant phenylpropanoid biosynthesis. Curr. Opin. Plant Biol. 8:249-253. Noel, J.P., Dixon, R.A., Pichersky, E., Zubieta, C., Ferrer, J.L. (2003). Structural, functional, and evolutionary basis for methylation of plant small molecules. Recent Adv. Phytochem. 37:37-58. Ogata, K., Morikawa, S., Nakamura, H., Hojo, H., Yoshimura, S., Zhang, R., Aimolo, S., Ametani, Y., Hirata, Z., Sarai, A., Ishii, S. and Nishimura, Y. (1995). Comparison of the free and DNA-complexed forms of the DNA-binding domain of c-MYB. Nature Struct. Biol. 2:309–320. Olmo, H.P. (1976). Grapes. 294-298. In N.W.Simmonds (ed.): Evolution of crop plants. Longman, London, UK. Pp 294-298.

162

Paz-Ares, J., Ghosal, D., Wienand, U., Peterson, P., Seadler, H. (1987). The regulatory locus c1 of Zea mays encoder a protein with homology to myb oncogene products and with structural similarities to transcriptional activators. EMBO J. 6:3553-3558. Pezet, R., Gindro, K., Viret, O., Spring, J.L. (2004). Glycosylation and oxidative dimerization of resveratrol are respectively associated to sensitivity and resistance of grapevine cultivars to downy mildew. Physiol. Mol. Plant Phathol. 65:297-303. Pezet, R., Perret, C., Jean-Denis, J.B., Tabacchi, R., Gindro, K., Viret, O. (2003). δviniferin, a resveratrol dehydrodimer: one of the major stilbenes synthesized by grapevine leaves. J. Agric. Food Chem. 51:5488-5492. Polesani, M., Bortesi, L., Ferrarini, A., Zamboni, A., Fasoli, M., Zadra, C., Lovato, A., Pezzotti, M., Delledonne, M., Polverari, A. (2010). General and species specific responses to downy mildew infections in a susceptible (Vitis vinifera) and a resistant (Vitis riparia) grapevine species. BMC Genomics 11:117 Preising-Müller, R., Schwekendiek, A., Brehm, I., Reif, H.J., Helmut, K. (1999). Characterization of a pine multigenic family containing elicitor responsive stilbene synthase genes. Plant Mol. Biol. 39:221-229. Purkayashta, R.P. (1995). Progress in phytoalexin research during the past 50 years. In Handbook of Phytoalexin Metabolism and Action; Daniel, M., Purkayashta, R.P. Eds.; Marcel Dekker: New York, pp 1-39. Quattrocchio, F., Wing, J., van der Woude, K., Souer, E., de Vetten, N., Mol, J., Koes, R. (1999). Molecular analysis of the anthocyanin2 gene of Petunia and its role in the evolution of flower color. Plant Cell. 11:1433-1444.

163

Ramsay, N.A., Walker, A.R., Mooney, M., Gray, J.C. (2003). Two basic helix-loop-helix genes (MYC-146 and GL3) from Arabidopsis thaliana can activate anthocyanins biosynthesis in a white flowered Matthiola incana mutant. Plant Mol. Biol. 52:679-688. Raiber, S., Schröder, G., Schröder, J. (1995). Molecular and enzymatic characterization of two stilbene synthases from Eastern white pine (Pinus strobus). A single Arg/His difference determines the activity and the pH dependence of the enzyme. FEBS Lett. 361:299-302. Romero, I., Fuertes, A., Benito, M.J., Malpical, J.M., Leyva, A., Paz-Ares, J. (1998). More than 80 R2R3-MYB regulatory genes in the genome of Arabidopsis thaliana. Plant J. 14:273-284. Romero-Pérez, A.I., Ibern-Gomez, M., Lamuela-Raventos, R.M., de la Torre-Boronat, M.C. (1999). Piceid, the major resveratrol derivative in grape juices. J. Agric. Food Chem. 47:1533-1536. Romero-Pérez, A.I., Ibern-Gomez, M., Lamuela-Raventos, R.M., de la Torre-Boronat, M.C. (1999). Piceid, the major resveratrol derivative in grape juices. J. Agric. Food Chem. 47:1533-1536. Romero-Péerez A.I., Lamuela-Raventos, R.M., Andreas-Lacueva, C., de la Torre-Boronat, M.C. (2001). Method for the quantitative extracion of resveratrol and piceid isomers in grape berry skins. Effect of powdery mildew on the stilbene content. J. Agric. Food Chem. 49:210-215. Ros Barcelo, A., Zapata, J.M., Calderon, A.A. (1996). A basic peroxidase isoenzyme, marker of resistance against Plasmopara viticola in grapevines, is induced by an elicitor from Trichoderma viride in susceptible grapevines. J. Phytopathol. 144:309-313

164

Rosemann, D., Heller, W., Sandermann, H. (1991). Biochemical plant responses to ozone: II induction of stilbene biosynthesis in Scots pine (Pinus sylvestris L.) seedlings. Plant Physiol. 97:1280-1286. Rosler, J., Krekel, F., Amrhein, N., and Schmid, J. (1997). Maize phenylanine ammonialyase has tyrosine ammonia-lyase activity. Plant Physiol. 113:175-179. Roupe, K.A., Remsberg, C.M., Yanez, J.A., Davies, N.M. (2006). Pharmacometrics of stilbenes: seguing towards the clinic. Curr. Clin. Pharmacol. 1:81-101. Ruhmann, S., Treutter, D., Fritsche, S., Briviba, K., Szankowsky, I. (2006) Piceid (resveratrol glucoside) synthesis in stilbene synthases transgenic apple fruit. J. Agric. Food Chem. 54:4633-4640. Sablowski, R.W.M., Moyano, E., Culianez-Macia, F.A., Schuch, W., Martin, C., Bevan, M. (1994). A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes. EMBO J. 13:128-137. Saeed, A.I., Bhagabati, N.K., Braisted, J.C., Liang, W., Sharov, V., Howe, E.A., Thiagarajan, M., White J.A., Quackenbush, J. (2006). TM4 microarray software suite. Methods in Enzymology. 411:134-93. Sambrook, J., Fritsch, E.F., Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd Ed., Cold Spring Harbor Laboratory Press, N.Y. Sbaghi, M., Jeandet, P., Faivre, B., Bessis, R., Fournioux, J.C. (1995). Development of methods using phytoalexin (resveratrol) assessment as a selection criterion to screen grapevine in vitro cultures for resistance to gray mold (B. cinerea). Euphytica 86:41-47. Schnee, S., Viret, O., Gindro, K. (2008). Role of stilbenes in the resistance of grapevine to powdery mildew. Physiol. Mol. Plant Phatol. 72:128-133.

165

Schöppner, A., Kindl, H. (1984). Purification and properties of a stilbene synthase induced cell suspension of peanut. J. Biol. Chem. 259:6806-6811. Schöppner, A., Kindl, H. (1988). Purification and properties of a stilbene synthase from induced cell suspension cultures of peanut. J. Biol. Chem. 259:6806-6811. Schröder, G., Brown, J.W.S., Schröder, J. (1988). Molecular analysis of resveratrol synthase cDNA, genomic clones and relationship with chalcone synthase. Eur. J. Biochem. 172:161-169. Schröder, J., Schröder, G. (1990). Stilbene and chalcone synthases: related enzymes with key function in plant-specific pathways. Z. Naturforsch. 45c:1-8. Schultz, T.P., Boldin, W.D., Fisher, T.H., Nicholas, D.D., Mcmurtrey, K.D., Pobanz, K. (1992). Structure-fungicidal properties of some 3- and 4-hydroxilated stilbenes and bibenzyl analogues. Phytochemistry 31:3801-3806. Seigler, D.S. (2006). Basic pathways for the origin of allelopatic compounds. In:M.J. Reigosa Roger, M.J. Reigosa, N. Pedrol, L. Gonzalés (Eds.), Allelopathy: a physiological process with ecological implications, Springer, pp: 11-18. Shanks, J.V., Morgan, J. (1999). Plant ‘hairy root’ colture. Curr. Opin. Biotechnol. 10:151155. Shibutani, S., Samejima, M., Doi, S. (2004). Effect of stilbenes from bark of Picea glehnii (Sieb. et Zucc) and their related compounds against feeding behaviour of Reticulitermes speratus (Kolbe). J. Wood Sci. 50:439-444.

166

Shin, B., Choi, G., Yi, H., Yang, S., Cho, I., Kim, J., Lee, S., Paek, N.C., Kim, J.H., Song, P.S., Choi, G. (2002). AtMYB21, a gene encoding a flower-specific transcription factor, is regulated by COP1. Plant J. 30:23-32. Shomura, Y., Toryama, I., Suh, D.Y., Xiang, T., Kita, A., Sankawa, U., Miki, K. (2005). Crystal structure of stilbene synthase from Arachis ipogaea. Proteins 60:803-806. Sigrist, C.J.A., Cerutti, L., de Castro, E., Lagendijk-Genevaux, P.S., Bulliard, V., Bairoch, A., Hulo, N. (2010). PROSITE, a protein domain database for functional characterization and annotation. Nucleic Acids Res. 38:161-166. Simini, B. (2000). Serge renaud, from French paradox to Cretan miracle. The Lancet. 355:48 Slaughter, A.R., Hamiduzzaman, M.M., Gindro, K., Neuhaus, J.-M., Mauch-Mani, B. (2008). Beta-aminobutyric acid-induced resistance in grapevine against downy mildew: involvement of pterostilbene. Eur. J. Plant Pathol. 122:185-195. Sobolev, V.S., Guo, B.Z., Holbrook, C.C., Lynch, R.E. (2007). Interrelationship of phytoalexin production and disease resistance in selected peanut genotypes. J. Agric. Food Chem. 55:2195-2200. Solano, R., Nieto, C., Avila, J., Cañas, L., Diaz, I., Paz-Ares, J. (1995). Dual DNA bindig specificity of petal epidermis-specific MYB transcription factor (MYB-Ph3) from Petunia hybrida. EMBO J. 14:1773-1784. Sotheeswaran, S., Suphaty, V. (1993). Distribution of resveratrol oligomers in plants. Phytochemistry. 32:1083-1092.

167

Sparvoli, F., Martin, C., Scienza, A., Gavazzi, G., Tonelli, C. (1994). Cloning and molecular analysis of structural genes involved in flavonoid and stilbene biosynthesis in grape (Vitis vinifera L.). Plant Mol. Biol. 24:743-755. Steiner-Lange, S., Unte, U.S., Eckstein, L., Yang, C., Wilson, Z.A., Schmelzer, E., Dekker, K., Saedler, H. (2003). Disruption of Arabidopsis thaliana MYB26 results in male sterility due to non-dehiscent anthers. Plant J. 34: 519-528. Stracke, R., Werber, M., Weisshaar, B. (2001). The R2R3-MYB gene family in Arabidopsis. Curr. Opin. Plant Biol. 4:447-456. Stracke, R., Ishihara, H., Barsch, G.H.A., Mehrtens, F., Niehaus, K., Weisshaar, B. (2007). Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in in different parts of the Arabidopsis thaliana seedling. Plant Journal. 50:660-677. Sugimoto, K., Takeda, S., Hirochika, H. (2000). MYB-related transcription factor NtMYB2 induced by wounding and elicitors is a regulator of the tobacco retrotransposon Tto1 and defense-related genes. Plant Cell. 12:2511-2527. Takaota, M. (1939). Resveratrol, a new phenolic compound from Veratrum grandiflorum (translation of Japanese title). Nippon Kagaku Kaishi. 60:1090-1100. Takos, A.M., Jaffe, F.W., Jacob, S.R., Bogs, J., Robinson, S.P., Walker, A.R. (2006). Light induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiology. 142:1216-1232. Torregrosa, L., Verries, C., Tesniere, C. (2002). Grapevine (Vitis vinifera L.) promoter analysis by biolistic-mediated transient transformation of cell suspensions. Vitis 41: 2732.

168

Torres, P., Avila, J.G., Romo de Vivar, A., Garcia, A.M., Marin, J.C., Aranda, E., Cespedes, C.L. (2003) Antioxidant and insect growth regulatory activities of stilbenes and extracts from Yucca pericolosa. Phytochemistry. 64:463-473. Tropf, S., Lanz, T., Rensing, S.A., Schröder, J., Schröder G. (1994). Evidences that stilbene synthases have developed from chalcone synthases several times in the course of evolution. J. Mol. Evol. 38:610-618. Untergasser, A., Nijveen, H., Rao, X., Bisseling, T. Geurts, R, Leunissen J.A.M. (2007). Primer3Plus, an enhanced web interface to Primer3. Nucl.Acid Res. 35: 71-74. Velasco R, Zharkikh A, Troggio M, Cartwright DA, Cestaro A, Pruss D, Pindo M, Fitzgerald LM, Vezzulli S, Reid J, Malacarne G, Iliev D, Coppola G, Wardell B, Micheletti D, Macalma T, Facci M, Mitchell JT, Perazzolli M, Eldredge G, Gatto P, Oyzerski R, Moretto M, Gutin N, Stefanini M, Chen Y, Segala C, Davenport C, Dematte L, Mraz A, Battilana J, Stormo K, Costa F, Tao Q, Si-Ammour A, Harkins T, Lackey A, Perbost C, Taillon B, Stella A, Solovyev V, Fawcett JA, Sterck L, Vandepoele K, Grando SM, Toppo S, Moser C, Lanchbury J, Bogden R, Skolnick M, Sgaramella V, Bhatnagar SK, Fontana P, Gutin A, Van de Peer Y, Salamini F, Viola R (2007) A high quality draft consensus sequence of the genome of a heterozygous grapevine variety. PLoS ONE 2:e1326 Versari, A., Parpinello, G.P., Tornielli, G.B., Ferrarini, R., Giulivo, C. (2001). Stilbene compounds and stilbene synthase expression during ripening, wilting and UV treatment in grape cv. Corvina. J. Agric. Food Chem. 92:729736. Waffo-Teguo, P., Descendit, A., Deffieux, G., Vercauteren, J., Mérillon, J.M. (1996). Trans-resveratrol-3-O-β-glucoside (piceid) in cell-suspension cultures of Vitis vinifera. Phytochemistry. 42:1591-1593.

169

Walker, A.R., Lee, E., Bogs, J., McDavid, D.A.J., Thomas, M.R., Robinson, S.P. (2007). White grapes arose through mutation of two similar and adjacent regulatory genes. Plant J. 49:772-785. Wang, S. (1977). Heartwood extractives of Maclura pomifera and their role in decay resistance. Ph. D. thesis. Michigan State Univ., East Lansing. 50 pp. Wang, W., Tang, K., Yang, H.R., Wen, P.F., Zhang, P.,Wang, H.L., Huang, W.D. (2010). Distribution of resveratrol and stilbene synthase in young grape plants (Vitis vinifera L. cv. Cabernet Sauvignon) and the effect of UV-C on its accumulation. Plant Physiol. Biochem. 48:142-152. Waterhouse, A.L., Lamuela-Raventos, R.M. (1994). The occurrence of piceid, a stilbene glucoside, in grape berries. Phytochemistry. 37:571-573. Waterhouse, A.M., Procter, J.B., Martin, D.M.A, Clamp, M., Barton, G. J. (2009). Jalview Version 2 - a multiple sequence alignment editor and analysis workbench. Bioinformatics 25:1189-1191. Waters, E. (2003). Molecular adaptation and the origin of land plants. Mol. Phylogenet. Evol. 29:456-463. Weston, K. (1998). Myb proteins in life, death and differentiation. Curr. Opin. Genet. Dev. 8:76-81. Wiese, W., Vornam, B., Krause, E., Kindl, H. (1994). Structural organization and differential expression of three stilbene synthase genes located on a 13 kb grapevine DNA fragment, Plant Mol. Biol. 26:667-677. Wolberger, C. (1999). Multiprotein-DNA complexes in transcriptional regulation. Annu. Rev. Biophys. Biomol. Struc. 28:29-56.

170

Yanhui, C., Xiaoyuan, Y., Kun, H., Meihua, L., Jigang, L., Zhaofeng, G., Zhiquiang, L., Yunfei, Z., Xiaoxiao, W., Xiaming, Q., Yunping, S., Li, Z., Xiaohui, D., Jingchu, L., Xing-Wang, D., Zhangliang, C., Hongya, G., Li-Jia, Q. (2006). The MYB transcription factor superfamily in Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol. Biol. 60:107-124. Yu, C.K., Lam, C.N., Springob, K., Schmidt, J., Chu, I.K., Lo, C. (2005). Constitutive accumulation of cis-piceid in transgenic Arabidopsis overexpressing a sorghum stilbene synthase. Plant Cell Physiol. 47:1017-1021. Yu, C.K., Springob, K., Schmidt, J. Nicholson, R.L., Chu, I.K., Yip, W.K., Lo, C. (2005). A stilbene synthase gene (SbSTS1) is involved in host and nonhost defence responses in sorghum. Plant Physiol. 138:393-401. Yu, O., Jez, J.M. (2008). Natures’s assembly line: biosynthesis of simple phenylpropanoids and polyketides. The Plant J. 54:750-762. Zamboni A., Minoia, L., Ferrarini, A., Tornielli, G.B., Zago, E., Delledonne, M., Pezzotti, M. (2008). Molecular analysis of post-harvest withering in grape by AFLP transcriptional profiling. J. Exp. Bot. 59: 4145-4159 Zamboni, A., Gatto, P., Cestaro, A., Pilati, S. Viola, R., Mattivi, F., Moser, C., Velasco, R. (2009). Grapevine cell early activation of specific responses to DIMEB, a resveratrol elicitor. BMC Genomics 10:363. Zhang, F., Gonzalez, A., Zhao, M.Z., Payne, C.T., Lloyd, A. (2003). A network of redundant bHLH proteins functions in all TTG1-dependent pathways of Arabidopsis. Development. 130:4859-4869. Zimmermann, I.M., Heim, M.A., Weisshaar, B., Uhrig, J.F. (2004). Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-

171

like BHLH proteins. Plant Journal. 40:22-34.

172

Chapter 7: Chloroplast Microsatellite Markers to Assess Genetic Diversity and Origin of an Endangered Italian Grapevine Collection Marzia Salmaso,1* Alessandro Vannozzi,1 and Margherita Lucchin1

1) Department of Environmental Agronomy and Crop Production, Agripolis, University of Padova, Viale Università 16, 35020 Legnaro (Padova), Italy. *Corresponding author (email: [email protected]; tel: +39 049 8272817; fax: +39 049 8272839)

American Journal of Enology and Viticulture; 2010 61,4:551-556

Abstract Genetic diversity was evaluated at nine chloroplast microsatellite (cpSSR) loci in 16 grapevine cultivars indigenous to northeastern Italy and seven international cultivars. The aim was to understand the origin and genetic relatedness of local varieties for the development of an adequate strategy of future germplasm conservation. The 21 alleles detected constituted eight different haplotypes, three of which have never been observed and should be considered typical of northeastern Italy. This collection has a higher haplotype diversity (0.71) than that detected in other regions, thus representing a unique genetic resource to be conserved. The distribution of haplotype frequency also suggests the existence of independent domestication events.

Key words grape varieties, chloroplast microsatellites, genetic diversity, domestication

173

7.1 Introduction Molecular markers applied to chloroplast genome have been increasingly used to study population genetic structure and evolution, gene flow and phylogenetic relationships in many plants species (Angioi et al. 2009; Lumaret et al. 2009). When compared to the nuclear genome, the chloroplast organelle genome shows different patterns of genetic differentiation, because of its uniparental inheritance in tha majority of plants and in particular in grape, the object of this study (Arroyo-García et al. 2002) and the absence of recombination events (Xu 2005). This generally allows chloroplast microsatellite variants to accumulate in an uniparental lineage providing information on the level and distribution of genetic diversity at regional and individual level (Baneh et al. 2007). Due to this particularity, information from chloroplast genome is suitable to better define events governing and driving plant populations and their evolutionary processes (Provan et al. 2001) and to give a contribution towards a more precise determination of pedigree relationships among crop varieties. Analysis of the chloroplast microsatellite (cpSSR) markers thus provides complementary information on plant population dynamics to that obtained from the nuclear genome. In recent years, chloroplast microsatellite markers have therefore been developed to investigate the origin and diffusion of several fruit tree species, such as olive (Besnard et al. 2002; Breton et al. 2006), hazelnut (Boccacci et al. 2006) and grapevine (Arroyo-García et al. 2002; Arroyo-García et al. 2006; Imazio et al. 2006). The Eurasian grapevine (Vitis vinifera L.) is the most widely-cultivated and economically important fruit crop in the world (Vivier & Pretorius 2002). Despite a relatively small number of varieties are considered of commercial importance, the totality of accessions represent an important genetic, environmental and cultural heritage. The wish to preserve the genetic variability of V. vinifera, as well as revealing offspring relationships, synonymy, homonymy and the need to clarify the dynamics of grapevine diffusion and domestication on an international, national and even regional scale has led, in the last decade, to the extensive use of microsatellite markers. In particular, several interesting papers have been published on polymorphisms at chloroplastic microsatellites loci to investigate the origin of grapevine, the breeding history of local cultivars, and to shed light on the existence of different sites of domestication (Arroyo-García et al. 2002; Grassi et al. 2003; ArroyoGarcía et al. 2006; Imazio et al. 2006). In Italy, as in other Mediterranean countries,

174

centuries of natural and human selection have led to the generation of a huge number of indigenous cultivars (Martin et al. 2003; Imazio et al. 2006), most of which are typical of restricted areas and constitute an inestimable cultural and territorial heritage that should be preserved and protected. In 2005, we started evaluating the biodiversity in native grapevine varieties in order to safeguard the remaining north-eastern Italian indigenous grapevine germplasm, as a starting point for a future conservation strategy. A group of local varieties typical of different areas in the northeast of Italy, some not yet included in the Italian Catalogue of Cultivated Grapevine Varieties and at risk of extinction due to a lack of interest in their cultivation and propagation, was evaluated by Salmaso et al. (2008). The analysis of three chloroplastic microsatellites (ccmp3, ccmp5, ccmp10) in these varieties revealed several polymorphisms (average gene diversity at the three loci was He= 0.449), although with a lower average gene diversity than that estimated for nuclear loci (He= 0.628). In this paper we report the analysis of the genetic diversity in most of the germplasm previously considered, extending the analysis by adding six new chloroplast loci. The aim of this research was to obtain an exhaustive survey of the genetic diversity and differentiation pattern of an endangered north-eastern Italian grapevine collection, aimed at the setting up of an adequate strategy for future germplasm conservation. Characterization of grapevine cultivars into haplotype groups may be an important initial step in evaluating how much genetic diversity is represented in these genotypes and contribute towards understanding the origin and genetic relatedness among the grapevine varieties.

7.2 Matherials and metods 7.2.1 Plant material and DNA extraction Polymorphisms at nine chloroplast SSR loci were analyzed in a sample of 16 local varieties of Vitis vinifera provided by two private collections near the Euganian Hills (Padova) and one near Breganze (Vicenza), in north-eastern Italy. Seven international certified cultivars (Barbera VCR433, Cabernet franc VCR10, Cabernet sauvignon R5, Chardonnay R8, Merlot R3, Pinot noir VCR20 and Traminer R1), supplied by a certified commercial nursery, were also analyzed as reference cultivars. The list showing all

175

analyzed cultivars and respective growing areas is given in Table 7.1. Total DNA was extracted from young leaves using the Nucleon PhytoPure Genomic DNA Extraction Kit (GE Healthcare Life Sciences). Samples were resuspended in sterile water after RNase digestion (10 μg/μl RNase A). Table 7.1 - List of grapevine cultivars and cultivation areas. Parenthesis list the number of different accessions assayed. a(n): number of different accessions assayed. a=varieties not registered in the Italian Catalogue of Cultivated Varieties. b =Varieties present in the Vitis International Variety Catalogue (http://www.vivc.bafz.de/index.php). c= hybrid with a non-vinifera Vitis species. Local Varieties

Source

Reference Varieties Source

Agostana neraa

Euganean Hills

Barbera b

Certified nursery

Cabernet Colli Euganeia

Euganean Hills

Cabernet franc b

Certified nursery

Corbinella a

b

Euganean Hills

Cabernet sauvignon b (2)

Certified nursery

Corbinona a

b

Euganean Hills

Chardonnay b

Certified nursery

Euganean Hills

Merlot b (2)

Certified nursery

Gruaja a

Breganze (Vicenza)

Pinot nero b

Certified nursery

Marzemina bianca b

Euganean Hills

Traminer b

Certified nursery

Marzemina nera b (2)

Euganean Hills

Marzemina nera bastarda a

Euganean Hills

Negrara veronese a

Euganean Hills

Pattaresca a

Euganean Hills

Gatta a

176

b

b

Pignola b

Euganean Hills

Raboso Piave b (8)

Euganean Hills

Raboso veronese b (4)

Euganean Hills

Schiavetta doretta a

Euganean Hills

Tintoria c

Euganean Hills

7.2.2 cpSSR analysis Six chloroplastic microsatellite marker loci were analyzed using universal primers designed for dicotyledonous angiosperms: ccSSR5, ccSSR9, ccSSR14, ccSSR23 (Chung and Staub 2003), NTCP-8 and NTCP-12 (Bryan et al. 1999). Three additional cpSSR loci, ccmp3, ccmp5 and ccmp10 (Weising and Gardner 1999), previously tested in the same cultivar collection (Salmaso et al. 2008), were included in the data analysis to complement and complete the datasets. Genomic sequences were routinely amplified in 20 μl PCR reactions containing 12 ng of template DNA, 2.5 μmol/L MgCl2, 0.4 μmol/L of forward primer and 2.4 μmol/L of reverse primer, 4 μmol/L dNTPs, 1X Taq polymerase reaction buffer and 0.5U of Taq DNA polymerase (BiotaqTM DNA polymerase, Bioline, London, UK). Amplifications were carried out in a Biometra TGradient thermocycler initially set at 94 °C for 3 min, followed by 30 cycles of 30 sec denaturation at 94 °C, 30 sec at the appropriate annealing temperature and a 45 sec extension at 72 °C. After cycling, PCR reactions were incubated at 72 °C for 5 min. The optimal annealing temperature for each primer pair was initially established by performing gradient PCR: 57 °C for ccSSR5; 59 °C for ccSSR9, 57 °C for NTCP12; 55 °C for ccSSR14, ccSSR23 and NTCP8. Amplification products (10μl) were analyzed by electrophoresis on 1X TAE agarose gels (2% w/v) and visualized by ethidium bromide staining. Forward primers were labeled with ABI fluorescent dyes at the 5’end and PCR products were analyzed by capillary electrophoresis with an ABI Prism 310 Genetic Analyzer (Applied Biosystems, Foster City, California). Finally, chromatograms were analyzed using Gene Mapper 4.0 software

(Applied

Biosystems, Monza, Italy).

7.2.3 cpSSR data analysis Chromatograms were scored as genotypes based on the allele composition. The chloroplast genome may be considered a single locus and all sequence variation interpreted as giving rise to different haplotypes. Allelic and haplotype frequencies were directly estimated at nine cpSSR loci. Haplotype frequencies were measured as the percentage of individuals sharing the same haplotype in each group, for all the varieties and for indigenous and international varieties. Gene diversity (He) was calculated with the formula

177

n

H e = 1− ∑ ( 2i ) (Weir 1996), with n representing the number of alleles and pi the frequency i=1

of the ith allele in the population. Haplotype diversity was calculated in the same manner as gene diversity, with n and pi referring to haplotypes. A chlorotype median network was constructed using the program Network v.4.5 (Bandelt et al. 1999).

7.3 Results and Discussion An endangered collection of 16 local grapevine cultivars from north-eastern Italy, together with seven international varieties as standard, were analyzed to assess their genetic diversity at nine chloroplast loci and understand the phylogenetic relationships. Despite the low rate of mutation that characterizes the chloroplast genome, all loci were found to be polymorphic among 23 grapevine cultivars displaying a total of 21 alleles, but no varietyspecific alleles were found in the population. Two different size variants were detected at the loci ccmp3, ccmp5, ccSSR5, ccSSR9, NTCP-8 and NTCP-12 and three at the loci ccmp10, ccSSR14, ccSSR23, according to Arroyo-García et al. (2006). The allele size, frequency and gene diversity values for each cpSSR locus are reported in Table 2. ArroyoGarcía et al. (2006) reported a fourth allele at loci ccSSR14 and ccSSR23, but it was observed only in species of the genus Vitis other than Vitis vinifera, thus confirming our results. At the six new loci examined, ccSSR5, ccSSR9, ccSSR14, ccSSR23, NTCP-8 and NTCP-12, the most frequent fragments in both indigenous and international samples, were the 254, 165, 202, 281, 249, and 110 bp alleles respectively, the frequency of which ranged from 64% (alleles 254 and 110) to 82% (allele 165). Gene diversity for nine loci varied from 0.297 to 0.483, values that were close to those observed in Vitis vinifera (ArroyoGarcía et al. 2002) and in other species (Bryan et al. 1999; Ishii and McCouch 2000). The highest genetic diversity value (He = 0.483) was shown by locus ccmp10, in agreement with Weising and Gardner (1999) and Arroyo-García et al. (2002), who assayed ccmp microsatellite markers in both grapevine and in different species. The varieties ‘Corbinona’ and ‘Corbinella’ were identical at all the loci. These two indigenous varieties have been demonstrated to be identical also at the nuclear SSR level except for one locus (Salmaso et al. 2008); for this reason we considered them as synonymous for the gene pool analysis. ‘Cabernet Colli Euganei’ is a variety cultivated

178

since 1870 in the small area of Lispida (Euganean Hills) to produce the homonymous wine. From previous nuclear SSR analysis (Salmaso et al. 2008), this variety was proven to be a mutant of the French cultivar Carmenère. For this reason, ‘Cabernet Colli Euganei’ was also excluded from the gene pool analysis of the local grapevine germplasm.

Table 7.2 - Allele size and frequency and gene diversity values for the nine polymorphic chloroplast SSR loci in 22 grapevine varieties and in 13 native northeastern Italian varieties (Corbinella and Corbinona were considered synonymous; Tintoria and Cabernet Colli Euganei were not included in the native varieties) (H: expected heterozygosity). Locus ccmp3 ccmp5 ccmp10

ccSSR5 ccSSR9 ccSSR14

ccSSR23

NTCP-8 NTCP-12 Average (SD)

Allele size 102 103 100 101 107 108 109 254 255 165 166 201 202 203 280 281 282 248 249 110 111 177.95(71.67)

22 varieties Allele freq. (%) He 36 0.463 64 64 0.463 36 18 0.483 68 14 64 0.463 36 82 0.297 18 18 0.430 72 9 18 0.430 73 9 32 0.434 68 64 0.463 36 42.9 (24.67) 0.436(0.055)

13 native varieties Allele freq. (%) He 31 0.426 69 69 0.426 31 23 0.461 69 8 69 0.426 31 77 0.355 23 23 0.355 77 23 77

0.355

23 77 69 31 47.4 (25.29)

0.355 0.426 0.398(0.043)

As the chloroplast genome is non recombinant, there is the expectation that variability in one locus is correlated with that of another (Provan et al. 2001), so length variants at each locus were combined into haplotypes. Combinations of all different alleles at the nine analyzed loci in the 22 accessions resulted in a total of eight different haplotypes with one of the plastotypes (haplotype I corresponding to haplotype D in Arroyo-García et al. 2006) shared by 50% of individuals (Table 7.3).

179

Table 7.3 – Haplotypes and their frequency defined on the basis of 21 polymorphic alleles found at 9 chloroplastic SSR loci (letters correspond to the plastotype nomenclature of Arroyo-García et al., 2006) with listo of varieties (outgroup cultivars listed in italic font). a Corbinella, Tintoria, and Cabernet Colli Euganei have been excluded. b Haplotypes I and IV are identical to haplotypes D and E (of Arroyo-García et al., 2006), exept for a difference of a base in alleles at loci NTCP8 and ccSSR5, respectively. c Barbera, Cabernet franc, Cabernet sauvignon, Cabernet Colli Euganei, Marzemina bianca, Marzemina nera, Negrara veronese, Pignola, Raboso Piave, Raboso veronese, Traminer.

Allele size (bp)

Haplotype

ccmp3

ccmp5

I (Dc)

103

100

108

254

165

202

II (A)

102

101

107

255

166

201

Frequency

NTCP-8

NTCP-12

22 varaietes (%)

13 native varaieties (%)

7 international varieties (%)

281

249

110

50.00

46.1

57.1

280

248

111

18.18

23.1

14.3

ccmp10 ccSSR5 ccSSR9 ccSSR14 ccSSR23

Varieties a

group of 11 varieties

‘Corbinona'/'Corbinella', 'Gatta', 'Pattaresca', Pinot Noir

III (C )

102

101

109

255

165

203

282

248

111

9.09

0

28.6

IV (Ec)

103

100

109

255

165

202

281

249

110

4.55

7.7

0

‘Agostana N.’

V

102

100

108

254

165

202

281

249

110

4.55

7.7

0

‘Marzemina Nera Bastarda'

VI

103

100

108

254

165

202

281

249

111

4.55

7.7

0

‘Gruaja'

VII

103

101

108

254

165

202

281

249

110

4.55

7.7

0

‘Schiavetta Doretta'

VIII (B)

102

101

108

255

165

202

281

248

111

4.55

0

0

‘Tintoria'

180

Chardonnay, Merlot

Only three plastotypes (I, II and III, corresponding to D, A and C) had overall global frequency greater than 5%, according to the results of Arroyo-García et al. (2006) for Vitis vinifera sativa samples. The third major plastotype (III), infrequent on the Italian peninsula, was detected only in the international varieties Chardonnay and Merlot and was totally absent in the indigenous germplasm. On the contrary, the haplotype I we observed in half of the native varieties, was also the most frequent haplotype (D) found on the Italian peninsula by Arroyo-García et al. (2006). Haplotype II (A) of Corbinella-Corbinona, Gatta and Pattaresca, was the second most frequent in the indigenous germplasm (23%), while in the international cultivars it was detected only in Pinot noir. This suggests a distinct origin of domestication for the Corbinella-Corbinona, Gatta and Pattaresca with respect to Marzemina nera, Marzemina bianca, Negrara veronese, Pignola and the Raboso group. The first three varieties were among the most widely cultivated wine varieties in the same area of the province of Padova before the Second World War. Instead, Negrara veronese is a variety no longer grown to produce wine, but in the past it was sometimes confused with Raboso varieties (Calò et al. 2004). Marzemino is a famous red wine produced from the Marzemina nera variety and, according to Salmaso et al. (2008), Marzemina bianca was inferred to be the result of a spontaneous cross between Marzemina nera and an unknown parent, probably occurring in the 16th century. Furthermore, the indigenous varieties of plastotype I belong to a different cluster of varieties, except for Gatta, with respect to plastotype II if nuclear genome is considered (Salmaso et al. 2008). Plastotype VIII was found only in Tintoria, a putative hybrid with American grapevine species. This result agrees with those of Arroyo-García et al. (2006) who detected it (plastotype B) in sylvestris samples and in many non-vinifera species. Haplotype IV, corresponding to haplotype E of Arroyo-García et al. (2006), was found only for Agostana nera variety. Three new varietyspecific haplotypes, never previously found in other studies, were singled out in three indigenous varieties: haplotype V for Gruaja, haplotype VI for Marzemina nera bastarda and haplotype VII for Schiavetta doretta. Gruaja is a variety cultivated in north-eastern Italy since the 18th century, but nowadays it is grown on very few farms in Vicenza province (Breganze area). Marzemina nera bastarda and Schiavetta doretta are ancient varieties no longer cultivated to produce wine as they have been replaced by other more productive international cultivars. Even at the nuclear level both varieties have shown the lowest

181

similarity with the other indigenous varieties (Salmaso et al. 2008). These three rare plastotypes should be considered typical of north-eastern Italy, therefore the three endangered varieties should be the priority target for a conservation strategy aimed at preserving grapevine biodiversity and preventing genetic erosion. Many studies have demonstrated that there is a multigeographic contribution of wild species in the regional grapevine genepools harboring a high genetic diversity and heterozygosity in cultivated grapevine varieties growing in different regions (Grassi et al. 2003; Martin et al. 2003; Imazio et al. 2006). Haplotype diversity for the native varieties was 0.71, higher than the value observed for Greek, Spanish (Arroyo-García et al. 2002) and Iranian wild grapevines (Baneh et al. 2007). These results suggest a possible influx of genes from local wild V. sylvestris populations to the regional gene pool of Vitis vinifera cultivated varieties. According to Grassi et al. (2003), the existence of a secondary domestication centre for this native germplasm is hypothesized. A chloroplast median network between chloroplast microsatellites was built to describe plastotype relationships based on the number of mutational differences (Figure 7.1). The construction of haplotype networks assumes that microsatellites add or subtract repeat units with equal probability and, in most cases, one repeat unit at a time (stepwise mutation model) indicating the minimum number of evolutionary events separating the haplotypes (Goldstein et al. 1995). This network analysis has the potential to reveal some of the haplotype structure resulting from ancestral relationships and the non-random distribution of mutations among lineages (Clark et al. 2000). Therefore alleles of similar size could have a history of fewer intervening mutations and contain information about time since divergence from a common ancestor. According to Arroyo-García et al. (2006), our results show that the three most frequent haplotypes (I, II and III) correspond to the three major haplotype lineages, with haplotype VIII occupying a central position. The variety-specific haplotypes of the native germplasm (haplotype IV, V, VI and VII) were closely associated to haplotype I. The intermediate position of haplotype VIII to all the others is in agreement with its proposed ancestral position (Arroyo-García et al. 2006). Four putative haplotypes, corresponding to intermediate evolutionary steps, were not detected in our dataset (black circle in Figure 7.1). This situation suggests a common genetic base for the indigenous and international varieties investigated (Salmaso et al. 2008). The presence of haplotype I in

182

half of the inteernational and a indigennous varietties indicatees a comm mon origin of these accesssions, probbably from the primarry centre off domesticattion in the Near East or in the Trannscaucasian region, in agreement a w historiical informaation (Zohaary and Hop with pf 1993). On thhe other haand, the natiive germplaasm has beeen demonstrrated to posssess a high h level of haplootype diverssity with many m unique alleles. The hypothesiis of a seconndary domeestication centrre for the naative germpplasm can onnly be confi firmed by fuurther investtigations co oncerning the genetic g relattionship bettween thesee materials and a wild V. vinifera acccessions grrowing in the same area too verify the presence p off common haplotypes. h

Figu ure 7.1 - A summary network n of plastotypess. Diameter of circle iss proportion nal to the haplootype frequuency. Num mbers on thee lines conn necting haplotypes inddicate the nu umber of nucleeotide diffeerences acccumulatedlcc in the torrso numberrs of nucleootide the difference d accum mulated is always onee). Haplotyppes presentt only in inndigenous vvarieties aree red, the haplootype present only in internationaal varieties is i green. Haaplotypes I and IV are identical to haaplotypes D and E of (A Arroyo-Garrcía et al. 20 006), exceptt for a diffeerence of on ne base at loci NTCP-8 N and ccSSR5, respectively r y.

183

7.4 Conclusions Maintenance of genetic variability is the main objective of conservation programs. We underline the usefulness of chloroplast SSR markers to study the origin and genetic diversity of an indigenous grapevine collection. The results showed that this collection has a higher genetic diversity than that detected in other regions and many chloroplast haplotypes, some of them found for the first time, so this collection represents an interesting and unique genetic resource to be conserved. In particular, the highest priority should be assigned to the endangered varieties Gruaja, Marzemina nera bastarda and Schiavetta doretta for conservation of grapevine biodiversity. Furthermore, our data could suggest a separate domestication of grapevine in north-eastern Italy with the contribution of wild grapevine to the regional gene pool. Further analyses of wild populations of the same area, using chloroplast and nuclear markers, would improve our understanding of the origin and spread of grapevine cultivars.

184

7.5 References

Angioi, S.A., F. Desiderio, D. Rau, E. Bitocchi, G. Attene, R. Papa. (2009). Development and use of chloroplast microsatellites in Phaseolus spp. and other legumes. Plant Biol. 11:598-612. Arroyo-García, R., F. Lefort, M.T. de Andrés, J. Ibáñez, J. Borrego, N. Jouve, F. Cabello, and J.M. Martinez-Zapater. (2002). Chloroplast microsatellites polymorphisms in Vitis species. Genome. 45:1142-1149. Arroyo-García, R., et al. (2006). Multiple origins of cultivated grapevine (Vitis vinifera L. ssp. sativa) based on chloroplast DNA polymorphisms. Mol. Ecol.. 15:3707-3714. Bandelt, H.J., P. Foster, and A. Rohl. (1999). Median-Joining networks for inferring intraspecific philogenies. Mol. Biol. Evol.. 16:37-48. Baneh, D.H., S.A. Mohammadi, M. Labra, A. Nazemieh, F. de Mattia, M. Mardi. (2007). Chloroplast microsatellites markers to assess genetic diversity in wild and cultivated grapes of Iran. Pak J Biol Sci. 10(11):1855-1859. Besnard, G., B. Khadari, P. Baradat, A. Bervillé. (2002). Olea europaea (Oleaceae) phylogeography based on chloroplast DNA polymorphism. Theor. Appl. Genet. 103:1353-1361. Boccacci, P., A. Akkar, and R. Botta. (2006). DNA typing and genetic relations among European hazelnut (Corylus avellana L.) cultivars using microsatellites markers. Genome. 49:598-611. Breton, C., M. Tersac, A. Berville’. (2006). Genetic diversity and gene flow between the wild olive (oleaster, Olea europaea L.) and the olive: several Plio-Pleistocene refuge zones in the Mediterranean basin suggested by simple sequence repeats analysis. J. Biogeogr. 33:1916-1928.

185

Bryan, G.J., J. McNicoll, G. Ramsay, R.C. Meyers, W.S. De Jong. (1999). Polymorphic simple sequence repeat markers in chloroplast genomes of Solanaceous plants. Theor. Appl. Genet. 99:859-867. Calò, A., S. Cancellier, E. Celotti, M. Coletti, A. Costacurta, M. Crespan, A. Dalla Serra, P. Giacobbi, F. Mattivi, E. Michelet, S. Soligo, A. Stocco. (2004). Recupero, conservazione e valorizzazione del germoplasma viticolo veneto. Azienda Regionale Veneto Agricoltura. Legnaro, Padova, Italy. Clark, C.M., T.M. Wentworth, D.M.O. Malley. (2000). Genetic discontinuity revealed by chloroplast microsatellites in eastern North American Abies (Pinaceae). Am. J. Bot. 87:774-778 . Goldstein, D.B., A.R. Linares, L.L. Cavalli Sforza, M.W. Feldman. (1995). An evaluation of genetic distances for use with microsatellites loci. Genetics. 139:463-471. Grassi, F., M. Labra, S. Imazio, R. Ocete Rubio, O. Failla, A. Scienza, and F. Sala. (2003). Evidence of a secondary grapevine domestication centre detected by SSR analysis. Theor. Appl. Genet. 107:1315-1320. Imazio, S., M. Labra, F. Grassi, A. Scienza, O. Failla. (2006). Chloroplast microsatellites to investigate the origin of grapevine. Genet. Resour. Crop Evol. 53:1003-1011. Ishii, T., and S.R. McCouch. (2000). Microsatellity and microsynteny in the chloroplast genomes of Oryza and eight other Graminaceae species. Theor. Appl. Genet. 100:12571266. Lumaret, R., and R. Jabbour-Zahab. (2009). Ancient and current gene flow between two distantly related Mediterranean oak species, Quercus suber and Q. ilex. Ann Bot. 104:725-36.

186

Martin, J.P., J. Borrego, F. Cabello, and M.J. Ortiz. (2003). Characterization of Spanish grapevine cultivar diversity using sequence-tagged microsatellite site markers. Genome. 46:10-18. Provan, J., W. Powell, and P.M. Hollingsworth. (2001). Chloroplast microsatellites: new tools for studies in plant ecology and evolution. Trends. Ecol. Evol. 16:142-147. Salmaso, M., R. Dalla Valle, and M. Lucchin. (2008). Gene pool variation and phylogenetic relationships of an indigenous northeast Italian grapevine collection revealed by nuclear and chloroplast SSRs. Genome. 51:838-855. Vivier, M.A., and I.S. Pretorius. (2002). Genetically tailored grapevines for the wine industry. Trends Biotechnol.. 20:472-478. Weir, B.S. (1996). Genetic Data Analysis II. Sinhauer Associates, Inc., Sunderland, Mass. Weising, K., and R. Gardner. (1999). A set of conserved PCR primers for analysis of simple sequence repeat polymorphism in chloroplast genomes of dicotyledonous angiosperms. Genome. 42:9-19. Xu, J. (2005). The inheritance of organelle genes and genomes: patterns and mechanisms. Genome. 48:951-958. Zohary, D., and M. Hopf. (1993). Domestication of Plants in the Old World: The Origin and the Spread of Cultivated Plants in West Asia, Europe, and the Nile Valley, 3rd ed. Oxford University, New York.

187

188

Appendix 1: Novel vectors characterization of VvMYB14 TF

used

for

functional

Novel vectors developed at the CSIRO Plant Industry center and used in this project are showed below. pART27uGFP was used for VvMYB14 over-expression in hairy roots, whereas pCLB130NH was used for VvMYB14 silencing in the same system.

189

 

190