Vascular Endothelial Growth Factor Receptor-2 Activation Induces

2 downloads 0 Views 741KB Size Report
Gómez et al. • Blockage of VEGFR-2 Inhibits ...... Hum Reprod 9:792–799. 34. Doldi N, Bassan M, Fusi F, Ferrari A 1997 In controlled ovarian hyperstimulation,.

0013-7227/02/$15.00/0 Printed in U.S.A.

Endocrinology 143(11):4339 – 4348 Copyright © 2002 by The Endocrine Society doi: 10.1210/en.2002-220204

Vascular Endothelial Growth Factor Receptor-2 Activation Induces Vascular Permeability in Hyperstimulated Rats, and this Effect Is Prevented by Receptor Blockade ´ L GO ´ MEZ, CARLOS SIMO ´ N, JOSE ´ REMOHI´, RAU

AND

ANTONIO PELLICER

Fundacio´n IVI para el Estudio de la Reproduccio´n (R.G., C.S., J.R., A.P.); Department of Pediatrics, Obstetrics, and Gynecology (C.S., J.R., A.P.), Valencia University School of Medicine; and Department of Obstetrics and Gynecology, Hospital Universitario Dr. Peset (A.P.), Valencia 46020, Spain The existence of a vasoactive molecule released in response to hCG is believed to be the main feature in the development of ovarian hyperstimulation syndrome (OHSS) in women, and vascular endothelial growth factor (VEGF) is the main candidate as the human chorionic gonadotropin (hCG) mediator. This study was conducted to investigate the role of VEGF in increasing vascular permeability (VP) in vivo, a characteristic of OHSS. We analyzed the source and specific isoforms of VEGF involved and developed strategies to reverse increased VP in hyperstimulated rats targeting the VEGF system. Ovarian hyperstimulation was induced with pregnant mare’s serum gonadotropin, or pregnant mare’s serum gonadotropin plus hCG. Time-course experiments analyzed VP and the expression of whole VEGF mRNA in the mesentery and the ovaries. VP and ovarian mRNA VEGF expression increased to peak values after 48 h. No significant change in expression

V

ASCULAR ENDOTHELIAL growth factor receptor is now identified as the main angiogenic substance responsible for increased capillary permeability leading to extravasation of protein-rich fluid and, subsequently, the full appearance of ovarian hyperstimulation syndrome (OHSS). Serum vascular endothelial growth factor (VEGF) levels increase after human chorionic gonadotropin (hCG) administration in hyperstimulated women at risk of developing OHSS (1). In fact, a rise in serum VEGF levels has been used as a marker for subsequent development of OHSS (2). Moreover, plasma VEGF levels correlate with the clinical picture of OHSS (3) and the changes in VEGF in ascites have been correlated with the clinical course of OHSS (4). In women who develop OHSS, VEGF is expressed and produced by granulosa-lutein cells (5–10) and is released into the follicular fluid (5, 11, 12) in response to hCG (10), inducing increased capillary permeability (5, 11, 12). The isoform VEGF165 has been specifically identified in human follicular fluid (13). Similarly, we have shown that hCG stimulates the release of VEGF in human endothelial cells, which, in turn, acts in an autocrine manner to increase vascular permeability Abbreviations: DEPC, Diethylpyrocarbonate; EB, Evans Blue; hCG, human chorionic gonadotropin; OHSS, ovarian hyperstimulation syndrome; PBS-T, PBS-0.05% Tween 20; PMSG, pregnant mare’s serum gonadotropin; VEGF, vascular endothelial growth factor; VEGFR, vascular endothelial growth factor receptor; VP, vascular permeability.

was observed in the mesentery. To further prove the ovarian origin of VEGF, we showed that VP was not altered when ovariectomized rats were treated with gonadotropins. The ovary expressed VEGF120 and VEGF164 isoforms. Immunohistochemistry showed VEGF in granulosa and zona pellucida of preovulatory and atretic follicles and in granulosa-lutein and endothelial cells of whole corpus luteum. A specific VEGF receptor-2 inhibitor (SU5416) was administered in three different protocols: on a daily basis, every 48 h, or two injections after hCG. Increased VP was reversed when SU5416 was administered every 48 h or two injections after hCG. These results show that the ovary is the main source of VEGF120 and VEGF164, which act through the VEGF receptor-2 to increase VP, and provide new insights into the prevention of OHSS. (Endocrinology 143: 4339 – 4348, 2002)

(VP) (12). Thus, both cell types may be involved in the production and release of VEGF in women treated with gonadotropins who develop OHSS. If the endothelium is involved, we still do not know whether only the vessels of the ovary or the entire vascular tree participate in the mechanisms leading to OHSS. The human VEGF gene has been mapped to chromosome 6p12 (14) and is made up of eight exons. Exons 1–5 and 8 are always present in VEGF mRNA, whereas the expression of exons 6 and 7 is regulated by alternative splicing. This phenomenon produces various VEGF isoforms differing in length, but with a common region. In humans, five different VEGF mRNAs have been detected encoding the isoforms VEGF121, VEGF145, VEGF165, VEGF189, and VEGF206 (15). The isoforms VEGF121 and VEGF165 appear to be mainly involved in the process of angiogenesis (16) and are characteristic products of the ovary (17). The VEGF gene shows the same exonic structure in rodents and humans (18). Murine VEGF-expressed isoforms VEGF120, VEGF144, VEGF164, VEGF188, and VEGF205 differ in only one amino acid length compared with human VEGF isoforms, showing a 95% protein homology (19). Similar to those in human ovary (5–10), hybridization studies in the rat ovary have demonstrated whole VEGF mRNA expression predominately after the LH surge (20). The receptors for VEGF are present in the endothelial cells and belong to the tyrosine kinase receptor family (21). They

4339

4340

Endocrinology, November 2002, 143(11):4339 – 4348

are also present in the inner theca of human follicles (9, 10). Two specific endothelial cell membrane receptors for VEGF have been identified, VEGF receptor-1 (VEGFR-1; Flt-1) and VEGFR-2 (Flk-1/KDR) (22, 23). The receptor Flk-1/KDR appears to be mainly involved in regulating VP, angiogenesis, and vasculogenesis (23, 24). Targeting the Flk-1/KDR receptor has been a goal for researchers working in gynecological oncology. Different specific VEGFR-2 blockers have been used in animal models that reduce tumor growth (25, 26) and ascites (26, 27). Although the mechanism of ascites may be different in neoplasms and OHSS (27), nobody has tried to date to reverse ascites formation in OHSS targeting the VEGF system. Based on the above information, we have employed an in vivo murine model to induce OHSS, considering the two main characteristics, ovarian enlargement and increased VP leading to ascites (13). Using this model, we have first investigated the hormonal conditions inducing OHSS, the involvement of VEGF in the process, the tissue source(s) of VEGF, and the specific VEGF isoforms involved in OHSS. Finally, the effect of blocking the VEGFR-2 on VP, as a new strategy to prevent and treat OHSS, was assayed. Materials and Methods Drugs and reagents General chemicals of analytical grade were obtained from Sigma (St. Louis, MO) and Merck & Co., Inc. (Darmstadt, Germany). Pregnant mare’s serum gonadotropin (PMSG) was purchased from Sigma, and hCG (Profasi) was obtained from Serono Laboratories (Madrid, Spain). Primary mouse VEGF antihuman monoclonal antibody (sc7269) was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), and horseradish peroxidase-conjugated extravidin was purchased from Sigma-Aldrich (Irvine, UK). Biotinylated IgGs to detect the primary antibody were obtained from DAKO Corp. (Copenhagen, Denmark). The TRIzol reagent was obtained from Life Technologies, Inc. (Paisley, Scotland, UK). Ketamine (Ketolar) was purchased from Parke-Davis (Barcelona, Spain), and the VEGFR-2 inhibitor SU5416 was provided by Sugen, Inc. (South San Francisco, CA).

Animals, stimulation protocols, and experimental design Immature female Wistar rats were obtained from Harlam Iberica (Sant Feliu de Codina, Spain) and were kept at least 1 wk in our laboratory before starting the experiments. They were fed a standard diet and allowed free access to water with a 12-h light, 12-h dark schedule (lights on from 0700 –1900 h). All studies used 22-d-old animals (42– 48 g) and were conducted in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals. Protocols for animal handling were approved by the ethical animal committee of the Valencia University School of Medicine. In the first series of experiments, we investigated the hormonal conditions involving OHSS. Animals were divided into three groups. The control group (n ⫽ 48) received ip injections of 0.1 ml saline from d 22–26. The PMSG group (n ⫽ 48) received 10 IU PMSG for 4 consecutive days and 0.1 ml saline on the fifth day. The OHSS group (n ⫽ 48) was given 10 IU PMSG for 4 consecutive days and 30 IU hCG on the fifth day to induce OHSS (28). Time-course experiments were performed measuring VP at 6 h before and 0, 2, 24, 48, and 96 h after hCG or saline treatment. Each time point included eight animals per experimental group. The mesentery, which is representative of a highly vascularized tissue, and one ovary from at least four animals per group at each time point were frozen for mRNA VEGF analysis, whereas the other ovary of the same animal was used for immunohistochemistry analysis. First, we compared mRNA VEGF levels among the three groups at each time point in the ovary and the mesentery independently to find out the timing of VEGF expression. Second, the source of VEGF expression was reassured by comparing VEGF/␤-actin ratios between ovary and mesentery at each time point

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

in the OHSS group. Finally, VEGF isoform expression was studied. Immunohistochemical analysis was also performed on the ovaries of these animals to prove VEGF protein production. A second series of experiments was designed to investigate the ovary as the source of VEGF in hyperstimulated animals measuring VP as the end point. Four groups of animals were established. The control group (n ⫽ 8) receiving saline as described above. The OHSS group (n ⫽ 8) was given PMSG and hCG as described above. The ovariectomized and hyperstimulated group (n ⫽ 8), in which the animals were anesthetized with ketamine (100 mg/kg) and the ovaries were removed 24 h before stimulation with PMSG and hCG, was the OHSS group. The ovariectomized group (n ⫽ 8) consisted of animals ovariectomized under anesthesia and treated with saline as in the control group.

Permeability assays To measure VP, a previously described method was used (28 –29). Rats were anesthetized with ketamine and heated on a thermal blanket to avoid hypothermia. A fixed volume (0.2 ml) of 5 mm Evans Blue (EB) dye diluted in distilled water was injected via the femoral vein. Thirty minutes after dye injection, the peritoneal cavity was filled with 5 ml 0.9% saline (21 C; pH 6) and massaged for 30 sec. Subsequently, the fluid was quietly extracted with a Vialon vascular catheter (BD Biosciences, Madrid, Spain) to prevent tissue or vessel damage. To avoid any protein interference, peritoneal fluid was recovered in tubes containing 0.05 ml 0.1 n NaOH. After centrifugation at 900 ⫻ g for 12 min, the EB concentration was measured at 600 nm on a Shimadzu 1201 spectrophotometer (Izasa, Madrid, Spain). The level of the extravasated dye in the recovered fluid was expressed as micrograms of EB per 100 g body weight.

mRNA expression of VEGF RNA isolation. RNA extraction was performed according to the method described by Chomczynski and Sacchi (30) with minor modifications using the TRIzol reagent. Briefly, each tissue was weighed, and 500 ␮l TRIzol reagent/100 mg tissue weight were added. Total RNA was separated from DNA and proteins by adding 250 ␮l chloroform and was precipitated with isopropanol (overnight, ⫺20 C). The precipitate was washed twice in ethanol, air-dried, and resuspended in 75% diethylpyrocarbonate (DEPC)-treated water. The amount of RNA was quantified by spectrophotometry on a SmartSpec 3000 spectrophotometer (Bio-Rad Laboratories, Inc., Barcelona, Spain). RT. RT was carried out using the Advantage RT-for-PCR Kit (CLONTECH Laboratories, Inc., Palo Alto, CA,). Mastermix per sample was prepared as follows: 4 ␮l 5⫻ reaction buffer, 1 ␮l deoxy-NTP mix (10 mm each), 0.5 ␮l recombinant ribonuclease inhibitor, and 1 ␮l Moloney murine leukemia virus reverse transcriptase. One microgram of each sample was diluted to a final volume of 12.5 ␮l in DEPC-treated water plus 1 ␮l oligo(dT)18; the mixture was heated at 70 C for 2 min and kept on ice until Mastermix (6.5 ␮l) was added. For each RT, a blank was prepared using all of the reagents except the RNA sample, for which an equivalent volume of DEPC water (12.5 ␮l) was substituted. The RT blank was used to prepare the PCR blank (below). Once all components were mixed, the samples were incubated at 42 C for 1 h, then heated at 94 C for 5 min to stop cDNA synthesis and destroy deoxyribonuclease activity. The product was diluted to a final volume of 100 ␮l with DEPC-treated water and stored at –20 C until PCR analysis. Real-time PCR. Primers for quantitative PCR were designed using the Primers Express Software (PE Applied Biosystems, Warrington, UK) and synthesized (PE Applied Biosystems, Barcelona, Spain) The sense ␤-actin primer was 5⬘-616AGGGAAATCGTGCGTGACAT635-3⬘, and the antisense ␤-actin primer was 5⬘-764AACCGCTCATTGCCGATAGT745-3⬘ (NCBI accession no. 55574), giving rise to a expected PCR product of 149 bp. The VEGF primers were designed to amplify a region common to all VEGF isoforms, so the sense VEGF primer was 5⬘-114CAGCTATTGCCGTCCAATTGA124-3⬘, and the antisense VEGF primer was 5⬘244 CCAGGGCTTCATCATTGCA226-3⬘, where a 131-bp PCR product was expected (NCBI accession no. AF215726). To amplify cDNA, the RT samples were diluted to a final concentration of 12.5 ␮g total cDNA/␮l. In each reaction, a total of 4 ␮l (50 ␮g

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

cDNA) from each RT tube was mixed with 12.5 ␮l SYBR Green PCR master mix (PE Applied Biosystems) containing nucleotides, Taq DNA polymerase, MgCl2, and reaction buffer with SYBR green; 1–3 ␮l 0.5 ␮m VEGF or ␤-actin primers and double distilled water were added to a final volume of 25 ␮l. Real-time PCR was performed using an ABI PRISM 7700 Sequence Detection System (Perkin Elmer Corp., Norwalk, CT) according to the manufacturer’s instructions with a heated lid (105 C), an initial denaturation step at 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 60 C for 1 min. Each sample was amplified in duplicate for VEGF or ␤-actin, giving rise to four reactions per sample. In parallel, 6-fold serial dilutions of known concentrations of VEGF and ␤-actin cDNA were run with each analysis as a calibration curve. Quantification data were analyzed at the beginning of the exponential phase (cycles 18 –25) with ABI PRISM 1.7 analysis software. Background fluorescence was removed by setting a noise band. Duplicates showing more than a 5% variation were discarded. To validate a real-time PCR, standard curves with r ⬎ 0.95 and slope values between 3.1 and 3.4 were required. For each sample, the amounts of VEGF cDNA and ␤-actin cDNA were determined with relation to the standard curves. The VEGF/␤-actin ratio was used to estimate and compare the relative VEGF expression. The results of each PCR experiment were confirmed in a minimum of three consecutive experiments. At the end of the PCR reaction, all products reached a plateau. To determine whether other nonexpected products were also amplified, the PCR products from each VEGF or ␤-actin after 40 cycles were subjected to a subsequent agarose-4% gel electrophoresis with ethidium bromide to confirm amplification specificity.

VEGF isoforms Primer sequences to detect VEGF isoforms were previously described (31) and were synthesized using Custom Primers (Life Technologies, Inc., Barcelona, Spain). The sense VEGF primer 5⬘-10CTGCTCTCTTGGGTGCACTGG30-3⬘ (sequences are numbered on the basis of the cDNA for rat VEGF164, with the first base of the initiation codon designated 1) (32) was located in exon 1. The antisense primer was 5⬘572 CACCGCCTTGGCTTGTCACAT552-3⬘ and was matched to a common region downstream from the alternative splicing site (32). Thus, this pair of primers would generate a different sized product for each of the splicing forms of VEGF mRNA. The predicted PCR products for the three major forms, VEGF120, VEGF164, and VEGF188, would be 431, 563, and 635 bp, respectively. To amplify cDNA, 100 ␮g total cDNA from each RT tube were mixed with a Mastermix prepared as follows: 2.5 ␮l 10⫻ reaction buffer, 2.5 ␮l 25 mm MgCl2, and 0.1 ␮l Taq polymerase (5 IU/␮l; Bioline, London, UK); 0.5 ␮l 10 mm dNTPs mix (Sigma), 1.25 ␮l of each primer (25 ␮m; Life Technologies, Inc.) for VEGF, and double-distilled water were added to a final volume of 25 ␮l/sample. PCR reactions were carried out using an Eppendorf Mastercycler Personal (Eppendorf, Hamburg, Germany), with the following program using a heated lid (105 C): first heated to 94 C for 5 min, then 26 –30 cycles of 92 C for 30 sec, 60 C for 30 sec, and 72 C for 90 sec, with a final extension of 72 C for 5 min, and cooled down to 4 C. Products were then electrophoresed in a 1.5% agarose gel in the presence of ethidium bromide, and bands were analyzed in an image analysis system (Gelprinter Plus, Madrid, Spain) using 1D software (TDI, Madrid, Spain).

VEGF protein localization Ovarian samples for immunohistochemical experiments were fixed in formalin embedded in paraffin, sectioned, and mounted on glass slides. Twelve serial sections (5 ␮m) from each sample were prepared for immunohistochemistry, and the first and last sections were stained with hematoxylin-eosin. The tissue sections were deparaffinized in xylene and dehydrated in a graded series of ethanol. After deparafination, sections were boiled in citrate buffer (0.05 m) in a microwave oven to unmask antigens. Endogenous peroxidase was quenched with 3% (vol/ vol) hydrogen peroxide (10 min at room temperature), samples were rinsed three times for 5 min each time in PBS, and nonspecific binding was blocked with dehydrated nonfat milk (50 mg/ml diluted in PBS). Thereafter, tissue sections were rinsed with PBS-0.05% Tween 20 (PBS-T) three times and then incubated with 1:100 mouse antihuman VEGF

Endocrinology, November 2002, 143(11):4339 – 4348 4341

antibody (which recognizes rat VEGF) overnight at 4 C. After washing four times with PBS-T, sections were incubated with biotinylated rabbit antimouse IgG (90 min, 1:300 dilution at 37 C) to amplify the signal. Sections were rinsed four times with PBS-T and then incubated with horseradish peroxidase-conjugated extravidin (30 min, 1:40 dilution at room temperature), washed with PBS-T four times, and incubated for 10 min with working substrate solution (0.2 ml stock amino ethyl carbazol solution with 3.8 ml 0.05 m acetate buffer, pH 6.0; immediately before use, 20 ␮l 3% H2O2 was added) to detect the signal; reaction was terminated by rinsing the slides gently with distilled water. Finally, slides were counterstained with Mayer’s hematoxylin, rinsed with water, mounted with glycerol gelatin, and viewed with an Olympus Corp. BH2 microscope (Melville, NY). Negative controls were included in each experiment by incubating tissue sections with antibody dilution buffer instead of the primary antibody. Positive control slides consisted of human hemangiosarcoma cells.

Blocking experiments A series of blocking experiments was designed. Three protocols were assayed to inhibit increased permeability in OHSS animals by blocking the VEGFR-2. A total of 100 mg of the free powder compound SU5416 was diluted to a final concentration of 25 mg/ml in dimethylsulfoxide and kept at 4 C until it was used. For these experiments, a total of eight animals were included in each of the five experimental groups. The control group (n ⫽ 8) was treated as described above. The OHSS group (n ⫽ 8) was treated as previously described. In the OHSS inhibition group, rats were treated with PMSG and hCG in the same way as the OHSS animals, but SU5416 was added by ip injections (25 mg/kg䡠d) in three different forms: daily administration (q-24 h) of SU5416 coincidental with the injection of PMSG and hCG (d 22–26), administration of SU5416 every 48 h (q-48 h; d 23, 25, and 27), and injection of SU5416 on the day of hCG treatment and 24 h later (p-hCG; d 26 and 27). VP was measured in all groups at one time point according to the maximal VP observed in the first series of experiments.

Statistical analysis Data were expressed as the mean ⫾ sem. In the first series of VP and VEGF expression experiments, a nonparametric Kruskal-Wallis statistical method was used to find differences among groups at each time point. For this purpose, we previously normalized the VEGF/␤-actin ratio in PMSG and hCG groups with the VEGF/␤-actin ratio in the control group at each time point. In the experiments in which VP was measured to determine the relevance of the ovary as the source of VEGF and in the blocking experiments, a Mann-Whitney test was used to compare VP in OHSS group to those in the other groups. This test was also employed to find differences in VEGF expression between the ovary and the mesentery in the OHSS group. In this case the VEGF/␤-actin ratio in the ovary was normalized to the VEGF/␤-actin ratio in the mesentery at each time point in the OHSS group. Significance was defined as P ⬍ 0.05. Statistical analysis was carried out using the Statistical Package for Social Sciences (SPSS, Inc., Chicago, IL).

Results Effect of PMSG and hCG on ovarian enlargement and VP

Ovarian weight was compared among the three groups of animals established in the first series of experiments. PMSG alone (291.4 ⫾ 21.3 mg) and PMSG plus hCG (312.7 ⫾ 31.2 mg) were able to significantly (P ⬍ 0.001) increase ovarian weight compared with that in control animals (31.7 ⫾ 4.3 mg). Time-course determinations of VP using the EB method are shown in Fig. 1. As observed, the VP induced by PMSG doubled the amount of extravasated dye observed in controls, although no significant changes during the different time points were found. The average VP measured with this method in control animals was 2.1 (range, 1.5–2.6) ␮g EB/100 g body weight. Two hours after hCG, the OHSS group showed a significant (P ⬍ 0.05) increase in VP (9.81 ⫾ 2.3 ␮g

4342

Endocrinology, November 2002, 143(11):4339 – 4348

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

FIG. 1. Time-course permeability values. The symbols represent (by Kruskal-Wallis test) significant differences among OHSS, control and PMSG groups at each time point. The PMSG and OHSS groups were different from controls at all time points, but OHSS was also different from PMSG at 2, 24, 48, and 96 h after hCG. *, P ⬍ 0.05; **, P ⬍ 0.005; ***, P ⬍ 0.001.

EB/100 g body weight) compared with the PMSG and control groups. Maximal VP (26.1 ⫾ 5.1 ␮g EB/100 g body weight; P ⬍ 0.001) was observed 48 h after hCG administration and remained significantly (P ⬍ 0.01) elevated after 96 h (18.6 ⫾ 4.7 ␮g EB/100 g body weight). Although the accumulation of ascetic fluid was not evaluated in these experiments, we did observe ascites and a fibrin-rich matrix protein accumulation in the peritoneal cavity in more than 80% of the OHSS group rats at 48 and 96 h after hCG. This was not the case for the other two experimental groups.

The ovary as the source of VEGF

To further prove the source of VEGF, VP was measured in ovariectomized animals. Figure 4 shows that in the absence of ovaries, VP was not altered by PMSG and hCG. VEGF isoforms

The expression of the different VEGF isoforms was tested with conventional PCR in both tissues in the three groups 48 h after hCG administration. Whereas the ovary only expressed VEGF120 and VEGF164 isoforms (Fig. 5A), the mesentery expressed VEGF120, VEGF164, and VEGF188 (Fig. 5B).

Ovarian and mesentery mRNA VEGF expression

Whole VEGF expression in the ovaries of the PMSG group was 2- to 3-fold greater than that in the controls, but their values did not change during the time course. Whole VEGF expression in the ovaries of the PMSG group at – 6 and 0 h was similar to that in the OHSS group, but a significant increase in VEGF expression was detected at 24 (4.3 ⫾ 0.9; P ⬍ 0.05) and 48 h (5.6 ⫾ 1.5; P ⬍ 0.05) after hCG administration in the OHSS compared with the control and PMSG groups (Fig. 2A). This highest VEGF expression was coincidental with maximal VP to EB. Unlike the ovary, the expression of VEGF mRNA in the mesentery was not different among groups at any time point and did not change during the study period in any group (Fig. 2B). To elucidate the source of VEGF, we amplified ovarian and mesentery samples of OHSS rats in the same PCR plate to compare the VEGF/B-actin ratio, avoiding interassay error. VEGF expression in the ovary was always higher than that in the mesentery at each of the analyzed time points, with top levels detected in the ovarian tissue 48 h after hCG (Fig. 3).

VEGF protein localization in the ovary

Figure 6 shows a representative picture of the immunohistochemistry studies in which the presence of VEGF in the ovaries of control and hyperstimulated animals was investigated at the protein level. Light and dispersed staining was observed in thecal and stroma cells, but not in granulosa cells of the control group. In the OHSS group, the granulosa cells of preovulatory follicles were the main targets for VEGF antibody. In agreement with the invasive process taking place after ovulation, we observed a strong staining in the whole corpus luteum, but displaying a gradient with the highest binding in the outer zone. Nonovulating follicles in the OHSS group showed a similar pattern as preovulatory follicles, with positive signal in granulosa cells. Endothelial cells were strongly stained with VEGF antibody. Independently of the group considered, slides treated with VEGF primary antibody showed the strongest staining in the zona pellucida of atretic and preovulatory oocytes, with no significant signal in the negative control.

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

Endocrinology, November 2002, 143(11):4339 – 4348 4343

FIG. 2. RT-PCR detection of ␤-actin and whole VEGF in ovary (A) and mesentery (B) from OHSS, PMSG, and control groups at different time points (6 h before and 0, 2, 24, 48 and 96 h after hCG). After quantification, approximately 20 ␮l PCR products (in the plateau phase) were mixed with 4 ␮l loading buffer and run mixed in the same well, confirming no unspecific products. ␤-Actin (149-bp fragment) and VEGF (131-bp fragment) showed the expected PCR products ( L, 100-bp ladder). Values in the graph indicate the VEGF/␤-actin ratio (mean ⫾ SEM) normalized to the control group (value 1) at each time point. Whole VEGF expression in the OHSS and PMSG groups was significantly higher than that in the control group at any time point. Whole VEGF expression started to increase in the OHSS ovaries 2 h after hCG, reaching significance compared with PMSG after 24 and 48 h. In mesenteric tissue, no differences were found among groups at any time point, as shown in the graphs. *, P ⬍ 0.05 among groups.

Reversal of increased VP using a VEGFR-2 inhibitor

Figure 7 compares VP 48 h after hCG injection in the groups established in the third series of experiments. All groups were compared with the OHSS group, which, as expected, showed a significant (P ⬍ 0.001) increase in VP (31.3 ⫾ 5.4 ␮g EB/100 g body weight) compared with the control group (1.7 ⫾ 1.24 ␮g EB/100 g body weight). Administration of daily injections of SU5416 in the q-24 h group during the ovarian hyperstimulation protocol, but not after hCG, did not reverse the increased VP (17.9 ⫾ 4.30 ␮g EB/100 g body weight). However injections of SU5416 every 48 h in the q-48 h group significantly inhibited (6.0 ⫾ 2.3 ␮g EB/100

g body weight; P ⬍ 0.05) the enhancement in VP induced by hCG. The same was true, but to a lesser extent, for the p-hCG group that received two injections of SU5416, one at the same time and the other 24 h after hCG administration (10.5 ⫾ 3.2 ␮g EB/100 g body weight; P ⬍ 0.05). Discussion

The OHSS experimental model used in the present study was interesting because of the homology between human and rat VEGF systems (19, 20), and because it has been previously used with success (28). More importantly, we learned that immature rats behave similarly to humans in the

4344

Endocrinology, November 2002, 143(11):4339 – 4348

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

FIG. 3. Ovarian and mesenteric ␤-actin (A) and VEGF (B) in the OHSS group were run independently, showing no unspecific amplification. PCR products from the standard curve were mixed in the same well showing ␤-actin (149 bp) and VEGF (131 bp) bands. Values in the graph indicate the VEGF/␤-actin ratio (mean ⫾ SEM) normalized to the lowest value, 1, assigned to mesentery. VEGF levels in ovary were significantly higher than mesentery levels at each time point. *, P ⬍ 0.05; **, P ⬍ 0.01.

FIG. 4. Vascular permeability measured 48 h after hCG or saline. Control (n ⫽ 8), ovariectomized (Ovar; n ⫽ 8), and ovariectomized and hyperstimulated (Ovar ⫹ OHSS; n ⫽ 8) animals were compared with the OHSS group (n ⫽ 8) using a nonparametric Mann-Whitney test. ***, P ⬍ 0.001.

sense that only the administration of hCG was able to induce a dramatic increase in VP and ascites, both unequivocal signs of OHSS (13). Thus, the work presented herein may be a valid model as a first step to apply a similar approach in humans. The relevance of hCG in increasing capillary permeability was observed 2 h after hCG administration and peaked after 48 h. Interestingly, it was coincidental in time with the maximal expression of VEGF mRNA in the ovary. The link between VEGF and increased VP was further supported by the inhibitory experiments employing SU5416, in which we showed that the vascular changes can be prevented to a great extent by targeting the Flk-1/KDR receptor. Therefore, the present experiments show for the first time in vivo a close

relationship between increased VEGF expression and capillary permeability in the OHSS model. The fact that an increase in VEGF expression in both groups of stimulated animals was actually observed before a significant increase in VP suggests that other vasoactive substances may be involved in the early stages of OHSS. However, the coincidence in timing of VEGF expression and increased VP after 48 h and the inhibitory effects on VP of a VEGFR-2 inhibitor show a clear relationship between both phenomena after 2 d. This is of clinical relevance because OHSS first appears 3– 6 d after hCG (33), emphasizing the role of molecules active 48 h after hCG, such as VEGF. Several studies suggest an ovarian origin of the mediator

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

Endocrinology, November 2002, 143(11):4339 – 4348 4345

FIG. 5. RT-PCR detection of VEGF isoforms in ovary (A) and mesentery (B) biopsies using primers that encompass the splice site in the VEGF sequence. The expected PCR products for VEGF188, VEGF164, and VEGF120 were 635, 563, and 431 bp. Control (EC), PMSG (P), and OHSS (O) groups expressed the three major isoforms (VEGF120, VEGF164, and VEGF188) in mesentery biopsies, whereas only VEGF120 and VEGF164 could be detected in ovarian biopsies. L, Ladder. No changes in expression patterns were observed.

and ascitic fluid present in OHSS (34, 35). In hyperstimulated women the ovary is also the source of VEGF and other cytokines (36, 37). The granulosa-luteinized cells of the ovarian follicle seem to be the main source of VEGF in response to hCG (6). Our studies (12) have shown that the endothelium has hCG receptors and responds to this gonadotropin by releasing VEGF and increasing the amount of KDR receptors present in the cell surface, suggesting that endothelial cells may be also involved in the pathogenesis of OHSS. Thus, provided that the ovary is involved in the pathogenesis of increased VP, the granulosaluteinized cell may not be the only source of VEGF. To clarify this issue in our model, we analyzed the expression of VEGF in a highly vascularized tissue, the mesentery, compared with that in ovaries of hyperstimulated rats. We found that hCG induced a significant increase in VEGF mRNA expression in the ovaries coincidental with peak VP, whereas the mesenteric contribution to VEGF mRNA expression did not change over time. To further prove our findings, we measured VP in ovariectomized animals after the administration of PMSG and hCG. No increase in VP was observed in the absence of the ovaries. This experiment does not exclude that other ovarian vasoactive substances, acting shortly after hCG administration, could

also be removed from the circulation, but prove the ovarian origin of VEGF responsible for increased VP after 48 h. The corpus luteum should be the source of VEGF (20). Employing immunohistochemistry, we further explored this issue in hyperstimulated animals. Both endothelial and granulosa-luteinized cells showed a positive signal. The endothelial cells of the neovascularized corpus luteum stained particularly high for VEGF. As VEGF is expressed and produced in granulosa-luteal cells (5–10), this finding could be interpreted as a coparticipation of endothelial cells in this biological function, but also could be the result of a rapid release of VEGF from the granulosa cells on the vessels. It was surprising to observe the strong staining in the zona pellucida of the oocyte in atretic or preovulatory follicles. Further experiments employing in situ hybridization will clarify whether VEGF is produced in the oocyte. Only the VEGF121 and VEGF165 isoforms are expressed in ovarian tissue, as shown in normal and malignant human ovary (8, 17) and in women with OHSS (13). This is in accordance with our rat model, in which we observed that, independently of the group analyzed, the ovaries only expressed these isoforms (VEGF120 and VEGF164), whereas the mesentery expressed all of the major VEGF isoforms. Taken

4346

Endocrinology, November 2002, 143(11):4339 – 4348

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

FIG. 6. Immnuhistochemistry with human hemangiosarcoma tissue as a positive control (A) showing strong staining and with a negative control (B) after omitting primary antibody corresponding to the ovary of an OHSS animal 48 h after hCG treatment. Animals not treated with hormones in the control group 24 h after the last saline injection (C) showed dispersed staining in stroma (st). A preovulatory follicle in a hyperstimulated ovary 0 h after hCG (D) shows strong staining in granulosa (gr) cells and, to a lesser extent, in theca (th), as shown in detail in E. Hyperstimulated ovaries 24 h after hCG (F) show a corpus luteum (CL) formation (F) and detail (G) of the directed staining from outer to inner. Whole staining in granulosa lutein and endothelial cells from corpora lutea 48 h after hCG (H) contrasts with detail (I) of a nonovulating follicle showing strongest VEGF staining in zona pellucida (zp). Corpus luteum 96 h after hCG (J) shows a staining gradient with more intensity in the outer zone of the corpus luteum and in the surrounding and endothelial cells (K) of blood vessels (v). Magnifications, ⫻200 (B, C, D, F, H, and J) and ⫻500 (A, E, G, I, and K).

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

Endocrinology, November 2002, 143(11):4339 – 4348 4347

FIG. 7. VP values in the five groups studied in the series of blocking experiments. VP was significantly inhibited after SU5416 administration in the OHSS inhibition groups q-48 h and p-hCG. The asterisks indicate significant differences between the OHSS and the remaining groups: *, P ⬍ 0.05; ***, P ⬍ 0.001.

together, these findings indicate that the changes in VP related to VEGF were based on the variation in the quantity, not the pattern, of expression of the VEGF isoforms and suggest that the augmented expression of VEGF120 and VEGF164 isoforms in the ovary is responsible for the increased VP in OHSS. VEGF stimulation of KDR/Flk-1 is known to result in phosphorylation of the Src family of protein kinases (38) starting KDR signal transduction implicated in the development of endothelial reorganization, membrane ruffling, and chemotactic contraction (22). These morphological changes have often been observed in endothelial monolayers undergoing barrier changes in response to inflammatory mediators, implying that KDR-triggered intracellular cascade of events could be involved in the permeability response to VEGF (39 – 41). SU5416 is a novel synthetic compound that was developed to inhibit KDR signaling in different cancers by avoiding the initial VEGFR-2 phosphorylation. Increasing doses of SU5416, administered in a murine cancer model, showed a significant dose-dependent decrease in tumor growth and VP, with the best results at a nontoxic dose of 25 mg/kg䡠d (42). SU5416 treatment does not affect surface expression of Flk-1/KDR or the affinity of the receptor for VEGF. Instead, the durability of the activity of SU5416 is attributable to its long-lasting ability to specifically inhibit VEGF-dependent phosphorylation of Flk-1/KDR and subsequent downstream signaling, but SU5416 is not an irreversible inhibitor of Flk-1/KDR tyrosine kinase (43). Although Flk-1/KDR is probably up-regulated in the gonadotropin-treated animals (12), the massive doses of SU5416 administered (25 mg/kg) prevented the possibility of any appreciable effect due to up-regulation (42). SU5416 abolished the possibility of Src activation, posterior signal transduction, and the consequent vascular leakage, thus avoiding OHSS symptoms as seen by the significant blockage obtained in groups q48 and p-hCG. A very interesting point is that the administration of SU5416 during ovarian stimulation with PMSG, but not after the hCG injection, was unable to block increasing permeability as seen in the q-24 h group. This finding agrees with the fact that OHSS appears in humans during the luteal phase after hCG administration (6, 13) and suggests that temporary inhibition of VEGFR-2 previous to hCG injection may not be a valid strategy to avoid the onset of the syndrome. Contrarily, the administration of SU5416 in q48 and p-hCG

groups effectively reversed the increased VP, implying that injection of this compound after hCG may be critical to block increasing permeability in the OHSS. These observations open the possibility of establishing an effective treatment with a single injection of SU5416, avoiding the possible toxic effects of a longer inhibitory treatment (44). The ability to reverse hCG action on VP by targeting the VEGFR-2 employing SU5416 not only supported the key role of VEGF in OHSS, but also provided new insights into the development of strategies to prevent and treat the syndrome based on its pathophysiological mechanism rather than using empirical approaches as we do today. In fact, tumor growth, neoangiogenesis, and ascites formation have been prevented in animals with different ovarian neoplasms targeting the VEGF system (25–27, 45– 49), specifically the Flk-1 receptor with SU5416 (42, 50). Herein, we present evidence that the same approach can be used in the OHSS model. Acknowledgments The authors acknowledge Julio Martin for his help with the molecular biology experiments, and Inma Nogueras for her teaching and advice concerning animal handling. Received February 20, 2002. Accepted July 18, 2002. Address all correspondence and requests for reprints to: Antonio Pellicer, M.D., FIVIER, Guardia Civil 23, esc 6. pta 7, Valencia 46020, Spain. E-mail: [email protected] This work was supported by FISs 01-0191 and Fundacio´ n Salud 2000.

References 1. Pellicer A, Albert C, Mercader A, Bonilla-Mussoles F, Remohi J, Simon C 1999 The pathogenesis of ovarian hyperstimulation syndrome: in vivo studies investigating the role of interleukin (IL)-1␤, IL-6 and vascular endothelial growth factor (VEGF). Fertil Steril 7:482– 489 2. Agrawal R, Tan SL, Wild S, Sladkevicius P, Engmann L, Payne N, Bekir J, Campbell S, Conway G, Jacobs H 1999 Serum vascular endothelial growth factor concentrations in in-vitro fertilization cycles predict the risk of ovarian hyperstimulation syndrome. Fertil Steril 71:287–293 3. Abramov Y, Barac V, Nisman B, Schenker JG 1997 Vascular endothelial growth factor plasma levels correlate to the clinical picture in severe ovarian hyperstimulation syndrome. Fertil Steril 67:261–265 4. Chen CD, Wu MY, Chen HF, Chen SU, Ho HN, Yang YS 1999 Prognostic importance of serial cytokine changes in ascites and pleural effusion in women with severe ovarian hyperstimulation syndrome. Fertil Steril 72:286 –292 5. Yan Z, Weich HA, Bernart W, Breckwoldt M, Neulen J 1993 Vascular endothelial growth factor (VEGF) messenger ribonucleic acid (mRNA) expression in luteinized human granulosa cells in vitro. J Clin Endocrinol Metab 77:1723–1725 6. Neulen J, Yan Z, Raczek S, Weindel K, Keck C, Weich HA, Marme D, Breckwoldt M 1995 Human chorionic gonadotropin-dependent expression of vascular endothelial growth factor/VP factor in human granulosa cells: im-

4348

7. 8.

9.

10. 11. 12. 13. 14. 15. 16. 17. 18.

19.

20. 21. 22. 23. 24. 25.

26. 27.

28. 29. 30. 31.

Endocrinology, November 2002, 143(11):4339 – 4348

portance in ovarian hyperstimulation syndrome. J Clin Endocrinol Metab 80:1967–1971 Gordon JD, Mesiano S, Zaloudek CJ, Jaffe RB 1996 Vascular endothelial growth factor localization in human ovary and fallopian tubes: possible role in reproductive function and ovarian cyst formation. J Clin Endocrinol Metab 81:353–359 Otani N, Minami S, Yamoto M, Shikone T, Otani H, Nishiyama R, Otani T, Nakano R 1999 The vascular endothelial growth factor/fms-like tyrosine kinase system in human ovary during the menstrual cycle and early pregnancy. J Clin Endocrinol Metab 84:3845–3851 Yamamoto S, Konishi I, Tsuruta Y, Nanbu K, Mandai M, Kuroda H, Matsushita K, Hamid AA, Yura Y, Mori T 1997 Expression of vascular endothelial growth factor (VEGF) during folliculogenesis and corpus luteum formation in the human ovary. Gynecol Endocrinol 11:371–381 Goldsman MP, Pedram A, Domı´nguez CE, Ciuffardi I, Levin E, Asch RH 1995 Increased capillary permeability induced by human follicular fluid: a hypothesis for an ovarian origin of the hyperstimulation syndrome. Fertil Steril 63:268 –272 McClure N, Healy DL, Rogers PA, Sullivan J, Beaton L, Haning Jr RV, Connolly DT, Robertson DM 1994 Vascular endothelial cell growth factor as permeability agent in ovarian hyperstimulation syndrome. Lancet 344:235–236 Albert C, Garrido N, Rao CV, Remohı´ J, Simon C, Pellicer A 2002 The role of the endothelium in the pathogenesis of ovarian hyperstimulation syndrome. Mol Hum Reprod 8:409 – 418 Levin ER, Rosen GF, Cassidenti DL, Yee B, Meldrum D, Wisot A, Pedram A 1998 Role of vascular endothelial cell growth factor in ovarian hyperstimulation syndrome. J Clin Invest 102:1978 –1985 Wei MH, Popescu NC, Lerman MI, Merrill MJ, Zimonjic DB 1996 Localization of the human vascular endothelial growth factor gene, VEGF, at chromosome 6p12. Hum Genet 97:794 –779 Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z 1999 Vascular endothelial growth factor (VEGF) and its receptors. FASEB J 13:9 –22 Watkins RH, D’Angio CT, Ryan RM, Patel A, Maniscalco WM 1999 Differential expression of VEGF mRNA splice variants in newborn and adult hyperoxic lung injury. Am J Physiol 276:858 – 867 Olson TA, Mohanraj D, Carson LF, Ramakrishnan S 1994 VP factor gene expression in normal and neoplastic human ovaries. Cancer Res 54:276 –280 Shima DT, Kuroki M, Deutsch U, Ng YS, Adamis AP, DⴕAmore PA 1996 The mouse gene for vascular endothelial growth factor. genomic structure, definition of the transcriptional unit, and characterization of transcriptional and post-transcriptional regulatory sequences. J Biol Chem 271:3877–3883 Burchardt M, Burchardt T, Chen MW, Shabsigh A, de la Taille A, Buttyan R, Shabsigh R 1999 Expression of messenger ribonucleic acid splice variants for the vascular endothelial growth factor in the penis of adult rats and humans. Biol Reprod 60:398 – 404 Phillips HS, Hains J, Leung DW, Ferrara N 1990 Vascular endothelial growth factor is expressed in rat corpus luteum. Endocrinology 127:965–967 De Vries C, Escobedo JA, Ueno H, Houck K, Ferrara N, Williams LT 1992 The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science 255:989 –991 Waltenberger J, Claesson-Welsh L, Siegbahn A, Shibuya M, Heldin CH 1994 Different signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor. J Biol Chem 269:26988 –26995 Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman ML, Schuh AC 1995 Failure of blood island formation and vasculogenesis in Flk1-deficient mice. Nature 376:62– 66 Verheul HM, Hoekman K, Jorna AS, Smit EF, Pinedo HM 2000 Targeting vascular endothelial growth factor blockade: ascites and pleural effusion formation. Oncologist 5(Suppl 1):45–50 Xu L, Yoneda J, Herrera C, Wood J, Killion JJ, Fidler IJ 2000 Inhibition of malignant ascites and growth of human ovarian carcinoma by oral administration of a potent inhibitor of the vascular endothelial growth factor receptor tyrosine kinases. Int J Oncol 16:445– 454 Yukita A, Asano M, Okamoto T, Mizutani S, Suzuki H 2000 Suppresion of ascites formation and re-accumulation associated with human ovarian cancer by an anti-VPF monoclonal antibody in vivo. Anticancer Res 20:155–160 Kobayashi H, Okada, Asahina T, Gotoh J, Terao T 1998 The kallikrein-kinin system, but not vascular endothelial growth factor, plays a role in the increased VP associated with ovarian hyperstimulation syndrome. J Mol Endocrinol 20:363–374 Ujioka T, Matsuura, Kawano T, Okamura H 1997 Role of progesterone in capillary permeability in hyperstimulated rats. Hum Reprod 12:1629 –1634 Khanna M, Chaturvedi UC, Sharma MC, Pandey VC, Mathur A 1990 Increased capillary permeability mediated by a Dengue virus-induced lymphokine. Immunology 69:449 – 453 Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156 –159 Koos RD 1995 Increased expression of vascular endothelial growth/perme-

Go´ mez et al. • Blockage of VEGFR-2 Inhibits Vascular Permeability

32.

33. 34. 35. 36. 37. 38.

39. 40.

41.

42.

43.

44.

45.

46.

47.

48. 49.

50.

ability factor in the rat ovary following an ovulatory gonadotropin stimulus: potential roles in follicle rupture. Biol Reprod 52:1426 –1435 Conn G, Bayne ML, Soderman DD, Kwok PW, Sullivan KA, Palisi TM, Hope DA, Thomas KA 1990 Amino acid and cDNA sequences of a vascular endothelial cell mitogen that is homologous to platelet-derived growth factor. Proc Natl Acad Sci USA 87:2628 –2632 Dahl Lyons CA, Wheeler CA, Frishman GN, Hackett RJ, Seifer DB, Haning Jr RV 1994 Early and late presentation of the ovarian hyperstimulation syndrome: two distinct entities with different risk factors. Hum Reprod 9:792–799 Doldi N, Bassan M, Fusi F, Ferrari A 1997 In controlled ovarian hyperstimulation, steroid production, oocyte retrieval, and pregnancy rate correlate with gene expression of vascular endothelial growth factor. J Assist Reprod Genet 14:589 –592 Itskovitz-Eldor J, Kol S, Lewit N, Sealey JE 1997 Ovarian origin of plasma and peritoneal fluid prorenin in early pregnancy and in patients with ovarian hyperstimulation syndrome. J Clin Endocrinol Metab 82:461– 464 Schenker JG 1999 Clinical aspects of ovarian hyperstimulation syndrome. Eur J Gynecol Reprod Biol 85:13–10 Rizk B, Aboulghar M, Smitz J, Ron-El R 1997 The role of vascular endothelial growth factor and interleukins in the pathogenesis of severe ovarian hyperstimulation syndrome. Hum Reprod Update 3:255–266 Guo D, Jia Q, Song HY, Warren RS, Donner DB 1995 Vascular endothelial cell growth factor promotes tyrosine phosphorilation of mediators of signal transduction that contain SH2 domains. Association with endothelial cell proliferation. J Biol Chem 270:6729 – 6733 Wu HM, Yuan Y, Zawieja DC, Tinsley J, Granger HJ 1999 Role of phospholipase C, protein kinase C, and calcium in VEGF-induced venular hyperpermeability. Am J Physiol 276:H535–H542 He H, Venema Vj, Gu X, Venema RC, Marrero MB, Caldwell RB 1999 Vascular endothelial growth factor signals endothelial cell production of nitric oxide and prostacyclin through Flk-1/KDR activation of c-Src. J Biol Chem 274:25130 –25135 Gille H, Kowalsky J, Li B, LeCouter J, Moffat B, Zioncheck TF, Pelletier N, Ferrara N 2001 Analysis of biological effects and signalling properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2). A reassessment using novel receptor-specific vascular endothelial growth factor mutants. J Biol Chem 276:3222–3230 Fong TA, Shawver LK, Sun L, Tang C, App H, Powell TJ, Kim YH, Schreck R, Wang X, Risau W, Ullrich A, Hirth KP, McMahon G 1999 SU5416 is a potent and selective inhibitor of the vascular endothelial growth factor receptor (Flk1/KDR) that inhibits tyrosine kinase catalysis, tumor vascularization, and growth of multiple tumor types. Cancer Res 59:99 –106 Mendel DB, Schreck RE, West DC, Li G, Strawn LM, Tanciongco SS, Vasile S, Shawver LK, Cherrington JM 2000 The angiogenesis inhibitor SU5416 has long-lasting effects on vascular endothelial growth factor receptor phosphorylation and function. Clin Cancer Res 6:4848 – 4858 Taraseviciene-Stewart L, Kasahara Y, Alger L, Hirth P, McMahon G, Waltenberger J, Voelkel NF, Tuder RM 2001 Inhibition of the VEGF receptor 2 combined with chronic hypoxia causes cell death-dependent pulmonary endothelial cell proliferation and severe pulmonary hypertension. FASEB J 15:427– 438 Brekken RA, Overholser JP, Stastny VA, Waltenberger J, Minna JD, Thorpe PE 2000 Selective inhibition of vascular endothelial growth factor (VEGF) receptor 2 (KDR/Flk-1) activity by a monoclonal anti-VEGF antibody blocks tumor growth in mice. Cancer Res 60:5117–5124 Wedge SR, Ogilvie DJ, Dukes M, Kendrew J, Curwen JO, Hennequin LF, Thomas AP, Stokes ES, Curry B, Richmond GH, Wadsworth PF 2000 ZD4190: an orally active inhibitor of vascular endothelial growth factor signaling with broad-spectrum antitumor efficacy. Cancer Res 60:970 –975 Wood JM, Bold G, Buchdunger E, Cozens R, Ferrari S, Frei J, Hofmann F, Mestan J, Mett H, O’Reilly T, Persohn E, Rosel J, Schnell C, Stover D, Theuer A, Towbin H, Wenger F, Woods-Cook K, Menrad A, Siemeister G, Schirner M, Thierauch KH, Schneider MR, Drevs J, Martiny-Baron G, Totzke F 2000 PTK787/ZK 222584, a novel and potent inhibitor of vascular endothelial growth factor receptor tyrosine kinases, impairs vascular endothelial growth factor-induced responses and tumor growth after oral administration. Cancer Res 60:2178 –2189 Kozin SV, Boucher Y, Hicklin DJ, Bohlen P, Jain RK, Suit HD 2001 Vascular endothelial growth factor receptor-2-blocking antibody potentiates radiationinduced long-term control of human tumor xenografts. Cancer Res 61:39 – 44 Bold G, Altmann KH, Frei J, Lang M, Manley PW, Traxler P, Wietfeld B, Bruggen J, Buchdunger E, Cozens R, Ferrari S, Furet P, Hofmann F, MartinyBaron G, Mestan J, Rosel J, Sills M, Stover D, Acemoglu F, Boss E, Emmenegger R, Lasser L, Masso E, Roth R, Schlachter C, Vetterli W 2000 New anilinophthalazines as a potent and orally well absorbed inhibitors of the VEGF receptor tyrosine kinases useful as antagonists of tumor-driven angiogenesis. J Med Chem 43:2310 –23l Vajkoczy P, Menger MD, Vollmar B, Schilling L, Schmiedek P, Hirth KP, Ullrich A, Fong TA 1999 Inhibition of tumor growth, angiogenesis, and microcirculation by the novel Flk-1 inhibitor SU5416 as assessed by intravital multi-fluorescence videomicroscopy. Neoplasia 1:31– 41

Suggest Documents