World J Microbiol Biotechnol (2010) 26:1195–1200 DOI 10.1007/s11274-009-0288-8
ORIGINAL PAPER
Utilization of dibenzothiophene as sulfur source by Microbacterium sp. NISOC-06 Moslem Papizadeh • Mohammad Roayaei Ardakani Gholamhossein Ebrahimipour • Hossein Motamedi
•
Received: 19 October 2009 / Accepted: 14 December 2009 / Published online: 25 December 2009 Ó Springer Science+Business Media B.V. 2009
Abstract Oil-polluted soils were sampled from National Iranian South Oil Company (NISOC) for isolation and screening of C–S and not C–C targeted Dibenzothiophene (DBT) degrading microorganisms. Microbacterium sp. NISOC-06, a C–S targeted DBT degrading bacterium, was selected and its desulfurization ability was studied in aqueous phase and water-gasoline biphasic systems. The 16srRNA gene was amplified using universal eubacteriaspecific primers, PCR product was sequenced and the sequence of nearly 1,500 bp 16srDNA was studied. Based on Gas Chromatography results Microbacterium sp. NISOC-06 utilized 94.8% of 1 mM DBT during the 2 weeks of incubation. UV Spectrophotometry and biomass production measurements showed that the Microbacterium sp. NISOC-06 was not able to utilize DBT as a carbon source. There was no accumulation of phenolic compounds as Gibb’s assay showed. Biomass production in a biphasic system for which DBT-enriched gasoline was used as the sulfur source indicated the capability of Microbacterium sp. NISOC-06 to desulfurize gasoline. Keywords Dibenzothiophene Desulfurization 16srRNA phylogenetic identification Oil polluted soils Microbacterium
M. Papizadeh (&) M. R. Ardakani H. Motamedi Department of Biology, Faculty of Sciences, Shahid Chamran University, Ahvaz, Iran e-mail:
[email protected] G. Ebrahimipour Department of Biology, Faculty of Sciences, Shahid Beheshti University, Tehran, Iran
Introduction Sulfur is the third most abundant element in crude oil. Combustion of sulfur rich fuels releases high amounts of sulfur oxides into the atmosphere and triggers the acid rains. Sulfurous fuels also decrease the efficiency of exhaust catalyst systems (Gupta and Roychoudhury 2005; Soleimani et al. 2007; Song and Ma 2003). Low amount of mineral sulfur is detected in fossil fuels and most of the sulfur is in the form of thiophenes in which sulfur is bonded covalently as C–S bonds (Garc0 ia-Cruz et al. 2008; Kilbane 2006). The diesel and fuel oil contain significant amounts of benzothiophenes and dibenzothiophenes (DBTs), which are considerably more difficult to remove by commercially available desulfurization processes (Grossman et al. 1999). International agencies have imposed stringent limitations on sulfur content of fuels that necessitated the use of more efficient refining and desulfurization technologies (Grossman et al. 2001; Gupta and Roychoudhury 2005; Kilbane 2006). Hydrodesulfurization (HDS) is the current industrial desulfurization technology that imposes high pressure (150–3,000 lb/in2) and temperatures (290–455°C) on fuels to hydrogenise the sulfur moiety and production of H2S and desuphurized fuels (Grossman et al. 1999). Regarding high amounts of energy needed to break C–S bond in thiophenes, DBT family which is recalcitrant to HDS and the main fraction of the fuel sulfur content remains undesulfurized (Garc0 ia-Cruz et al. 2008). Thus, DBT has been as a model compound in desulfurization studies (Okada et al. 2002a, b). Considering progress of biological reactions in mild conditions and inexpensiveness of microbial fermentation processes, Biocatalytic desulfurization (BDS) has been a main candidate as an alternative or complement desulfurization process (Baldi et al. 2003;
123
1196
Gupta and Roychoudhury 2005; Lee et al. 1995). Many studies have used traditional and the same techniques to detect DBT desulfurizing and/or degrading microorganisms by enrichment in aquatic systems and metabolic pathways have been elucidated for some of them (Baldi et al. 2003; Gupta and Roychoudhury 2005; Kropp et al. 1997; Okada et al. 2002a, b; Rashidi et al. 2006; Soleimani et al. 2007). This study has experienced novel and optimized enrichment methodologies to detect DBT desulfurizing microorganisms that can desulfurize DBT in aquatic and hydrocarbon/water biphasic systems, and it has introduced Microbacterium sp. NISOC-06 that is able to utilize DBT as the sole source of sulfur and not carbon.
Materials and methods
World J Microbiol Biotechnol (2010) 26:1195–1200
Enrichment procedure for DBT-desulfurizing microorganisms About 0.2 g soil sample was inoculated into 100 ml MSM?DBT-enriched gasoline in a 250 ml Erlenmeyer flask. These flasks were incubated in unshaken conditions at 35°C. After 20 days of incubation, a piece of the pellicle that was developed on the surface of the culture was inoculated into fresh MSM?Glu?DBT-enriched gasoline. After 2 weeks of incubation in the same conditions, a piece of the pellicle was removed and serially diluted and plated on 1.5% agar-solidified MSM, containing 5 g/l Glu and 0.5 mM sulfate as sources of carbon and sulfur, respectively. Plates were incubated at 35°C until colony formation (nearly 2 weeks). Single colonies were screened for detection of C–S and not C–C degradation (Guerinik and Al-Mutawah 2003; Gilbert et al. 1998; Grossman et al. 2001).
Materials Screening of C–S and not C–C degrading microorganisms DBT, biphenyl, 2-Hydroxy biphenyl (2-HBP), ethyl acetate, Gibb’s reagent (2, 6-dichloroquinone 4-chloroimide) and ingredients of mineral salt medium were obtained from Merck. Mineral oil was purchased from Acros organics. Gasoline and crude oil were kindly supplied by the NISOC. Methods Sampling According to the relationship of the soil color to oxidation– reduction potential, light brown and red-brown oil polluted soils were sampled from NISOC areas. All soil samples have usual texture and color, were oil and water-unsaturated and were achieved by 2–5 cm digging of oil polluted soils. All samples were protected from drying and inoculated into enrichment flasks during 1–4 h after sampling. Culture medium Isolation and cultivation were performed using mineral salt medium (MSM) containing 3.2 g KH2PO4; 5.1 g K2HPO4; 2 g NH4Cl; 0.6 g MgCl2; 0.001 g FeCl3 and 0.001 g CaCl2 per liter that were dissolved in double distilled deionized water (DDW). Final pH 7.2 was adjusted by 20% NaOH titration. After autoclaving (121°C, 20 min), 1 ml of filtersterilized gasoline enriched by 20 mM authentic DBT was added to 98.5 ml of MSM as the source of sulfur (MSM?DBT-enriched gasoline). Glucose was added by 5 g/l final concentration as the carbon source (Gilbert et al. 1998; Etemadifar et al. 2006; Guerinik and Al-Mutawah 2003).
123
DBT utilizing microorganisms was studied to detect C–S and not C–C targeted DBT-degradation. Each single colony was inoculated into MSM?Glu (Glucose)?DBT, MSM?DBT and MSM?DBT?sulfate containing flasks (DBT was added from an acetone solution with 0.8 mM Final concentration). Biomass production in MSM?DBT and MSM?DBT?sulfate flasks was related to the ability of DBT utilization as carbon or carbon and sulfur sources. The results were proved by GC and UV spectrophotometry studies (Gilbert et al. 1998). Biomass measurement Cell growth was determined by measuring turbidity at 600 nm. At 24 h intervals, 3 ml of each flask was withdrawn, centrifuged (4,000 rpm, 12 min) and maintained in 4°C. The t0 sample of each medium was used as the blank for measurement of biomass production (OD600). Gibbs assay and UV spectrophotometry About 20 ll Gibbs reagent (5 mM in ethanol) was added to 1 ml of culture samples of MSM?DBT. A blank solution was prepared as cell free MSM?DBT?Gibbs reagent. After an hour of incubation at 30°C, reaction tubes were centrifuged (5,000 rpm, 10 min) and A610 was measured (Rashtchi et al. 2006; Guerinik and Al-Mutawah 2003; Gilbert et al. 1998). k285 and k323 were used to detect reduction of DBT concentration, k392 (3-hydroxy-2-formyl-benzothiophene [HFBT]), k248 (Biphenyl) and k266 (2-hydroxy biphenyl)
World J Microbiol Biotechnol (2010) 26:1195–1200
was used to detect any increase in concentration of DBTdesulfurization metabolites (Etemadifar et al. 2006). Metabolite extraction About 0.5 ml of the MSM?0.8 mM DBT aliquots was acidified to pH B 2.0 by titration with 50% HCl. 0.5 ml ethyl acetate was added as a general solvent and the mixture vortexed for 5 min. After a 5 min of phase separation, ethyl acetate phase was harvested. Extraction by the same method was repeated for three times and all ethyl acetate phases were centrifuged (5,000 rpm, 10 min). Upper 2/3 volume of the ethyl acetate phase was harvested and dried at 50°C at room atmosphere. Finally, 1 ml of ethanol was added to dried materials and analyzed by GC and UV spectrophotometry (Rashtchi et al. 2006; Kropp et al. 1997; Gilbert et al. 1998). Gas chromatography All ethyl acetate extracted samples were analyzed to determine the concentration of DBT and its sulfurous metabolites, using GC equipped with a sulfur chemiluminesence detector (SCD). 1 ll of sample was injected into a 0.32 mm interior diameter and 30 m column with a 0.015 mm film CP-SIL 5CB for sulfur column operated at 1.7 ml/min volume velocity of helium carrier gas. The injector and detector temperatures were maintained at 275 and 800°C, respectively. The column temperature was remained at 200°C according to the different organic sulfur compounds till the character peak appeared (Lee et al. 1995; Okada et al. 2002a, b; Seo et al. 2006). Also, Samples of MSM?sulfate, cell free blanks and sulfur free MSM were analyzed using GC and UV spectrophotometry to relate organic sulfur compounds to the DBT metabolism. Energy dispersive spectrometry To detect any mineral sulfur contamination, 5 ml of sulfur free MSM was dried at 50°C and room pressure. The dried salts were analyzed using Scanning Electron Microscope (SEM), Equipped with EDS analyzer.
1197
most eubacteria (Weisburg et al. 1991). Proficiency of FD1 and RP1 Primers was analyzed by CLC main workbench software (trial version) and BLASTN 2.2.18 ? program in National center of biotechnology information (NCBI). DNA extraction An aliquot (3 ml) of an overnight culture was centrifuged for 15 min (5,000 rpm), the pellet was washed with Tris– EDTA (TE) buffer, then centrifuged again, the pellet was resuspended in 600 ll of RSB buffer and 65 ll of 10% sodium dodecyl sulfate (SDS) and after shaking, 500 ll of Tris-buffered phenol (pH 8) were added. After shaking, the mixture was centrifuged for 10 min in an Eppendorf centrifuge at 10,000 rpm, and the aqueous phase was extracted with phenolchloroform-isoamyl alcohol (25:24:1). Finally, the DNA was precipitated with 24 ll of 2.5 M NaCl and 600 ll of -20°C absolute ethanol, centrifuged (13,000 rpm, 30 min), and washed with 70% ethanol. The pellet was air dried and resuspended in 50 ml of TE buffer (Duarte et al. 2001). Polymerase chain reaction All PCR amplifications were performed in a thermal cycler (BIORAD, USA). The 50 ll PCR mixtures were prepared with 1 ll of target DNA (10–20 ng), 5 ll of 109 PCR buffer (Fermentas), 10 mMol of each deoxyribonucleoside triphosphate, 2.5 mM MgSO4, 10 pmol of each primer, 5 U of PFU DNA polymerase and appropriate volume of DDW. A hot-start procedure (4 min, 94°C) was used before the enzyme was added to prevent nonspecific annealing of the primers. Negative control (PCR mixture without template DNA) was included. PCR entailed 30 cycles (94°C for 1 min, 62°C for 30 s, 72°C for 1 min, plus one additional cycle with a final 20 min chain elongation) (Duarte et al. 2001). Agarose gel electrophoresis of PCR products indicated a sharp band in 1,500 bp and it was purified and sequenced by genfanavaran biotech corp.
Results
16srDNA sequence based identification
Isolation and screening
Primers
Between isolated microorganisms, there were four bacterial isolates, capable of DBT utilization as the sulfur source. The growth pattern of Microbacterium sp. NISOC-06 in MSM?0.8 mM MgSO4, MSM?0.8 mM DBT and sulfur free MSM flasks showed that DBT affects the growth rate and biomass production effectively (Fig. 1). UV spectrophotometry studies of MSM?DBT during the incubation
The 16srDNA was amplified using general eubacterial specific primers FD1 (50 -CCGAATTCGTCGACAACAGA GTTTGATCCTGGCTCAG) and RP1 (50 -CCCGGGAT CCAAGCTTACGGTTACCTTGTTACGACTT) that are advised to amplify nearly full length of 16srRNA gene of
123
1198
World J Microbiol Biotechnol (2010) 26:1195–1200 3 SO4
1.6
DBT
1.4
blank
T= 0h T=240h
2.5
Absorption
OD600
2 1.8
1.2 1 0.8
2 1.5 1
0.6
0.5
0.4
0 254
0.2
276
285
293
300
313
323
332
392
Wavelengh(nm)
0 0
24
48
72
96
120
144
168
192
216
240
Time(hour) Fig. 1 Growth pattern of Microbacterium sp. NISOC-06 in mediums. MSM?sulfate (filled diamond), MSM?DBT (filled square) and sulfur free MSM (filled triangle)
indicated a 51.3 and 91.2% reduction of absorption at 285 and 323 nm, respectively (Fig. 2). Gibbs assay showed no 2-HBP accumulation. GC-SCD studies indicated that there was no accumulated sulfurous byproduct(s), so the end product(s) were desulfurized. Quantitative analysis of peaks showed 95.9% reduction of DBT concentration during the incubation (Fig. 3). As is shown in Fig. 4, after a 48 h long lag phase, a 120 h long exponential growth begins, during this period DBT concentration was reduced by 90.6%. After this accelerated DBT utilization during the log phase (t48–t168), a decreasing growth rate and DBT utilization occurred (t168–t240). A 5.3% reduction of DBT concentration
Fig. 2 UV absorption pattern of extraction samples of t0 (filled square) and t240 (dash)
occurred in this period (t168–t240). Regarding 1.1% reduction of DBT concentration in cell free MSM?DBT flask, 94.8% of DBT reduction was related to bacterial assimilation of DBT as sulfur source. There was no growth using DBT as the sole source of carbon or as both carbon and sulfur sources and no changes were detected at 285 and 323 nm. These data were analyzed to conclude that Microbacterium sp. NISOC-06 is a new sulfur selective DBT desulfurizing strain. EDS analysis of 5 ml of dried sulfur free MSM showed no sulfur moiety by a certainty of 0.01%. GC-SCD chromatograms of sulfur free blank flasks showed that volatile sulfurous compounds of atmosphere introduced into the samples and their concentration increased by higher agitation and vortex.
Fig. 3 GC-SCD chromatograms of t0 and t240 samples of MSM?DBT?Glu
123
World J Microbiol Biotechnol (2010) 26:1195–1200 1.8 1.7 1.6 1.5 1.4 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
0.8
0.6
Biomass(OD600) DBT concentration (mM)
0.4
DBT(mM)
OD600
Fig. 4 Biomass production (filled triangle) and reduction of DBT concentration (filled square) in a 240 h period
1199
0.2 0.1 0.0 0
24
48
72
96
120
144
168
192
216
240
Time(hour)
Identification Regarding the results of Taxonomic report of BLASTN 2.2.18?program, the isolate NISOC-06 was affiliated to the genus Microbacterium with 99% similarity to specific species. Considering its isolation from NISOC oilfields in Khuzestan province of Iran, we have named it Microbacterium sp. NISOC-06, a nonmotile, catalase and citrate positive, oxidase and gelatinase negative, highly oxidative cocci bacterium that can emulsify crude oil efficiently. This bacterium grows in the presence of 0.2% phenol, toluene and 1% gasoline as carbon source.
Discussion The basis of enrichment procedure was on the ability of the target microorganisms to assimilate DBT from hydrophobic phase by a high efficiency. Regarding highly toxic nature of gasoline, only microorganisms resistant to it can assimilate sulfur source and produce a thick pellicle among aquatic and hydrophobic phases. Because of many explanations, such a partitioning is suitable to enhance hydrocarbons biodegradation (Kirkwood et al. 2007; Guerinik and Al-Mutawah 2003) that we have used to enhance the selectivity of enrichment procedure for DBT desulfurizing microorganisms. The role of such partitioning in selective degradation of different sulfur sources has not been reported. Among the isolated microorganisms, there was a significant difference in the rate and extent of DBT metabolization. Therefore, Microbacterium sp. NISOC-06 is selected on the basis of its desulfurization abilities. Considering Fig. 1, An interesting point is the growth ability of Microbacterium sp. NISOC-06 in the sulfur free blank flask. Regarding EDS and GC-SCD studies, volatile organosulfur compounds of lab atmosphere can be solved
in culture medium and solvents during the incubation and extraction procedure that can be the main cause of biomass production in the absence of authentic sulfur source. Also, nutrient starvation studies have showed that microorganisms produce sulfur scavenging proteins to assimilate more dilutions of sulfur sources (Kertesz 1999; Van der Ploeg and Leisinger 2001). Considering the geographical location of Ahvaz in the NISOC oilfields, various concentrations of volatile hydrocarbons can be detected in its atmosphere a fraction of which can be sulfurous. Thus, ability of biomass production in the absence of authentic sulfur source can be explained. Regarding Fig. 1, after 48 h of incubation, there was a defined diauxic growth in MSM?DBT flask which is the result of catabolic repression on the sulfur source. Regarding the growth pattern in MSM?DBT and sulfur free MSM (blank) flasks in Fig. 1, there was the same pattern of growth until 48 h of incubation, although it is a result of the presence of volatile organosulfurs in the atmosphere. After the log phase, (168 h of incubation) accumulation of DBT desulfurization metabolites and end product(s) or repression of desulfurization at transcription or enzyme decreased the growth rate. High surface hydrophobicity of Microbacterium sp. NISOC-06 can be a reason of accelerated DBT assimilation and desulfurization and results in high rate of DBT uptake. Etemadifar et al. have reported 60% reductions of absorption at 285 nm and more than 70% reduction at 323 nm (Etemadifar et al. 2006). Considering Fig. 2, there is different absorption reduction at various wavelengths, especially at 285 and 323 nm. Accumulation of aromatic compounds whose kmax is restricted in 240–285 is the most possible reason which was not explained by Etemadifar et al. k246 is the kmax of Biphenyl. Other metabolites by a similar chemistry have their kmax at 250–285 nm and concentration of these compounds increased the absorption at 250–285 (nm). Indeed, C–C bond degradation and DBT mineralization can
123
1200
reduce total UV absorption effectively, but C–S targeted desulfurization can produce aromatic end product(s) that increase the UV absorption at particular wavelengths. In the presence of sulfate, thiosulfate and sulfite in separate flasks containing MSM?DBT?ethanol, there was no change in DBT concentration and UV absorption and it was revealed that DBT utilization is repressed in the presence of simple sulfur sources. Also, Microbacterium sp. NISOC-06 can not utilize DBT as the carbon source and no change in UV absorption was seen. Consequently, these changes in UV absorption were specific to DBT metabolization as the sulfur source and not carbon. According to GC-SCD studies, during the course of incubation, there was no sulfurous metabolites concentration. Thus, metabolites of DBT desulfurization should be metabolized too fast to be detected in culture samples. Li et al. have reported negative Gibbs assay and it was a result of 2-HBP methylation and detoxification (Li et al. 2005). Absence of 2-HBP, results of UV spectrophotometry and growth inability of the strain on the DBT as the carbon source propose a novel or modified metabolic strategy used by Microbacterium sp. NISOC-06. The full 16srRNA gene was sequenced whose investigation introduced it as a member of Microbacterium genus, thus regarding its isolation from NISOC oilfields we named it Microbacterium sp. NISOC-06. Further studies on biodesulfurization optimization and genetic properties of Microbacterium sp. NISOC-06 is continuing. Acknowledgment This work was kindly supported by the vice chancellor for research office of Shahid Chamran Univesity, Iran and National Iranian South Oil Company (NISOC), Department of Research and Development and Department of Chemicals and Laboratories. Great thanks to Seied Abbas Dibaj, GC-man of gas chromatography laboratory of NISOC.
References Baldi F, Pepi M, Fava F (2003) Growth of Rhodosporidium toruloides strain DBVPG 6662 on dibenzothiophene crystals and orimulsion. Appl Environ Microbiol 69:4689–4696 Duarte GF, Rosado AS, Seldin L, De Araujo W, Van Elsas JD (2001) Analysis of bacterial community structure in sulfurous-oilcontaining soils and detection of species carrying dibenzothiophene desulfurization (dsz) genes. Appl Environ Microbiol 67:1052–1062 Etemadifar Z, Emtiazi G, Peimanfar S (2006) Removal of dibenzothiophene, biphenyl and phenol from waste by Trichosporon sp. Sci Res Essay 1:72–76 Garc0 ia-Cruz I, Valencia D, Klimova T, Oviedo-roa R, Mart0 inezmagad0 an JM, G0 omez-Balderas R, Illas F (2008) Proton affinity of S-containing aromatic compounds: implications for crude oil hydrodesulfurization. J Mol Catal A Chem 281:79–84 Gilbert SC, Morton J, Buchanan S, Oldfield C, McRoberts A (1998) Isolation of a unique benzothiophene desulphurizing bacterium,
123
World J Microbiol Biotechnol (2010) 26:1195–1200 Gordona sp. Strain 213E (NCIMB 40816), and characterization of the desulphurization pathway. Microbiology 144:2545–2553 Grossman MJ, Lee MK, Prince RC, Garrett KK, George GN, Pickering IJ (1999) Microbial desulfurization of a crude oil middle-distillate fraction: analysis of the extent of sulfur removal and the effect of removal on remaining sulfur. Appl Environ Microbiol 65:181–188 Grossman MJ, Lee MK, Prince RC, Minak-Bernero V, George GN, Pickering IJ (2001) Deep desulfurization of extensively hydrodesulfurized middle distillate oil by Rhodococcus sp. strain Ecrd-1. Appl Environ Microbiol 67:1949–1952 Guerinik K, Al-Mutawah Q (2003) Isolation and characterization of oil-desulphurizing bacteria. World J Microbiol Biotechnol 19: 941–945 Gupta PK, Roychoudhury JK (2005) Biotechnology of desulfurization of diesel: prospects and challenges. Appl Microbiol Biotechnol 66:356–366 Kertesz MA (1999) Riding the sulfur cycle—metabolism of sulfonates and sulfate esters in Gram-negative bacteria. FEMS Microbiol Rev 24:135–175 Kilbane JJ II (2006) Microbial biocatalyst developments to upgrade fossil fuels. Curr Opin Biotechnol 17:305–314 Kirkwood KM, Foght JM, Gray MR (2007) Selectivity among organic sulfur compounds in one- and two-liquid-phase cultures of Rhodococcus sp. strain JVH1. Biodegradation 18:473–480 Kropp KG, Andersson JT, Fedorak PM (1997) Bacterial transformations of 1, 2, 3, 4-Tetrahydro-dibenzothiophene and dibenzothiophene. Appl Environ Microbiol 63:3032–3042 Lee MK, Senius JD, Grossman MJ (1995) Sulfur-specific microbial desulfurization of sterically hindered analogs of dibenzothiophene. Appl Environ Microbiol 61:4362–4366 Li W, Zhang Y, Wang MD, Shi Y (2005) Biodesulfurization of dibenzothiophene and other organic sulfur compounds by a newly isolated Microbacterium strain ZD-M2. FEMS Microbiol Lett 247:45–50 Okada H, Nomura N, Nakahara T, Maruhashi K (2002a) Analyses of substrate specificity of the desulfurizing bacterium Mycobacterium sp. G3. J Biosci Bioeng 93:228–233 Okada H, Nomura N, Nakahara T, Maruhashi K (2002b) Analysis of dibenzothiophene metabolic pathway in Mycobacterium strain G3. J Biosci Bioeng 93:491–497 Rashidi L, Mohebali G, Darian JT, Rasekh B (2006) Biodesulfurization of dibenzothiophene and its alkylated derivatives through the sulfur-specific pathway by the bacterium RIPI-S81. Afr J Biotechnol 5:351–356 Rashtchi M, Mohebali GH, Akbarnejad MM, Towfighi J, Rasekh B, Keytash A (2006) Analysis of biodesulfurization of model oil system by the bacterium, strain RIPI-22. Biochem Eng J 29:169– 173 Seo JS, Keum YS, Cho IK, Li QX (2006) Degradation of dibenzothiophene and carbazole by Arthrobacter sp. P1-1. Int biodet biodegrad 58:36–43 Soleimani M, Bassi A, Margaritis A (2007) Biodesulfurization of refractory organic sulfur compounds in fossil fuels. Biotechnol Adv 25:570–596 Song C, Ma X (2003) New design approaches to ultra-clean diesel fuels by deep desulfurization and deep dearomatization. Appl Catal B Environ 41:207–238 Van der Ploeg JR, Leisinger EET (2001) Sulfonate-sulfur metabolism and its regulation in Escherichia coli. Arch Microbiol 176:1–8 Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16s ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697–703
