World Journal of Microbiology and Biotechnology

World Journal of Microbiology and Biotechnology Volume 21, Number 4, June 2005,pp 389-617

Production of rosmarinic acid byLavandula vera MM cell suspension in bioreactor: effect of dissolved oxygen concentration and agitation 10.1007/s11274-004-3982-6 Atanas I. Pavlov, Milen I. Georgiev and Mladenka P. Ilieva 389-392

Thailand habitats as sources of pullulan-producing strains of Aureobasidium pullulans 10.1007/s11274-004-2237-x S. Prasongsuk, R. F. Sullivan, M. Kuhirun, D. E. Eveleigh and H. Punnapayak 393-398

Optimization of medium constituents and fermentation conditions for the production of ethanol from palmyra jaggery using response surface methodology 10.1007/s11274-004-2461-4 B. V. V. Ratnam, S. Subba Rao, Damodara Rao Mendu, M. Narasimha Rao and C. Ayyanna 399-404

Dye decolorization by Trametes hirsuta immobilized into alginate beads 10.1007/s11274-004-1763-x Alberto Domínguez, Susana Rodríguez Couto and Mª Ángeles Sanromán 405-409

Stabilization of a truncated Bacillus sp. strain TS-23 α-amylase by replacing histidine-436 with aspartate 10.1007/s11274-004-1764-9 Huei-Fen Lo, Ya-Hui Chen, Nai-Wan Hsiao, Hsiang-Ling Chen, Hui-Yu Hu, Wen-Hwei Hsu and Long-Liu Lin 411-416

Development of diagnostic test methods for detecting key wildlife pathogens in bacteria-containing commercial biodegradation products 10.1007/s11274-004-1765-8 Jennifer A. Sibley, Rebecca H. Cross, Anita L. Quon, Kara Dutcyvich, Tomas A. Edge, Frederick A. Leighton and Greg D. Appleyard 417-423

A study of polynucleotide phosphorylase production by Escherichia coli in a hollow fibre reactor 10.1007/s11274-004-1890-4 Shi-Jian Nie, Lin Ma, Lian-Xiang Du and Bei-Zhong Han 424-428

Optimization of carotenoid production by Rhodotorula glutinis using statistical experimental design 10.1007/s11274-004-1891-3 P. K. Park, D. H. Cho, E. Y. Kim and K. H. Chu 429-434

Purification and characterization of lignin peroxidases from Penicillium decumbens P6 10.1007/s11274-004-1876-2 JinShui Yang, HongLi Yuan, HeXiang Wang and WenXin Chen 435-440

Growth and survival potentials of immobilized diazotrophic cyanobacterial isolates exposed to common ricefield herbicides 10.1007/s11274-004-1877-1 Surendra Singh and Pallavi Datta 441-446

Characterization of a wine-like beverage obtained from sugarcane juice 10.1007/s11274-004-1878-0 Yadira Rivera-Espinoza, Elsa Valdez-López and Humberto Hernández-Sánchez 447-452

A novel Candida glycerinogenes mutant with high glycerol productivity in high phosphate concentration medium 10.1007/s11274-004-1879-z Bin Zhuge, Xue-Na Guo, Crispen Mawadza, Hui-Ying Fang, Xue-Ming Tang, Xi-Hong Zhang and Jiang Zhuge 453-456

Oxidation of carbonyl compounds by whole-cell biocatalyst 10.1007/s11274-004-2467-y K. R. Gawai, P. D. Lokhande, K. M. Kodam and I. Soojhawon 457-461

Regulation of synthesis of endo-xylanase and β-xylosidase in Cellulomonas flavigena: a kinetic study 10.1007/s11274-004-2396-9 M. Ibrahim. Rajoka 463-469

Improved productivity of β-fructofuranosidase by a derepressed mutant of Aspergillus niger from conventional and non-conventional substrates 10.1007/s11274-004-1995-9 M. I. Rajoka and Amber Yasmeen 471-478

Antimicrobial study of pyrazine, pyrazole and imidazole carboxylic acids and their hydrazinium salts 10.1007/s11274-004-2041-7 T. Premkumar and S. Govindarajan 479-480

Decolorization of azo dyes using Basidiomycete strain PV 002 10.1007/s11274-004-2047-1 Pradeep Verma and Datta Madamwar 481-485

Effect of cultivation conditions on invertase production by hyperproducing Saccharomyces cerevisiae isolates 10.1007/s11274-004-2612-7 Ikram-ul-Haq, Mirza Ahsen Baig and Sikander Ali 487-492

Antibiotic resistance and survival of faecal coliforms in activated sludge system in a semi-arid region (Beni Mellal, Morocco) 10.1007/s11274-004-2613-6 S. Fars, K. Oufdou, A. Nejmeddine, L. Hassani, A. Ait. Melloul, K. Bousselhaj, O. Amahmid, K. Bouhoum, H. Lakmichi and N. Mezrioui 493-500

Diphenolases from Anoxybacillus kestanbolensis strains K1 and K4

T

10.1007/s11274-004-2392-0 Melike Yildirim, Melek Col, Ahmet Colak, Saadettin Güner, Sabriye Dülger and Ali Osman Beldüz 501-507

Utilization of vegetable oil in the production of clavulanic acid by Streptomyces clavuligerusATCC 27064 10.1007/s11274-004-2393-z G. L. Maranesi, A. Baptista-Neto, C. O. Hokka and A. C. Badino 509-514

Cytogenetic analysis of metaphase chromosomes from pupal testes of four mosquito species using fluorescence in situ hybridization technique (FISH) 10.1007/s11274-004-2394-y Fatma A. E. Sallam and Refaat G. Abou El Ela 515-518

Evaluation of agro-food byproducts for gluconic acid production by Aspergillus niger ORS-4.410 10.1007/s11274-004-2395-x O. V. Singh, N. Kapur and R. P. Singh 519-524

A comparative evaluation of oxygen mass transfer and broth viscosity using Cephalosporin-C production as a case strategy 10.1007/s11274-004-3489-1 Punita Mishra, Pradeep Srivastava and Subir Kundu 525-530

Immobilized cells cultivated in semi-continuous mode in a fluidized bed reactor for xylitol production from sugarcane bagasse 10.1007/s11274-004-3490-8 J. C. Santos, S. S. Silva S. I. Mussatto, W. Carvalho and M. A. A. Cunha 531-535

Physiological responses of pressed baker’s yeast cells pre-treated with citric, malic and succinic acids 10.1007/s11274-004-3136-x Maristela F. S. Peres, Claudia R. C. S. Tininis, Crisla S. Souza, Graeme M. Walker and Cecilia Laluce 537-543

Enhancing biological nitrogen removal from tannery effluent by using the efficient Brachymonas denitrificans in pilot plant operations 10.1007/s11274-004-3272-3 Seyoum Leta, Fassil Assefa and Gunnel Dalhammar 545-552

Anti-Helicobacter pylori substances from endophytic fungal cultures 10.1007/s11274-004-3273-2 Y. Li, Y. C. Song, J. Y. Liu, Y. M. Ma and R. X. Tan 553-558

Preliminary research of the RAPD molecular marker-assisted breeding of the edible basidiomycete Stropharia rugoso-annulata 10.1007/s11274-004-3271-4 Pei-Sheng Yan and Jia-Hui Jiang 559-563

Determination of poly-β-hydroxybutyrate (PHB) production by some Bacillus spp. 10.1007/s11274-004-3274-1 Mirac Yilmaz, Haluk Soran and Yavuz Beyatli 565-566

Negative effects of oil spillage on beach microalgae in Nigeria 10.1007/s11274-004-3910-9 J. P. Essien and S. P. Antai 567-573

Production of alkali-tolerant cellulase-free xylanase by Pseudomonas sp. WLUN024 with wheat bran as the main substrate 10.1007/s11274-004-3491-7 Zheng-Hong Xu, Yun-Ling Bai, Xia Xu, Jing-Song Shi and Wen-Yi Tao 575-581

Studies on antagonistic marine actinomycetes from the Bay of Bengal 10.1007/s11274-004-3493-5 Sujatha Peela, VVSN Bapiraju Kurada and Ramana Terli 583-585

Protein fingerprinting profiles in different strains of Aeromonas hydrophila isolated from diseased freshwater fish 10.1007/s11274-004-3909-2 Basanta Kumar Das, Surya Kanta Samal, Biswa Ranjan Samantaray and Prem Kumar Meher 587-591

Application of response surface methodology in medium optimization for spore production of Coniothyrium minitans in solid-state fermentation 10.1007/s11274-004-3492-6 Xin Chen, Yin Li, Guocheng Du and Jian Chen 593-599

Cultivation of oyster mushrooms (Pleurotus spp.) on various lignocellulosic wastes 10.1007/s11274-004-3494-4 Q. A. Mandeel, A. A. Al-Laith and S. A. Mohamed 601-607

Production of tannase by Aspergillus niger HA37 growing on tannic acid and Olive Mill Waste Waters 10.1007/s11274-004-3554-9 H. Aissam, F. Errachidi, M. J. Penninckx, M. Merzouki and M. Benlemlih 609-614

The influence of tapioca on the growth, the activity of glucoamylase and pigment production of Monascus purpureus UKSW 40 in soybean-soaking wastewater 10.1007/s11274-004-1892-2 Kris H. Timotius 615-617

Springer 2005

World Journal of Microbiology & Biotechnology (2005) 21:389–392 DOI 10.1007/s11274-004-3982-6

Production of rosmarinic acid by Lavandula vera MM cell suspension in bioreactor: effect of dissolved oxygen concentration and agitation Atanas I. Pavlov, Milen I. Georgiev and Mladenka P. Ilieva* Department of Microbial Biosynthesis and Biotechnologies – Laboratory in Plovdiv, Institute of Microbiology, Bulgarian Academy of Sciences, 26 Maritza Blvd., 4002 Plovdiv, Bulgaria *Author for correspondence: Tel.: +359-32-642-430, Fax: +359-2-8-700-109, E-mail: [email protected]

Keywords: Agitation, bioreactor, dissolved oxygen, Lavandula vera MM, rosmarinic acid

Summary The relationship between dissolved oxygen (DO) concentration, agitation rate and growth of Lavandula vera MM and rosmarinic acid biosynthesis was investigated in 3 l laboratory bioreactor. Lavandula vera MM cell suspension accumulated the highest amounts of biomass (34.8 g/l) and rosmarinic acid (1870.6 mg/l) on day 12 of cultivation at 50% dissolved oxygen and agitation speed 100 rpm and at 30% dissolved oxygen and agitation speed 300 rpm, respectively.

Introduction The scaling up of plant cell suspensions to large culture volumes, while keeping their biosynthetic potential, represents a critical stage in the production of secondary metabolites (Godoy-Hernandez et al. 2000). The main problems that appeared after transfer of plant cells from flasks to bioreactor include slow growth rate, physiological heterogeneity, genetic instability, low metabolic content and product secretion (Zhong 2001). Dissolved oxygen (DO) concentration and agitation speed are two of the most important factors for growth and accumulation of secondary metabolites by plant cell cultures (Schlatmann et al. 1995; Su et al. 1995; Huang et al. 2002; Luo et al. 2002). The quantity of inlet air must be sufficient to provide enough oxygen for the growth of the cells and the production of secondary metabolites, but an oversupply of oxygen can repress cell growth and secondary metabolite formation (Huang et al. 2002). However, oxygen consumption by different plant cells in batch culture does not show a constant value (Doran 1993). The sufficient agitation is substantial for ensuring the effective mass transfer in bioreactor with respect to biomass and nutrient of medium (Zhong et al. 2002). The rotation speed of the impeller must be optimal for growth and secondary metabolite production (Huang et al. 2002). The cell culture Lavandula vera MM is a` promising producer of rosmarinic acid (Ilieva & Pavlov 1997), which possess high antioxidant, antimicrobial and antiviral activity (Parnham & Kesselring 1985). As a result of investigation of physiological peculiarities of

L. vera MM and further optimization of nutrient medium, an amount of 1786.7 mg rosmarinic acid/l was achieved under cultivation in flasks (Pavlov et al. 2000). The aim of the present work is to investigate the influence of DO concentration and agitation speed on growth and rosmarinic acid biosynthesis by L. vera MM in 3 l bioreactor.

Materials and methods Plant cell culture and culture conditions Lavandula vera MM callus culture was maintained in a Linsmayer–Skoog (LS) agar nutrient medium (Linsmayer & Skoog 1965), supplemented with 30 g sucrose/l and 0.2 mg 2,4-dichlorphenoxyacetic acid/l. The cell suspension of L. vera MM was grown in LS medium of the same composition. The inoculum was obtained by cultivation of cell suspension for 7 days in conical flasks (500 ml) with 1/5 net volume, on a shaker (11.6 rad/s), in the dark, at 26 C. The inoculation was performed with 20% (v/v) cell suspension. Bioreactor cultivation A 3 l bioreactor (New Brunswick, BioFlo 110) with 2.25 l working volume, supplied with propeller impeller and ‘Four-gas mix device’ (New Brunswick, M12730055) were used. Before cultivation, 1.80 l of LS modified medium (Pavlov et al. 2000) was loaded into the bioreactor vessel. Bioreactor experiments were performed under temperature 26 C.

390

A.I. Pavlov et al.

Dry biomass The growth of the L. vera MM cell suspension was monitored by measuring the dry biomass (Dixon 1985). Conductivity was measured by pH/cond meter (INOLAB, WTW, Germany). Rosmarinic acid extraction and determination The rosmarinic acid was extracted from cell biomass with 50% (v/v) ethanol (three times by 20 min) at 70 C. The extract was evaporated to dryness; the dry residue was dissolved in a small volume of 70% (v/v) ethanol and then was stored for 24 h at –10 C. The obtained precipitate was separated by filtration and filtrate was used for determination of RA. The determination was performed spectrophotometrically at 327 nm (Lopez-Arnaldos et al. 1995) using spectrophotometer Shimadzu UV/VIS 1240.

Results and discussion Effect of dissolved oxygen on growth and rosmarinic acid biosynthesis by L. vera MM

5

30

4 3 2 1

1200 1000 800

25

600

20 15

400

10 200

5

0

0

(b) 7

40

6

35

5

30

0 0

2

4

6

8

10

12

4 3 2

1200 1000 800

25

600

20 15

400

10

1

5

0

0

14

200 0 0

2

Time (days)

4 3 2

1000 800

25

600

20 15

400

10

1

5

0

0

200 0 0

2

4

6

8

Time (days)

10

12

14

(d)

7

40

6

35

5

30

4 3 2

Dry weight (g/l)

30

1200

Conductivity (mS/cm)

5

6

8

10

12

14

Time (days)

Rosmarinic acid (mg/l)

35 Dry weight (g/l)

40

6


(c) 7

4

1200 1000 800

25

600

20 15

400

10

1

5

0

0

200


35


40

6 Dry weight (g/l)

(a) 7 Conductivity (mS/cm)

Experiments were performed under the constant agitation speed of 100 rpm. The obtained data,


Analysis

Dry weight (g/l)

The effect of agitation Experiments were performed at a constant DO (30% of air saturation) and impeller speeds – 200, 300 and 400 rpm.

concerning effect of DO on the growth and RA by L. vera MM (Figure 1) shown that the highest amount of biomass (34.8 g/l) was achieved at 50% DO concentration, while at 10, 30 and 40% DO biosynthesized biomasses were 12.7 g/l, 32.0 g/l and 31.8 g/l, respectively. The same dependence (an increase of dry cell weight with increase of DO concentration) was reported for another cell suspension cultures (Luo et al. 2002). However, the maximum amount of biomass was accumulated when the cultivation of L. vera MM cell suspension was performed at 50% dissolved oxygen on day 12 of cultivation, while at 30% and 40% DO, the maximum amounts of biomasses were achieved on day 10 of cultivation. The specific growth rate (l) and doubling time (td) were calculated (Table 1). As it can be seen the best specific growth rate and doubling time (l ¼ 0.0076 1/ h; td ¼ 91 h) were observed for cultivation of L. vera MM at 30% DO. When the cultivation was performed at 30% DO, the highest amount of rosmarinic acid was achieved on day 11 (1073.0 mg/l) (Figure 1b). The produced amounts of rosmarinic acid at DO levels 10, 40 and 50% of air saturation were lower (Figure 1a, c and d). Low levels of DO repressed secondary metabolite production, especially rosmarinic acid production (Figure 1a) and on the other hand over-supply of oxygen suppressed RA production as well (Figure 1d). Kieran et al. (1997) summarized that for plant cell suspension cultures critical DO concentrations are generally assumed to be in the range 15–20% of air saturation. However, Su et al. (1995) established that the most appropriate DO concentration for another producer of RA (Anchusa officinalis) was also 30% of air saturation. So sufficient quantity of dissolved oxygen is essential for secondary metabolite production, but it have to be specifying for every cell culture.


The effect of dissolved oxygen Cultivations were performed at a constant impeller speed (100 rpm) and concentrations of DO – 10, 30, 40 and 50% of air saturation.

0 0

2

4

6

8

10

12

14

Time (days)

Figure 1. Time course of growth (s) of L. vera MM cell suspension, rosmarinic acid accumulation (d) and conductivity changes (() during the cultivation with different dissolved oxygen (DO) concentration levels and constant impeller speed 100 rpm. A – 10% DO; B – 30% DO; C – 40% DO; D – 50% DO. Bars represent standard deviation.

Production of rosmarinic acid by Lavandula vera MM in bioreactor

a b

0.34 0.76 0.70 0.58 0.66 0.69 0.47

· · · · · · ·

10–2 10–2 10–2 10–2 10–2 10–2 10–2

Specific productivity, mg/(l.day)

204 91 99 119 105 100 147

17.2 107.3 85.2 38.4 122.2 155.9 52.2

Impeller speed – 100 rpm. Dissolved oxygen – 30%.

Effect of agitation on growth and rosmarinic acid biosynthesis by L. vera MM

5 4 3 2

2000 1800 1600 1400 1200 1000 800 600 400 200 0

25 20 15 10

1

5

0

0 0

2

4

6

8

10

12

Conclusion In conclusion it has been found that L. vera MM cell suspension culture during its cultivation in bioreactor (impeller speed 300 rpm and DO 30% of air saturation) biosynthesized 1870.6 mg rosmarinic acid/l, which is comparable to those reached in shake-flasks (1786.7 mg rosmarinic acid/l) (Pavlov et al. 2000). This is an

(b) 7

35

6

30


30 Dry weight (g/l)

35

6


(a) 7


For investigation of the influence of agitation, DO level – 30% of air saturation was chosen at which maximum amounts of RA were achieved. As shown in Figure 2 the maximum amount of biomass was accumulated at an impeller speed 200 rpm (32.2 g/l) and it was almost constant to 300 rpm (31.8 g/l). When the impeller speed was increased (from 100 to 300 rpm) the amounts of RA were increased as well (1870.6 mg/l on day 12 of cultivation at 300 rpm). The specific growth rate and doubling time are smaller from those calculated at 30% DO and 100 rpm agitation speed, which can be explained with the mechanical stress and connected with this prolongation of lag-phase of growth (Figure 2b). The calculated specific productivity was highest [155. 88 mg/(l. day)] when cultivation of L. vera MM

5 4 3 2

2000 1800 1600 1400 1200 1000 800 600 400 200 0

25 20 15 10

1

5

0

0 0

14

2

30

3 2

Dry weight (g/l)

35

6


(c) 7

4

6

8

10

12

14

Time (days)

Time (days)

5

4


10% DOa 30% DOa 40% DOa 50% DOa 200 rpmb 300 rpmb 400 rpmb

Doubling time, h

2000 1800 1600 1400 1200 1000 800 600 400 200 0

25 20 15 10

1

5

0

0 0

2

4

6

8


Specific growth rate, 1/h

cell suspension was performed at 300 rpm agitation and 30% DO (Table 1). The reason for this is the balance between hydrodynamic environment in the working volume of the bioreactor (connected with better exchange of oxygen and nutrients between plant cell and culture medium) and the level of shear stress. Further enhancement from 300 to 400 rpm gave obvious reduction on cell growth (23.7 g/l), which probably due to the higher shear stress. Obtained results showed that the agitation rate is very important for both growth of the cells and rosmarinic acid accumulation. Its value has to be optimized: not to high, because of the shear stress, and in the same time not to low, because of the mass transfer in the bioreactor. Based on experiences of microbial biotechnology (especially bioreactor cultivation of bacteria, fungi and etc) the investigators controlled DO using inconstant agitation speeds (Su et al. 1995). However, the changes of agitation speed during cultivation could provoke enhancement of mechanical stress, which corresponds with decrease of cell viability and product biosynthesis. Our results clearly demonstrated that during cultivation of L. vera MM cell suspension DO and agitation speed have to be optimized separately.

Dry weight (g/l)

Table 1. Specific growth rate, doubling time and specific productivity at the cultivation of L. vera MM plant cell culture in 3 l laboratory bioreactor BioFlo 110 /New Brunswick/.

391

10 12 14 16

Time (days)

Figure 2. Time course of growth (s) of L. vera MM cell suspension, rosmarinic acid accumulation (d) and conductivity changes (() during the cultivation at different agitation speeds and constant dissolved oxygen concentration 30%. A – 200 rpm; B – 300 rpm; C – 400 rpm. Bars represent standard deviation.

392 important result since many authors reported that the scale-up from flasks to bioreactor resulted in reducing productivity of secondary metabolites (Schiel & Berlin 1987; Scragg et al. 1987; Rodriguez-Monroy & Galindo 1999; Zhong et al. 1999).

References Dixon, R.A. 1985 Isolation and maintenance of callus and cell suspension cultures. In Plant Cell Culture, a Practical Approach, ed. Dixon, R.A. pp. 1–20. Oxford: Oxford University Press. OX26DP. ISBN 0-947946-22-5. Doran, P.M. 1993 Design of reactors for plant cells and organs. In Advances in Biochemical Engineering/Biotechnology, vol. 48, ed. Fiechter, A. pp. 117–168. Berlin, Heidelberg: Springer-Verlag, ISBN 3-540-56315-6. Godoy-Hernandez, G.C., Vazquez-Flota, F.A. & Loyola-Vargas, V.M. 2000 The exposure to trans-cinnamic acid of osmotically stressed Catharanthus roseus cells cultures in 14-l bioreactor increases alkaloid accumulation. Biotechnology Letters 22, 921–925. Huang, S-Y., Shen, Y-W. & Chan, H-S. 2002 Development of a bioreactor operation strategy for L-DOPA production using Stizolobium hassjoo suspension culture. Enzyme and Microbial Technology 30, 779–791. Ilieva, M. & Pavlov, A. 1997 Rosmarinic acid production by Lavandula vera MM cell-suspension culture. Applied Microbiology and Biotechnology 47, 683–688. Kieran, P.M., MacLoughlin, P.F. & Malone, D.M. 1997 Plant cell suspension cultures: some engineering considerations. Journal of Biotechnology 59, 39–52. Linsmayer, E.M. & Skoog, F. 1965 Organic growth factor requirements of tobacco tissue cultures. Physiology Plantarum 18, 100–127. Lopez-Arnaldos, T., Lopez-Serrano, M., Ros Barcelo, A., Calderon, A.A. & Zapata, J.M. 1995 Spectrophotometric determination of rosmarinic acid in plant cell cultures by complexation with Fe2+ ions. Fresenius Journal of Analytical Chemistry 351, 311–314.

A.I. Pavlov et al. Luo, J., Mei, X.G., Liu, L. & Hu, D.W. 2002 Improved paclitaxel production by fed-batch suspension cultures of Taxus chinensis in bioreactors. Biotechnology Letters 24, 561–565. Parnham, M.J. & Kesselring, K. 1985 Rosmarinic acid. Drugs of future 10, 756–757. Pavlov, A.I., Ilieva, M.P. & Panchev, I.N. 2000 Nutrient medium optimization for rosmarinic acid production by Lavandula vera MM cell suspension. Biotechnology Progress 16, 668–670. Rodriguez-Monroy, M. & Galindo, E. 1999 Broth rheology, growth and metabolite production of Beta vulgaris suspension culture: a copmarative study between cultures grown in shake flasks and in a stirred tank. Enzyme and Microbial Technology 24, 687–693. Schiel, O. & Berlin, J. 1987 Large scale fermentation and alkaloid production of cell suspension cultures of Catharanthus roseus. Plant Cell Tissue and Organ Culture 8, 153–161. Schlatmann, J.E., Vinke, J.L., ten Hoopen, H.J.G. & Heijnen, J.J. 1995 Relation between dissolved oxygen concentration and ajmalicine production rate in high density cultures of Catharanthus roseus. Biotechnology and Bioengineering 45, 435–439. Scragg, A.H., Morris, P., Allan, E.J., Bond, P. & Fowler, M.W. 1987 Effect of scale-up on serpentine formation by Catharanthus roseus suspension cultures. Enzyme and Microbial Technology 9, 619–624. Su, W.W., Lei, F. & Kao, N.P. 1995 High density cultivation of Anchusa officinalis in a stirred-tank bioreactor with in situ filtration. Applied Microbiology and Biotechnology 44, 293–299. Zhong, J.J. 2001 Biochemical engineering of the production of plantspecific secondary metabolites by cell suspension cultures. In Advances in Biochemical Engineering/Biotechnology, Vol. 72, Plant cells, eds. Scheper, T. & Zhong, J.J. pp. 1–26. Berlin, Heidelberg, New York: Springer-Verlag, ISBN 3-540-41849-0. Zhong, J.J., Chen, F. & Hu, W-W. 1999 High density cultivation of Panax notoginseng in stirred bioreactors for the production of ginseng biomass and ginseng saponin. Process Biochemistry 35, 491–496. Zhong, J.J., Pan, Z-W., Wang, Z-Y., Wu, J., Chen, F., Takagi, M. & Yoshida, T. 2002 Effect of mixing time on taxoid production using suspension cultures of Taxus chinensis in a centrifugal impeller bioreactor. Journal of Bioscience and Bioengineering 3, 244–250.

Springer 2005

World Journal of Microbiology & Biotechnology (2005) 21:393–398 DOI 10.1007/s11274-004-2237-x

Thailand habitats as sources of pullulan-producing strains of Aureobasidium pullulans S. Prasongsuk1,2, R.F. Sullivan3, M. Kuhirun2, D.E. Eveleigh3 and H. Punnapayak2,* 1 Biological Science Ph.D. program, Faculty of Science, Chulalongkorn University, Bangkok, Thailand 2 Plant Biomass Utilization Research Unit, Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand 3 Department of Biochemistry and Microbiology, Cook College, Rutgers University, NJ, USA *Author of correspondence: Tel.: +66-2-218-5477, Fax: +66-2-253-0337, E-mail: [email protected] Keywords: Aureobasidium pullulans, exopolysaccharide, pullulan

Summary A variety of habitats were sampled for the presence of Aureobasidium black yeasts with the attempt to find pullulan-producing strains. Habitats included leaves of mango (Mangifera indica Linn.), tamarind (Tamarindus indica Linn.), asoka (Saraca indica Linn.) and latex-painted and bathroom cement-wall surfaces. Parameters for the identification of the isolates included morphology, nutritional parameters, exopolysaccharide (EPS) production, and rDNA internal transcribed spacer (ITS) sequencing. All isolates of black yeasts were polymorphic with blastospores, hyphae, and chlamydospores. ITS analyses showed strong correlation with the GenBank A. pullulans sequences, with alignment using BLAST yielding greater than 95% similarity. All five isolates tested produced pullulan as deduced from infrared spectra and sensitivity to pullulanase. None produced aubasidan as evidenced from their IR spectra. The current studies support the notion that the hot, humid environments facilitate the development of A. pullulans and its tropical variants in diverse phylloplane and walls habitats, and merit support for further isolation and characterization of these black yeasts as a source of unique pullulan-producing strains.

Introduction Aureobasidium pullulans is a yeast-like fungus common in a wide variety of environments from plant leaves to damp indoor surfaces. It is an ascomycetous yeast in the Order Dothideales, Family Dothideaceae. This species comprises two varieties, var. pullulans and var. aubasidani which are distinguished by molecular characteristics, nutritional assimilation patterns, and exopolysaccharide (EPS) structure (Yurlova & De Hoog 1997). This fungus is useful in a range of applications including being a potential source of industrial enzymes (amylase, xylanase, and pectinase), single cell protein, and the polysaccharide gum, pullulan (Deshpande et al. 1992; Leathers 2003). Pullulan, an extracellular linear homopolysaccharide, is composed of repeating maltotriose subunits linked through a-1,6 glucosidic bonds. Pullulan is exploited in various industries including pharmaceutical, food, electronic, and cosmetic companies (Leathers 2003). A. pullulans is well recorded in the temperate-zones; however, in the tropics (such as Thailand), reports are scarce. Tokomasu et al. (1997) found A. pullulans as part of the fungal communities of pine-needle leaf litter on the pine forest of northern Thailand. Punnapayak et al. (2003) isolated airborne A. pullulans from various

locations in Thailand. These appear the only major published reports of this black yeast found in Thailand. Moreover, though a phylloplane colonizer, there are no previous reports on the isolation of A. pullulans from fresh plant leaves or building surface environs in Thailand. In this investigation, this fungus was isolated from diverse phylloplane habitats in Thailand and identified using morphology, nuclear ribosomal DNA internal transcribed spacer (ITS) sequencing, nutritional physiology, and determination of their EPS.

Materials and methods Isolation of fungi Fresh plant leaves (Mangifera indica Linn., Tamarindus indica Linn., Hibiscus rosa-sinensis Linn., Ochna kirkii Oliv., Bougainvillea spectabilis Linn., Saraca indica Linn., Cassia fistula Linn., Eugenia uniflora Linn., Annona squamosa Linn. and Artocarpus heterophyllus Lam.) were collected and disks (0.6 mm) were aseptically cut and placed on selective media plates-Corn Meal Agar (CMA) and Malt Extract Agar (MEA)-half strength. Other fungal habitats sampled included

394 bathroom cement-walls and latex-painted surfaces. Sterile cotton swabs were used for collection and this inoculum was smeared onto selective media plates in triplicate. All cultures were incubated at room temperature (30 C). The initial yeast colonies were purified by using cross-streaking on Potato Dextrose Agar (PDA) and repeated until colony pure cultures were obtained. CMA, MEA, and PDA were from Difco (Detroit, MI). Fungal identification Morphological observation Slide cultures were made using PDA, which were stained with lactophenol-cotton blue and observed by wet mounting using bright field microscopy. The colony characteristics were observed daily. The Aureobasidium strains were compared with the standard strains, A. pullulans ATCC 42023 and NRRL 6992, and the descriptions of Aureobasidium by Barnett & Barry (1998), Domsch et al. (1993), and Hermanides-Nijhof (1977). Nuclear ribosomal DNA internal transcribed spacer (ITS) Sequencing Fresh cells from the A. pullulans cultures were ground in liquid nitrogen and genomic DNA extracted using the Dneasy Plant Protocol (Quiagen, Inc., Valencia, CA). The 5.8S rDNA and flanking ITS regions (ITS1&2) were amplified from 2 ll of undiluted genomic DNA in a 100 ll reaction using the primers ITS5 and ITS4 (White et al. 1990). Each reaction contained 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 12.5 pmol each dNTP, 50 pmol each primer, and 2 U Taq polymerase (Desai & Pfaffle 1995). PCR (25 cycles) was carried out using a GeneAmp 9600 thermocycler (Perkin-Elmer Corporation, Foster City, CA) set to 95 C for 10 s, 56 C for 30 s, and 72 C for 1 min. Initial denaturation was conducted at 95 C for 1 min with a final extension for 10 min at 72 C. Successful PCR products were cleaned of primers and salts, using the QIAquick PCR Purification Kit (Quiagen, Inc., Valencia, CA). ABI PRISM BigDye Terminators v3.0 Cycle Sequencing reactions (Applied Biosystems, Foster City, CA) were prepared according to the manufacturer’s protocol, using primers ITS5 and ITS4 and the PCR product as template (White et al. 1990). Reactions were analysed on an ABI PRISM 3100 Automated DNA Sequencer (Applied Biosystems, FosterCity, CA). Nutritional physiology tests Carbon and nitrogen assimilation were investigated according to Barnett et al. (1990). Inocula were cultivated in the Yeast Malt Broth (YMB) (Difco, Detroit, MI). The carbon (0.5 M, 0.5 ml) or nitrogen source (0.5 M, 0.5 ml) was added to 10 yeast nitrogen base (Difco, Detroit, MI) (0.5 ml) (Difco yeast carbon base for nitrogen assimilation) plus 4 ml of sterile

S. Prasongsuk et al. distilled water. An inoculum (100 ll) of yeast culture (2.5 · 107 cell/ml) was added. Cultures were incubated at 25 C. Distilled water was used as a control. Growth was assessed by cell turbidity of the dispersed mycelium. EPS production and analysis EPS was prepared by growing cultures in a production medium (PM) in shake flasks (100 ml/ 250-ml flask, 150 rev/min, room temperature). PM contained glucose (5%); (NH4)2SO4 (0.06%); K2HPO4 (0.5%); MgSO4.7H2O (0.04%); NaCl (0.1%); and yeast extract (0.04%), with the pH adjusted to 6.5. EPS was recovered after 5 days by removing the yeast mycelium by centrifugation (10,000 · g, 15 min), and precipitating the EPS from the culture supernatant with 95% ethanol (2:1, ethanol:supernatant). EPS was dried at 60 C. The pullulan content was estimated by sensitivity to pullulanase (EC 3.2.1.41) from Klebsiella pneumoniae (Sigma, St. Louis, MO) according to Leathers et al. (1988). The IR spectra were determined using the potassium bromide (KBr) technique on an FTIR spectrometer (Perkin-Elmer, Norwalk, CT). Pullulan (Sigma) was used as the control standard.

Results and discussion Aureobasidium spp. were isolated from different habitats around Thailand including a bathroom cement-wall (isolate BK4), a latex-painted surface (isolate BK6), and leaves of mango (Mangifera indica Linn.) (isolate NRM2), asoka (Saraca indica Linn.) (isolate LB3), and tamarind (Tamarindus indica Linn.) (isolate SK3). The isolates were generally recovered using MEA half strength. Isolate NRM2 were isolated using CMA half strength. Examination of the cell morphology of the isolates by bright field light microscopy showed the classic A. pullulans polymorphology with blastospores, hyphae, and chlamydospores. The colonies grew rapidly, were smooth, slimy, pale pink or cream and became black with time (Figure 1). Isolates NRM2 and SK3 produced a pink and a yellow pigment, respectively, characteristic of so-called ‘colour-variant’ strains (Wickerham & Kurtzman 1975). The colony sizes ranged between 2.86 and 4.75 cm on the MEA after 7 days. Both morphological and colony characteristics corresponded well with the A. pullulans descriptions by Barnett & Barry (1998), Domsch et al. (1993), and Hermanides-Nijhof (1977) and to features of standard strains, ATCC 42023 and NRRL 6992. Sequences for isolates BK4, BK6, NRM2, and LB3 were identical to each other and identical to other A. pullulans sequences in GenBank, including the following: AF121284 (ATCC 42457), AY 139395 (CBS 110373), AY 139393 (CBS 110376), AY 139392 (CBS 110375), AJ244236 (CBS 101160), AY 139391 (CBS 110377),

Pullulan-producing strains of A. pullulans

395

Figure 1. Colony and morphology of Aureobasidium isolates. (A) colony and hypha of isolate BK 4, (B) colony and conidial apparatus of isolate BK6, (C) colony and chlamydospores of isolate NRM2, (D) colony and hypha with conidia of isolate LB3, (E) colony and blastospores of isolate SK3.

AJ244269 (VKPM F-371), AJ276062 (MZ58) and AJ276061 (MZ65). The sequence for SK3 differed slightly from the other four by a single T to A transversion in the ITS1 and a single deletion (T) in the ITS2. Strain SK3 was more similar to sequences for isolates BK4, BK6, NRM2 and LB3 than to any other sequence in GenBank. The sequences were submitted to GenBank with the following accession numbers AY225163, AY225164, AY225165, AY225166, AY225167, respectively for the isolates BK4, BK6, NRM2, SK3, and LB3. The carbon and nitrogen assimilation patterns of the isolates correlated with the assimilation patterns of the control strains (Tables 1 and 2). A diverse range of carbon sources was utilized including cellobiose, dulcitol, fructose, galactose, glucose, glycerol, methyl-a-D glucoside, raffinose, sucrose, xylitol, and xylose, while cellulose, chitin, p-coumaric acid, sodium succinate, and sodium salicylate were not assimilated. Intra-specific variation of Aureobasidium isolates and standard strains was found in assimilation of dulcitol, glucosamine, sodium citrate (Table 1). Okagbue et al. (2001) reported that Zimbabwean isolates of A. pullulans (de Bary) Arnaud utilized a broad range of substrates including cellobiose, glucose, glycerol, sucrose, xylan, and xylose. Other workers reported A. pullulans to utilize cellobiose but not cellulose (Dennis & Buhagiar 1973; De Hoog & Yurlova 1994). Federici (1982) also noted a lack of cellulase activity. Chitinase activity was not detected from this fungus (Federici 1982; De Hoog & Yurlova

1994). The results are in agreement with previous reports in which A. pullulans was distinguished from A. prunorum and Trichosporon pullulans by its ability to utilize glycerol and galactose (Dennis & Buhagiar 1973). De Hoog & Yurlova (1994) noted that A. pullulans could utilize methyl-a-D -glucoside while Hormonema sp. could not. All isolates also utilized lactose and methyl-a- D glucoside, in agreement with the data of A. pullulans var. pullulans (Yurlova & De Hoog 1997). Nitrogen sources that were utilized included L -arginine, creatinine HCl, L -isoleucine, L -lysine, L serine, sodium nitrate, sodium nitrite, and L -tryptophane but not creatine monohydrate, and L -threonine. Cooke & Matsuura (1963) reported that while A. pullulans P-66 assimilated a range of nitrogen sources including amino acids, it could not assimilate L -lysine. In contrast, Cernakova et al. (1980) and De Hoog & Yurlova (1994) stated that many tested strains of A. pullulans were able to utilize L -lysine. General utilization of amino acids is clear (Table 2), though the inability of specific strains to use asparagine, alanine, glutamine, proline, leucine, phenylalanine, and glycine is evident. The EPS of all isolates showed sensitivities to pullulanase between 56 and 97% (Table 3). An apparent correlation between greater pullulan production by the lesser pigmented isolates was observed. This possibility was found by the previous reports (Leathers et al. 1988; West & Reed-Hamer 1993; Punnapayak et al. 2003).

396

S. Prasongsuk et al.

Table 1. Carbon assimilation pattern of Aureobasidium isolates from Thailand. Carbon substrates/Strains

BK4

BK6

SK3

NRM2

LB3

NRRL Y-2311-1a

NRRL Y-7469a

1. Caffeic acid 2. D -Cellobiose 3. Cellulose powder (1% fibrous) 4. Chitin (colloidal) 5. p-Coumaric acid 6. D -Glucose 7. D ulcitol 8. Fructose 9. D -Galactose 10. D -(+)-Glucosamine 11. Glycerol 12. Myo-inositol 13. Lactose 14. Mannitol 15. Methyl-a- D -glucoside 16. Maltose 17. Quinic acid 18. Raffinose 19. Rhamnose 20. Ribose 21. Sodium citrate 22. D )Sorbitol 23. Sodium succinate 24. Sodium acetate 25. Sodium salicylate 26. Starch (soluble) 27. Sucrose 28. Salicin 29. Trehalose 30. D -Xylose 31. D -Xylitol

) +

) +

w +

) +

) +

) +

+

) ) ) + + + + w + + + + + + + + + + ) + ) ) ) + + + + + +

) ) ) + + + + w + + + + + + + + + + ) + ) ) ) + + + + + +

) ) ) + + + + ) w + + + + + + + ) + ) + ) ) ) + + + + + +

) ) ) + + + + ) + + + + + + + + + + ) + ) ) ) + + + + + +

) ) ) + + + + ) + + + + + + + + + + + + ) ) ) + + + + + +

) ) ) + ) + + + w + + + + + + + + + + + ) ) ) + + + + + +

) ) ) + + + + ) w + + + + + + + + + + + ) w ) + + + + + +

a

Standard strains, A. pullulans NRRL Y-2311-1 and A. pullulans NRRL Y-7469. += assimilation, ) = non-assimilation, w = weak assimilation.

Table 2. Nitrogen assimilation pattern of Aureobasidium isolates from Thailand. Nitrogen substrates/Strains

BK4

BK6

SK3

NRM2

LB3

NRRL Y-2311-1a

NRRL Y-7469a

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23.

+ ) ) + w ) + + + + w + + + + + + + + + + + w

w ) ) + w ) + + + + + + + + w + w + + + + + +

+ ) ) + + ) + + + + + + + + + + + + + + + ) +

+ ) + + + ) w + + + ) + + + + + ) ) + + ) + +

+ ) ) + + ) + + + + + + + + + + + ) ) + ) + +

+ ) + + + ) + + + + + + + + + + + + + + + + +

+ ) + + + ) + + + + + + + + + + + + + + + + +

L -Aspartic

acid

L -Threonine L -Asparagine Lysine L -Methionine Creatine monohydrate L -Valine Sodium nitrite Sodium nitrate Creatinine L -Alanine L -Arginine L -Serine L -Tryptophan L -Ornithine L -Glutamic acid L -Glutamine L -Proline L -Leucine L -Isoleucine L -Phenylalanine Glycine L -Histidine

a Standard strains, A. pullulans NRRL Y-2311-1 and A. pullulans NRRL Y-7469. + = assimilation, = non assimilation, w = weak assimilation.

Pullulan-producing strains of A. pullulans Table 3. Pullulan content and degree of pigmentation of the EPS. Isolates

Pullulan content (%)a

Degree of pigmentationb

BK4 BK6 NRM2 LB3 SK3

97 56 61 80 90

+ +++ ++ + +

a % Pullulan content was calculated from the amount of reducing sugar (maltotriose equivalent) released from the reaction between the EPS and pullulanase enzyme. b Degree of pigmentation was determined by visual observation.

Leathers et al. (1988) noted that melanin, which contaminated pullulan, could be inhibitory to pullulanase. The IR spectra of EPS from all isolates were similar to that of the pullulan standard (Figure 2), with a pullulan-like peak at around k ¼ 850 cm)1 which indicates the -configuration within the EPS (Yurlova & De Hoog, 1997). Madi et al. (1997) also reported a peak at k ¼ 859.6 cm)1of EPS from A. pullulans (de Bary) Arnaud (IMI145194) which they interpreted as an configuration. In conclusion, A. pullulans was successfully isolated from distinct habitats in Thailand. This furthers our knowledge of the occurrence of this organism in tropical climates. The A. pullulans isolates were from very different habitats from leaves to painted surfaces. On the basis of morphology, nutritional physiology, ribosomal DNA ITS sequencing, and the types of EPS, all isolates were identified as A. pullulans var. pullulans.

397 Isolates included typical black colonies and colour variants. Although Aureobasidium is ubiquitous, colour variant strains have thus far only been isolated from tropical or subtropical sites. Because of the polymorphism of this fungus, morphological criteria are not sufficient for identification; however, molecular techniques (ITS sequencing) were also unable to resolve the isolates. Differences in nutritional physiology and EPS characterization were useful to define the isolates. All isolates produced a pullulan EPS, a commercial biopolymer gum raising the concept that further Aureobasidium isolates from Thailand should be evaluated for potential commercial exploitation.

Acknowledgement The authors wish to thank The Royal Golden Jubilee (RGJ) Ph.D. grant 4.S.CU/42/Q1 contract number PHD/0143/2542, The Thailand Research Fund and Eveleigh-Fenton fund for the financial support. We thank Cletus P. Kurtzman, Timothy D. Leathers (UDSA, Peoria, IL), James F. White Jr., Marshall Bergen (Plant Pathology/Biology, Rutgers University) for helpful discussion. This research was also supported by the establishment fund of the Plant Biomass Utilization Research Unit, Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok, and the Project for the Promotion of Efficiency and Capability of the National Competition by the Ministry of Education, Thailand.

Figure 2. Infrared (IR) spectra. (a) Pullulan standard (Sigma), (b) EPS from Aureobasidium sp. BK4, (c) EPS from Aureobasidium sp. BK6, (d) EPS from Aureobasidium sp. NRM2, (e) EPS from Aureobasidium sp. LB3, (f) EPS from Aureobasidium sp. SK3.

398 References Barnett, A.J., Payne, W.R. & Yarrow, R. 1990 Yeasts: Characteristics and Identification. Cambridge: Cambridge University Press. ISBN 0521350565. Barnett, H.L. & Barry, B.H. 1998 Illustrated Genera of Imperfect Fungi. Minneapolis: The American Phytopathological Society Press. ISBN 0890541922. Cernakova, M., Kockova-Kratochvilova, A., Suty, L., Zemek, J. & Kuniak, E 1980 Biochemical similarity among strains of Aureobasidium pullulans (de Bary) Arnaud. Folia Microbiologica 25, 68–73. Cooke, W.B. & Matsuura, G. 1963 Physiology studies in the black yeasts. Mycopathologia et Mycologia Applicata 21, 225–271. De Hoog, G.S. & Yurlova, N.A. 1994 Conidiogenesis, nutritional physiology and taxonomy of Aureobasidium and Hormonema. Antonie van Leeuwenhoek 65, 41–54. Dennis, C. & Buhagiar, R.W.M. 1973 Comparative study of Aureobasidium pullulans, A. prunorum sp. nov. and Trichosporon pullulans. Transaction of the British Mycological Society 60, 567– 575. Deshpande, M.S., Rale, V.B. & Lynch, J.M. 1992 Aureobasidium pullulans in applied microbiology: a status report. Enzyme and Microbial Technology 14, 514–527. Desai, U.J. & Pfaffle, P.K. 1995 Single-step purification of a thermostable DNA polymerase expressed in Escherichia coli. Biotechniques 19, 780–784. Domsch, K.H., Gams, W. & Anderson, T. 1993 Compendium of Soil Fungi. London: Academic Press. ISBN 3980308383. Federici, F. 1982 Extracellular enzymatic activities in Aureobasidium pullulans. Mycologia 74, 738–743. Hermanides-Nijhof, E.J. 1977 Aureobasidium and allied genera. Studies in Mycology 15, 141–166. Leathers, T.D. 2003 Biotechnological production and applications of pullulan. Applied Microbiology and Biotechnology 62, 468–473.

S. Prasongsuk et al. Leathers, T.D., Nofsinger, G.W., Kurtzman, C.P. & Bothast, R.J. 1988 Pullulan production by colour variants of Aureobasidium pullulans. Journal of Industrial Microbiology 3, 231–239. Madi, N.S., Harvey, L.M., Mehlert, A. & McNeil, B 1997 Synthesis of two distinct exopolysaccharide fractions by cultures of the polymorphic fungus Aureobasidium pullulans. Carbohydrate Polymers 32, 307–314. Okagbue, R.N., Mwenje, E., Kudanga, T., Siwela, M. & Sibanda, T. 2001 Isolation of Aureobasidium pullulans from Zimbabwean sources and glucosidase activities of selected isolates. South African Journal of Botany 67, 157–160. Punnapayak H., Sudhadham, M., Prasongsuk S. & Pichayangkura, S. 2003 Characterization of Aureobasidium pullulans isolated from airborne spores in Thailand. Journal of Industrial Microbiology and Biotechnology 30, 89–94. Tokumasu, S., Tubaki, K. & Manoch, L. 1997 Microfungal communities on decaying pine needles in Thailand. In Tropical Mycology, edn. Janardhanan, K.K., Rajendran, C., Natarajan, K. & Hawksworth, D.L. pp. 93–106. Bangkok: Science Publishers. ISBN 1886106630. West T.P. & Reed-Hamer, B. 1993 Polysaccharide production by a reduced pigmentation mutant of the fungus Aureobasidium pullulans. FEMS Microbiology Letters 113, 345–350. White, T.J., Bruns, T., Lee, S. & Taylor, J. 1990 Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications, eds. Innis, M.A., Gelfand, D.H., Sninsky, J.J. & White, T.J. pp. 315–322. New York: Academic Press. ISBN 0123721806. Wickerham, L.J. & Kurtzman, C.P. 1975 Synergistic color variants of Aureobasidium pullulans. Mycologia 67, 342–361. Yurlova, N.A. & De Hoog, G.S. 1997 A new variety of Aureobasidium pullulans characterized by exopolysaccharide structure, nutritional physiology and molecular features. Antonie van Leeuwenhoek 72, 141–147.


Ó Springer 2005

Optimization of medium constituents and fermentation conditions for the production of ethanol from palmyra jaggery using response surface methodology B.V.V. Ratnam1,*, S. Subba Rao3, M. Damodar Rao2, M. Narasimha Rao3 and C. Ayyanna3 1 Department of Neurology, Johns Hopkins University School of Medicine, Pathology 233/Meyer 222, 600 North Wolfe Street, Baltimore, MD 21287, USA 2 Department of Pediatrics, Division of Infectious Diseases, Johns Hopkins University School of Medicine, 720 Rutland Avenue, Ross 1135B, Baltimore, MD-21205, USA. Tel: 410 614 0058, Fax: 410 614 1315, e-mail: [email protected] 3 Center for Biotechnology, Department of Chemical Engineering, College of Engineering, Andhra University, Visakhapatnam 530 003, India *Author for correspondence: E-mails: [email protected]/ratnam72@rediffmail.com Keywords: Central composite design (CCD), ethanol, palmyra jaggery, response surface methodology (RSM), Saccharomyces cerevisiae

Summary The quantitative effects of sugar concentration, nitrogen concentration, EDTA, temperature, pH and time of fermentation on ethanol production were optimized using a Box-Wilson central composite design (CCD) experiment. It was found that palmyra jaggery (sugar syrup from the palmyra palm) is a suitable substrate for the production of high concentrations of ethanol using Saccharomyces cerevisiae NCIM 3090 by submerged fermentation. A maximum ethanol concentration of 129.4 g/l was obtained after optimizing media components and conditions of fermentation. The optimum values were a temperature of 26.2 °C, pH of 8.4, time of fermentation of 4.2 days with 398.5 g of substrate/l, 3.1 g of urea/l and 0.51 g of EDTA/l. Thus by using the CCD, it is possible to determine the accurate values of the fermentation parameters where maximum production of ethanol occurs.

Introduction Ethanol is one of the largest volume organic chemicals that are industrially produced. The study of ethanol fermentation has gained importance because of increasing demand for it in recent years as a motor fuel supplement to gasoline. Rapid fermentation and high ethanol levels are desirable to minimize capital costs and distillation energy, while good yields are necessary for process economics. The substrate is the main cost component for industrial ethanol production and it is essential that ethanol production should be carried out with cheap substrates (Lee & Woodward 1983; Elisson et al. 2001). Palmyra jaggery, sugar syrup from the palmyra palm (Borassus flabellifer) is an agricultural product abundantly available in the India, Peninsula and the Northern of Sri Lanka and is an alternative substrate for producing ethanol. To develop a process for the maximum production of ethanol, standardization of media and fermentation conditions is crucial. Medium optimization by the classical method: a single – dimensional search involving changing one variable while fixing the others at a certain level is laborious and time – consuming, especially when the number of variables is large. An alternative and more efficient approach in microbial systems is the use of statistical methods (Duff et al.

1973). Statistical inference techniques can be used to assess the importance of individual factors, the appropriateness of this functional form and sensitivity of the response to each factor (Mason et al. 1989). Recently many statistical experimental design methods have been employed in bioprocess optimization. Among them, response surface methodology (RSM) is the one suitable method for identifying the effect of individual variables and for seeking the optimum conditions for a multivariable system efficiently. This method has been successfully applied to optimize alcoholic fermentation and other fermentation media (Maddox & Reichert 1977; Chen 1981, 1996; Zertuche & Zall 1985; Coteron et al. 1993; Sunitha et al. 1998; Ambati & Ayyanna 2001; Ratnam 2001; Ratnam et al. 2003). A detailed account of this technique has been outlined (Cochran & Cox 1968). Basically, this optimization process involves three major steps: performing the statistically designed experiments, estimating the coefficient in a mathematical model and predicting the response and checking the adequacy of the model. In this study, the RSM approach was adopted to locate optimum levels of substrate concentration, urea concentration, EDTA concentration, temperature, pH and time of fermentation using palmyra jaggery as a substrate, since these parameters play a key role in the enhancement of ethanol yield.

400

B.V.V. Ratnam et al.

Materials and methods Substrate Palmyra jaggery is the dark solid obtained from the sweet today, which is collected from the palmyra tree (Borassus flabellifer) grown in West Godavari District, Andhra Pradesh, India.

80 mesh, manufactured by Nucon Engineers, India) were used. The column oven was operated isothermally at 150 °C and the detector and injection ports were kept at 170 °C. Nitrogen was used as carrier gas at a flow rate of 30 cm3/min and the combustion gas was a mixture of hydrogen and air. Sugars were determined using Miller’s method (1959).

Microorganism

Experimental design and optimization

Saccharomyces cerevisiae NCIM 3090 obtained from National Chemical Laboratory, Pune, India, was used throughout the study.

Central composite experimental design (CCD, Box and Wilson 1951) was used in the optimization of ethanol production. Substrate (X1, g/l), urea (X2, g/l), EDTA (X3, g/l), temperature (X1, °C), pH (X2) and time of fermentation (X3, days) were chosen as the independent variables shown in Tables 1 and 2. Ethanol concentration (Yi, g/l) was used as the dependent output variable. For statistical calculations the variables Xi were coded as xi according to Equation (1)

Growth medium and growth conditions The culture was maintained on agar slants having the composition (%): malt extract 0.3, glucose 1.0, yeast extract 0.3, peptone 0.5 and agar agar 2.0. The pH of the medium was adjusted to 6.4–6.8 and cultures were incubated at 30 °C for 48 h. Production media and fermentation conditions Palmyra jaggery with 70% sugars was used as the sole carbon source for the fermentation and the syrup contains a sugar concentration of 280 g/l. A weighed amount of palmyra jaggery was dissolved in water and sterilized at 121 °C for 15 min. The fermentation was carried out in a Biostat M fermentor supplied by B. Braun Co., Germany with all necessary controls. The reactor was of 2 l capacity and working volume was 1 l. The operating conditions were maintained at a temperature of 30 °C, pH 5.0, stirrer speed 200 rev/min and inoculum size 5% (v/v). Inoculum was prepared in 500-ml flask containing 100-ml fermentation medium by incubating it at 30 °C for 48 h on a rotary shaker. The reactor was maintained under anaerobic conditions without aeration.

Xi ¼ ðXi Xi Þ= DXj ði ¼ 1; 2; 3; . . . ; kÞ

ð1Þ

where, is the dimensionless value of an independent variable, Xi the is real value of an independent variable, xi ; is the real value of the independent variable at the center point and DXj is step change. pffiffiffi A 23-factorial CCD, with six axial points ða ¼ 3Þ and six replications at the center points (n0 ¼ 6) leading to a total number of 20 experiments was employed (Table 2) for the optimization of the constituents of fermentation. The second degree polynomials (Equation (2)) were calculated with the statistical package (Stat-Ease Inc, Minneapolis, MN, USA) to estimate the response of the dependent variable. Yi ¼ b0 þ b1 X1 þ b2 X2 þ b3 X3 þ b11 X12 þ b22 X22 þ b33 X32 þ b12 X1 X2 þ b23 X2 X3 þ b13 X1 X3

ð2Þ

Analytical methods Ethanol was estimated by GC in which a flame ionization detector and stainless steel column (2.0 m length, 3.0 mm i.d.) packed with Porapak-Q (50–

where Yi is the predicted response, X1, X2, X3 are independent variables, b0, is the offset term, b1, b2, b3 are linear effects, b11, b22, b33 are squared effects and b12, b23, b13 are interaction terms.

Table 1. Independent variables in the experimental plan. Variables

Equation 3 Substrate (g/l), X1 Urea (g/l), X2 EDTA (g/l) , X3 Equation 4 Temperature (°C), X1 pH, X2 Time (days), X3

Coded levels )1.682

)1

0

1

1.682

316.9 1.318 0.3318

350 2 0.4

400 3 0.5

450 4 0.6

484.1 4.682 0.6682

16.58 6.318 2.318

20 7 3

25 8 4

30 9 5

33.4 9.682 5.682

401

Ethanol production from palmyra jaggery Table 2. The CCD matrix employed for three independent variables (actual values are given in Table 1). Run no.

X1

X2

X3

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

)1 1 )1 1 0 0 )1 1 )1 1 0 0 )1.682 1.682 0 0 0 0 0 0

)1 )1 1 1 0 0 )1 )1 1 1 0 0 0 0 )1.682 1.682 0 0 0 0

)1 1 1 )1 0 0 1 )1 )1 1 0 0 0 0 0 0 )1.682 1.682 0 0

urea concentration and EDTA concentration of ethanol. Hence these three factors are considered as major constituents of the medium to optimize by keeping the mineral constituents of the medium constant. Using CCD, a total number of 20 experiments with different combinations of substrate, urea, EDTA were performed (Tables 1 and 2). The response was taken at the maximum ethanol production which was observed at 4 days. The results were analysed using the analysis of variance (ANOVA) and v2 test as appropriate to the experimental design being used. The calculated regression equation for the optimization of medium constituents showed that the ethanol production (Yi, g/l) is a function of the concentration of substrate (X1, g/l), urea (X2, g/l) and EDTA (X3, g/l). By applying multiple regression analysis on the experimental data, the following second order polynomial equation was found to represent the ethanol production adequately. Yi ¼ 889:849 þ 5:0625X1 17:642X2 þ 114:1887X3 0:0068X12 3:1970X22 188:886X32 þ 0:0885X1 X2 þ 4:3687X2 X3 0:1619X1 X3 :

Results and discussion

ð3Þ

Optimization of medium constituents RSM is a sequential procedure with an initial objective of leading the experimenter rapidly and efficiently to the general vicinity of the optimum. Since the location of the optimum is unknown prior to running RSM experiments, it makes sense to have a design that provides equal precision of estimation in all directions is employed. The three factors which influence highly the fermentative production are substrate concentration,

The predicted levels of ethanol production from palmyra jaggery medium using the above equation are given in Table 3 along with experimental data. ‘The goodness of the model can be checked by different criteria’. The coefficient of determination, R2 is 0.9788, implies that 97.88% of the sample variation in the ethanol production is attributed to the independent variables. The R2 value also indicates that the only 1% of the variation is not explained by the model. The value of R is 0.9893. The corresponding analysis of

Table 3. Experimental and predicted yields for ethanol. X1

350 450 350 450 400 400 350 450 350 450 400 400 315.9 484.1 400 400 400 400 400 400

X2

2 2 4 4 3 3 2 2 4 4 3 3 3 3 1.318 4.682 3 3 3 3

X3

0.4 0.6 0.6 0.4 0.5 0.5 0.6 0.4 0.4 0.6 0.5 0.5 0.5 0.5 0.5 0.5 0.3318 0.6682 0.5 0.5

Ethanol yield (g/l) Experimental

Predicted

105.16 96.68 94.19 100.67 121.14 120.59 103.66 94.19 93.19 104.16 122.50 121.77 79.26 69.23 107.96 118.54 117.29 116.61 120.72 122.44

105.37 93.74 97.05 101.84 121.57 121.57 103.51 92.36 97.16 104.97 121.57 121.57 75.66 71.38 111.25 113.79 115.69 116.76 121.57 121.57

402

B.V.V. Ratnam et al.

Table 4. ANOVA for full quadratic model. Source of variation

Sum of squares (SS)

Regression 4385.5 Residual 95.13 Total 4480.6

Degrees of Mean freedom squares (DF) (MS) 9 10 19

487.3 9.5

F value

Probe > F

51.2

0

variance (ANOVA) is presented in Table 4. test was also carried out to check the best fit of the model. The model was a good fit. Since v2cal < v2tab , where v2cat is 0.98 and v2tab is 30.14. The predicted optimum levels of substrate, urea and EDTA were obtained by applying the regression analysis to the Equation (3). The predicted and experimental ethanol production at the optimum levels of medium constituents was also determined by using Equation (3). Figures 1–3 represent the response surface and contour plots for the optimization of medium constituents of ethanol production. The optimum medium constituents for higher metabolic production can be attained at the concentration of 398.5 g of substrate/l, 3.1 g of urea/l and 0.51 g of EDTA/l. At these optimum medium consentrations maximum ethanol production of 125.4 g/l was obtained. Experimental and predicted ethanol production at the optimum levels of media constituents were also determined (Table 7). Optimization of fermentation conditions The most important physical factors which affect the fermentative production of ethanol are the temperature, initial pH and time of fermentation. The suitable levels for these parameters were also determined using statis-

Figure 1. Response surface and contour plot of substrate concentration vs. urea concentration on ethanol production (EDTA was kept constant at 0.5 g/l).

Figure 2. Response surface and contour plot of substrate concentration vs. EDTA concentration on ethanol production (urea was kept constant at 3 g/l).

tical CCD. The experimental design matrix is given in Tables 1 and 2. Twenty experiments were performed using different combinations of the variables as per the CCD. Using the results of the experiments, the following second order polynomial equation giving the ethanol as a function of temperature (X1, °C), pH (X2) and time of fermentation (X3, days) was obtained. Yi ¼ 1394:95 þ 69:9918X1 þ 117:3672X2 þ 53:7724X3 1:0407X12 4:2425X22 6:8737X32 1:8253X1 X2 0:4824X2 X3 0:0216X1 X3

ð4Þ

Figure 3. Response surface and contour plot of urea concentration vs. EDTA concentration on ethanol production (substrate concentration was kept constant at 400 g/l).

403

Ethanol production from palmyra jaggery Table 5. Experimental and predicted yields for ethanol. X1

X2

X3

Ethanol yield (g/l) Experimental Predicted

20 30 20 30 25 25 20 30 20 30 25 25 16.58 33.4 25 25 25 25 25 25

7 7 9 9 8 8 7 7 9 9 8 8 8 8 6.318 9.682 8 8 8 8

3 5 5 3 4 4 5 3 3 5 4 4 4 4 4 4 2.318 5.682 4 4

45.44 99.27 80.4 101.75 124.72 125.00 47.42 107.22 85.98 105.23 125.12 124.98 36.34 77.62 117.15 120.13 100.26 122.13 125.10 123.99

55.02 109.17 89.26 98.51 125.13 125.13 58.48 106.16 83.88 103.46 125.13 125.13 23.84 79.13 103.39 122.85 102.15 109.21 125.13 125.13

Figure 4. Response surface and contour plot of temperature vs. pH on ethanol production (time was kept constant at 4 days).

Table 6. ANOVA for full quadratic model. Source of variation

Sum of squares (SS)

Degrees of Mean freedom squares (DF) (MS)

Regression 14904.6 9 Residual 936.99 10 Total 15841.6 19

1656.1 93.7

F value

Probe > F

17.7

0

Table 7. Optimum values of media constituents, fermentation conditions and the experimental and predicted yields for ethanol. Variables

Equation 3 Substrate (g/l), X1 Urea (g/l), X2 EDTA (g/l), X3 Equation 4 Temperature (°C), X1 pH, X2 Time (days), X3

Optimum values

398.5 3.1 0.51 26.2 8.4 4.2

Optimum ethanol yield (g/l) Experimental

Predicted

125.4

125.6 Figure 5. Response surface and contour plot of temperature vs. time on ethanol production (pH was kept constant at 8.0).

129.4

129.8

The predicted production of ethanol using the above equation is given in Table 5 along with the experimental values. The coefficient of determination, R2 is 0.9408, implies that the sample variation of 94.08% for ethanol production is attributed to the independent variables, viz., temperature, pH and fermentation time. The R2 value also indicates that only 1% of the variation is not explained by the model. The value of R is 0.97. The corresponding analysis of variance (ANOVA) was presented in Table 6. v2 test shows

that the model is a good fit since v2cal < v2tab , where v2cal is 15.77 and v2tab is 30.14. The predicted optimum levels of temperature, initial pH and time of fermentation were obtained by applying the regression analysis to the Equation (4). The predicted and experimental ethanol productions at the optimum levels of fermentation conditions were also determined. Figures 4–6 represent the isoresponse contour and surface plots for the optimization of fermentation conditions of ethanol production. The maximum ethanol concentration of 129.4 g/l appeared at temperature, pH and time of fermentation of 26.2 °C, 8.4 and 4.2 days respectively. The experimental and predicted ethanol production at optimum conditions of fermentation were also determined (Table 7).

404

Figure 6. Response surface and contour plot of pH vs. time on ethanol production (temperature was kept constant at 25 °C).

Thus the present study using the technique of central composite design enables to find the accurate values of the medium constituents and fermentation conditions for the maximum product concentration of ethanol using Saccharomyces cerevisiae.

References Ambati, P. & Ayyanna, C. 2001 Optimizing medium constituents and fermentation conditions for citric acid production from palmyra jaggery using response surface method. World Journal of Microbiology and Biotechnology 17, 331–335. Box, G.E.P. & Wilson, K.B. 1951 On the experimental attainment of optimum conditions. Journal of the Royal Statistical Society (Series B) 13, 1–45. Chen, S.L. 1981 Optimization of batch alcohol fermentation of glucose syrup substrate. Biotechnology and Bioengineering 23, 1827–1836.

B.V.V. Ratnam et al. Chen, H.C. 1996 Optimizing the concentrations of carbon, nitrogen and phosphorus in a citric acid fermentation with response surface method. Food Biotechnology 10, 13–27. Cochran, N.G. & Cox, G.M. 1968 Experimental Designs. John Wiley and Sons Inc., p. 611. Coteron, A., Sanchez, M., Martinez, M. & Aracil, J. 1993 Optimization of the synthesis of an analogue of jojoba oil using fully central composite design. Canadian Journal of Chemical Engineering 71, 485–488. Duff, R.J., Defeo, J.A. & Robinson, R.A. 1973 Abstracts of Papers, 166th American Chemical Society National Meetings, Chicago, Micro, 28. Elisson, A., Hofmeyr, J.H.S., Pedler, S. & Hahn-Hagerdal, B. 2001 The xylose reductase/xylitol dehydrogenase/xylulokinase ratio affects product formation in recombinant xylose-utilizing Saccharomyces cerevisiae. Enzyme and Microbial Technology 29, 288–297. Lee, J.M. & Woodward, J. 1983 Properties and application of immobilized b-D -glucoside coentrapped with Zymomonas mobilis in calcium alginate Biotechnology and Bioengineering 25, 2441. Maddox, I.S. & Reichert, S.H. 1977 Use of response surface methodology for the rapid optimization of microbiological media. Journal of Applied Bacteriology 43, 197–204. Mason, R.L. Gunst, R.F. & Hers, J.L. 1989 Statistical Design and Analysis of Experiments with Application to Engineering and Science. New York: John Wiley & Sons. ISBN 0-471-85364-X. Miller, G.L. 1959 Use of DNS reagent for determination of reducing sugars. Analytical Chemistry 31, 426–428. Ratnam, B.V.V. 2001 Studies on physico-chemical and nutritional parametars for the production of ethanol from palmyra jaggery by submerged fermentation using Saccharomyces cerevisiae. PhD thesis, Andhra University, Visakhapatnam, AP, India. Ratnam, B.V.V., Narasimha Rao, M., Damodara Rao, M., Subba Rao, S. & Ayyanna, C. 2003 Optimization of fermentation conditions for the production of ethanol from sago starch using response methodology. World Journal of Microbiology and Biotechnology 19, 523–526. Sunitha, I., Subba Rao, M.V. & Ayyanna, C. 1998 Optimization of medium constituents and fermentation conditions for the production of L-glutamic acid by the coimmobilized whole cells of Micrococus glutanicus and Pseudomonas reptilivora. Bioprocess Engineering 18 , 353–359. Zertuche, L. & Zall, R.R. 1985 Optimizing alcohol production from whey using computer technology. Biotechnology and Bioengineering 27, 547–554.

Springer 2005


Dye decolorization by Trametes hirsuta immobilized into alginate beads Alberto Domı´ nguez, Susana Rodrı´ guez Couto and Mª Ańgeles Sanromań* Department of Chemical Engineering, University of Vigo, Campus Universitario As Lagoas–Marcosende, E-36200 Vigo, Spain *Author for correspondence: Tel.: +34-986-812383, Fax: +34-986-812380, E-mail: [email protected]

Keywords: Alginate, enzymes, immobilization, Trametes hirsuta, xenobiotics

Summary The present paper studies the production of laccase by Trametes hirsuta immobilized into alginate beads in an airlift bioreactor. In order to enhance laccase production fresh ammonium chloride was added, which led to the production, of high laccase activities (around 1000 U l)1). The bioreactor operated for 40 days without operational problems and the bioparticles maintained their shape throughout fermentation. Dye decolorization was performed at bioreactor scale operating in the batch mode. High decolorization percentages were obtained in a short time (96% for indigo carmine and 69% for phenol red in 24 h), indicating the suitability of this process for application to synthetic dye decolorization. On the other hand, in vitro decolorization of several industrial azo dyes by crude laccase produced in the above bioreactor was also performed. It was found that some of the dyes needed the addition of 1-hydroxybenzotriazole for their decolorization.

Introduction Dyes are extensively used for several industrial applications, and about 15% of them end up in industrial effluents. Unfortunately, conventional wastewater treatments are ineffectual at removing dyes and involve high cost, formation of hazardous by-products and intensive energy requirements (Stolz 2001). Moreover, complete dye removal is unfeasible. This has impelled research into alternative methods like biotechnological processes. The so-called ligninolytic fungi are particularly suitable for the development of such processes, since they produce extracellular lignin-degrading enzymes. The main components of their ligninolytic system are lignin peroxidases (LiPs), manganese peroxidases (MnPs) and laccases, which degrade a wide range of organic pollutants including dyes and polyaromatic hydrocarbons (PAHs). Laccase (benzenediol: oxygen oxidoreductases; EC 1.10.3.2) contains four neighboring copper atoms, which are distributed among different binding sites in the molecule and are differentiated by specific characteristic properties allowing them to play an important role in its catalytic mechanism (Shing & Kim, 1998; Xu 1999). This makes laccase an ideal candidate for the treatment of wastewater from industrial effluents such as those from textile factories. Trametes hirsuta has been selected to perform the present study, since it has recently been described as a good producer of laccase and has been shown to have

potential in dye degradation (Abadulla et al. 2000, Campos et al. 2001). Dye decolorization on an industrial scale requires the performance of continuous system technology, which is especially complex when dealing with filamentous fungi. Processes using immobilized growing cells seem to be more promising than traditional fermentation with free cells, since immobilization enables microbial cells to be used continuously (Zhou & Kiff 1991; Tieng & Sun 2000). Basically, there are two types of cell immobilization: attachment and entrapment. Several studies have employed different materials for the attachment procedure such as polyurethane foam (Nakamura et al. 1997; Mielgo et al. 2002), textile strips and straw (Kaluskar et al. 1999), nylon cubes (Haapala & Linko 1993; Rodrı´ guez couto et al. 2000), polystyrene foam (O¨ztu¨rk & Kasikara 2005) and stainless steel sponge (Rodrı´ guez Couto et al. 2004). All these materials were shown to be appropriate for the immobilization of white-rot fungi. On the other hand, relatively few studies have been conducted with white-rot fungi immobilized on sodium or calcium alginate (Livernoche et al. 1983; Pallerla & Chambers 1998; Yesilada et al. 1998). Cells entrapped in natural polymers (alginate, carrageenan, chitosan or cellulose derivatives) have been found to be more stable than free cells during continuous operation in different processes. This has stimulated interest in the development of systems with entrapped cells. Accordingly, calcium alginate was employed in this work. It

406 was preferred to other materials because it shows the following advantages: biodegradability, hydrophilicity, presence of carboxylic groups, natural origin, low density, mechanical stability and stability over an experimental pH range of 3.0–8.0 (Arica et al. 2001). The purpose of this research was to obtain high laccase activities by T. hirsuta immobilized by means of an entrapment technique operating in an airlift bioreactor. The effect of fresh ammonium chloride addition to the culture medium was also assessed. In addition, the system was successfully applied for decolorization of two synthetic dyes. Taking into account the great potential of laccase in different areas, the application of this system to other bioprocesses could be feasible.

Materials and methods

A.Domıńguez et al. (2,2¢-azino-di-[3-ethyl-benzothiazoline-(6)-sulfonic acid], Roche) as a substrate. One unit was defined as the amount of enzyme that oxidized 1 lmol of ABTS per minute and the activities were expressed in U l)1. Dye decolorization studies Dyestuffs The dyes tested for the in vivo studies were indigo carmine (indigoid) CI 73015 and phenol red (sulfonaphthalein). Both were purchased from Aldrich (St. Louis, MO, USA). The industrial dyes employed to perform the in vitro studies are indicated in Table 1. These dyes were manufactured by Clariant Ibe´rica S.A. (Spain) and they are commonly employed to dye chromed leather. Their chemical structure has not been disclosed, since it belongs to the company. A stock solution (0.5–0.25% in water) was stored in the dark at room temperature.

Microorganism T. hirsuta (BT 2566), obtained from Dr G.M. Gu¨bitz (Institute for Environmental Biotechnology, Graz University of Technology, Graz, Austria), was maintained on potato dextrose agar (PDA) plates at 4 C and subcultured every 3 months. Alginate beads T. hirsuta was entrapped in Ca-alginate polymer beads at a concentration of alginate of 1.4% (w/v) dissolved in water and sterilized at 120 C. The alginate solution was mixed with mycelial suspension, dropped into a calcium chloride solution 25 gl)1 and the beads formed were maintained at 4 C for 4 h. The ratio beads/culture medium employed was 10% (w/w). Bioreactor configuration and operation conditions A Biostat B (B. Braun, Germany) airlift bioreactor (working volume of 2 l) was employed. The temperature was maintained at 30 C by circulation of temperaturecontrolled water. Air was supplied to the bioreactor in a continuous way at a rate of 1 l min)1 and the pH was allowed to vary freely. The culture medium was prepared according to Tien & Kirk (1984) with 10 g l)1 glucose as a carbon source, veratryl alcohol as an inducer (4 mM, final concentration) and dimethyl succinate was replaced by 20 mM acetate buffer (pH 4.5). The bioreactor operated in batch. Samples were collected twice a day, centrifuged (8000 · g, 10 min) and analyzed in triplicate. The values in the figures correspond to mean values of replicate experiments with a standard deviation less than 15%.

In vivo Dye concentration was selected in order to obtain around 1.0 absorbance unit at their maximum visible wavelength. Samples, taken every day from the outlet of the reactor, were centrifuged (8000 · g, 10 min) to eliminate suspended particles. The residual dye concentration was measured spectrophotometrically and associated with the decrease in the absorbance at the peak of maximum visible wavelength for each dye (610 nm for indigo carmine and 431 nm for phenol red). In vitro Culture broth was collected at the maximum laccase activity (day 24), filtered, clarified by centrifugation at 8000 · g for 15 min, frozen, defrosted and then filtered to remove the precipitated polysaccharides. The resulting clear filtrate was concentrated with an Amicon membrane with a molecular weight cut-off of 10 kDa. In vitro decolorization experiments were performed with this concentrated clear filtrate. The reaction mixture for dye decolorization consisted of an aqueous solution of dye (final concentrations indicated in Table 1), crude laccase (500 U l)1, final concentration) in citrate phosphate buffer (pH 5.0) in a final volume of 1.5 ml. In the experiments with redox mediator, 1-hydroxybenzotriazole (HOBT) was also added to a final concentration of 0.12%. The residual dye concentration was measured spectrophotometrically Table 1. Industrial dyes employed in in vitro decolorization. Dye

Characteristics

Concentration (g l)1)

Derma Blue DBN Derma Bordeaux V Derma Carbon NBS

Acid, azo, anionic Acid, azo, anionic Mixture of direct and acid colorants, azo, anionic Azo, anionic Acid, azo, metal complex (Fe), anionic

0.05 0.07 0.13

Analytical determinations Laccase activity was determined spectrophotometrically as described by Niku-Paavola et al. (1990) with ABTS

Coracido Brown FG Derma Brown 5GL

0.17 0.08

Dye decolorization by immobilized Trametes hirsuta

407

from 350 to 750 nm, calculated by measuring the area under the plot and expressed in terms of percentage. A control test containing the same amount of a heatdenatured laccase was performed in parallel. The assays were done twice, the experimental error being below 3%.

Results and discussion Laccase production The rate, amount and quality of the laccase enzyme produced is affected by diverse typical fermentation factors such as medium composition, C/N ratio, pH, temperature, aeration rate, etc. Moreover, different aromatic compounds have also been widely used to stimulate laccase production. Thus, Kaluskar et al. (1999) determined for fungi such as Agaricus sp. that it is possible to increase laccase production by manipulating the growth medium composition and concluded that the technology of immobilization could be promising for future industrial development of this kind of enzyme. In view of the results obtained in previous work, experiments were performed supplementing the culture medium with 4 mM veratryl alcohol (data not shown). As can be observed in Figure 1, firstly the culture profile showed an initial lag phase, in which the fungus was adapting to the environmental conditions. Glucose, measured as reducing sugars, remained at a value around 10 g l)1 from the beginning until day 6 and from there onwards it gradually decreased up to day 18, being consumed at a rate of 0.823 g l)1 day)1. As for ammonium nitrogen, it was totally depleted in 4 days after the lag phase. Fresh medium was added on day 17 to give a final concentration of ammonium nitrogen of 175 mg l)1. Laccase activity appeared on day 6 and it sharply increased, peaking on day 10 (585 U l)1). Afterwards, it abruptly decreased and from the addition of fresh

Glucose (g l-1)

10

160

8 120 6 80 4

Ammonium (mg l-1)

200

12

40

2 0

0 0

5

10

15

20

25

30

Time (days)

Figure 1. Consumption of glucose (s) and ammonium (n), for the experiments with T. hirsuta immobilized into alginate beads. Fresh ammonium chloride was added on day 17.

medium onwards the activity was recovered, showing a maximum value of 1043 U l)1on day 24. Moreover, a mean value of about 900 U l)1 was maintained from day 20 until the end of cultivation (Figure 2). It is remarkable that the highest laccase activities were obtained when fresh ammonium chloride was added. This agrees with the investigations performed by Swamy & Ramsay (1999), who found that N-rich cultures produced higher levels of laccase than N-limited ones in submerged cultivation of T. versicolor. Moreover, in recent work by our research group (Rodrı´ guez et al. 2004) when T. hirsuta was grown immobilized into alginate beads in a fixed-bed bioreactor in N-limited conditions, much lower laccase activity values were produced. It is noteworthy that the bioreactor design used in the present study worked for 30 days without operational problems. In addition, the fungus was retained into the beads and cell leakage from the polymeric matrix into the medium was not observed. The bead size allowed the movement of air bubbles throughout the reactor bed giving suitable aeration for the microorganism and avoiding clogging problems, which would hinder mass and oxygen transfer rate. It indicates that this bioreactor design minimizes the drawbacks frequently found in other bioreactor configurations. Altogether this makes this support a very suitable material for the immobilization of filamentous fungi in airlift bioreactors. Dye decolorization in vivo The ability to degrade two structurally different dyes, indigo carmine (indigoid) and phenol red (sulfonaphthalein), by T. hirsuta entrapped in alginate beads was also analyzed. The decolorization of model dyes is a simple method to assess the aromatic-degrading capability of ligninolytic enzymes (Novotny´ et al. 2001). The reactor ran for 30 days and on day 32, when laccase activity was about 800 U l)1, the dye indigo carmine was aseptically added as an aqueous solution to a final concentration of 150 lM. The dye was almost totally decolorized in only 24 h (Figure 3). In a second batch, the dye phenol red was added on day 38 as an aqueous solution to a final concentration of 200 lM. A degradation of about 50% was reached in 3 h. After that, the decolorization rate was rather low reaching a value of 69% in 24 h (Figure 3). This indicates that phenol red is more resistant to degradation than indigo carmine. The easy degradation of indigoid dyes has already been reported by several authors (Wong & Yu 1999; Abbadulla et al. 2000). In order to determine the adsorption of dyes on the alginate beads, the bioparticles were treated with an extracting agent such as ethanol, measuring the possible residual dye concentration resulting in the final solution. No residual dye concentration was found, indicating, therefore, that the dyes were not adsorbed onto the alginate beads. This means that decolorization was only due to intra- and extracellular enzymes produced by the microorganism during cultivation.

408

A.Domıńguez et al.

600

cultures with T. hirsuta immobilized on an alginate bed to degrade structurally different dyes with diverse chromophoric groups of highly recalcitrant and nonbiodegradable characteristics such as industrial azo dyes was assessed. These results indicate the possibility of using this bioreactor to degrade other recalcitrant substances.

400

Dye decolorization in vitro

200

Figure 4 shows that the decolourization degree of the dyes indigo carmine and phenol red by the extracellular liquids reached similar profiles of decolorization percentage determined in in vivo assays (Figure 3). For this reason, in this section the ability of the crude laccase produced in the reactor to decolorize several industrial azo dyes was performed by an in vitro test. As seen in Figure 4, from 6 to 24 h decolorization obtained was the same or increased very little (Figure 4), which could be due to enzyme inhibition by some products generated in the oxidation process. The dyes Coracido Brown and Derma Brown were decolorized to a very little extent, which indicates that they are not substrates for laccase enzyme. Then, the well-known redox mediator HOBT was added subsequently to the decolorization mixture but no improvement was obtained. However, when this mediator was added at the beginning of the reaction the decolorization rate considerably increased, in particular, for the dye Derma Brown (70% in 10 min) (Figure 4). These results show the efficiency of the extracellular liquid produced for decolorization of complex azo dyes. A more detailed study of the effect of different redox mediators on azo dye decolorization is underway in our laboratory.

1200

Laccase activity (U l-1)

1000

800

0 0

5

10

15

20

25

30

Time (days)

Figure 2. Laccase production in cultures of T. hirsuta immobilized into alginate beads. 100

Decolorization (%)

80

60

40

20

0 0

200

400

600

800 1000 1200 Time (min)

1400

1600

1800

Figure 3. Profiles of indigo carmine (solid line) and phenol red (dotted line) decolorization obtained in an airlift bioreactor with T. hirsuta immobilized into alginate beads.

Conclusions

To confirm that decolorization was due to the laccase secreted by the fungus, in the following experiment the ability of the extracellular liquid from the bioreactor

According to the results obtained in the present work, it can be concluded that the system employed here is very suitable for use in dye decolorization, since it was able to

Indigo Carmine + HBT (0.12%) 4-6 h 24 h

Phenol Red Azul Derma Burdeos Derma Carbon Derma Pardo Coracido Pardo Derma 0

10

20

30

40

50

60

70

80

90

100

Decolorization (%)

Figure 4. Decolorization percentages obtained for several industrial azo dyes by crude laccase produced in an airlift bioreactor with T. hirsuta immobilized into alginate beads.

Dye decolorization by immobilized Trametes hirsuta operate with high efficiency, degrading different dyes in successive batches with no operational problems. This indicates the suitability of such a system for application to a continuous operation. In addition, it is also potentially very useful for laccase production for several biotechnological applications.

Acknowledgements This work was financed by the Spanish Ministry of Science and Technology and European FEDER (Project REN2003-01626/TECNO).

References Abadulla, E., Tzanov, T., Costa, S., Robra, K.H., Cavaco-Paulo, A. & Gu¨bitz, G.M. 2000 Decolorization and detoxification of textile dyes with a laccase from Trametes hirsuta. Applied and Environmental Microbiology 66, 3357–3362. Arica, M.Y., Kacar, Y. & Genç, O. 2001 Entrapment of white-rot fungus Trametes versicolor in Ca-alginate beads: preparation and biosorption kinetic analysis for cadmium removal from an aqueous solution. Bioresource Technology 80, 121–129. Campos, R., Kandelbauer, A., Robra, K.H., Cavaco-Paulo, A. & Gu¨bitz, G.M. 2001 Indigo degradation with purified laccases from Trametes hirsuta and Sclerotium rolfsii. Journal of Biotechnology 8, 131–139. Haapala, A. & Linko, S. 1993 Production of Phanerochaete chrysosporium lignin peroxidase under various culture conditions. Applied Microbiology and Biotechnology 40, 494–498. Kaluskar, V.M., Kapadnis, B.P., Jaspers, CH. & Penninckx, M.J. 1999 Production of laccase by immobilized cells of Agaricus sp. Induction effect of xylan and lignin derivatives. Applied Biochemistry and Biotechnology 76, 161–170. Livernoche, D., Jurasek, L., Desrochers, M. & Dorica, J. 1983 Removal of color from kraft mill waste waters with cultures of white rot fungi and immobilized mycelium of Coriolus versicolor. Biotechnology and Bioengineering 25, 2055–2065. Mielgo, I., Moreira, M.T., Feijoo, G. & Lema J.M. 2002 Biodegradation of a polymeric dye in a pulsed bed bioreactor by immobilised Phanerochaete chrysosporium. Water Research 36, 1896–1901. Nakamura, Y., Sawada, T., Sungusi, M.G., Kobayashi, F., Kuwahara, M. & Ito, H. 1997 Lignin peroxidase production by Phanerochaete chrysosporium. Journal of Chemical Engineering of Japan 30, 1–6.

409 Niku-Paavola, M.L., Raaska, L. & Ita¨vaara, M. 1990 Detection of white-rot fungi by a non-toxic stain. Mycological Research 94, 27– 31. Novotny´, C., Rawal, B., Bhatt, M., Patel, M., Sasek, V. & Molotoris, H.P. 2001 Capacity of Irpex lacteus and Pleurotus ostreatus for decolorization of chemically different dyes. Journal of Biotechnology 89, 113–122. O¨ztu¨rk, U¨.R. & Kasikara P.N. 2005 Production and stimulation of manganese peroxidase by immobilized Phanerochaete chrysosporium. Process Biochemistry 140, 83–87. Pallerla, S. & Chambers, R.P. 1998 Reactor development for biodegradation of pentachlorophenol. Catalysis Today 40, 103–111. Rodrı´ guez Couto, S., Rivela, I., Munõz, M.R. & Sanromań, A. 2000 Ligninolytic enzyme production and the ability of decolourisation of Poly R-478 in packed-bed bioreactors by Phanerochaete chrysosporium. Bioprocess Engineering 23, 287–293. Rodrı´ guez Couto, S., Sanromań, A., Hofer, D. & Gu¨bitz, G.M. 2004 Stainless steel sponge: a novel carrier for the immobilisation of the white-rot fungus Trametes hirsuta for decolourisation of textile dyes. Bioresource Technology 95, 67–72. Shing, K.-S. & Kim, C.-J. 1998 Decolorisation of artificial dyes by peroxidase from the white-rot fungus Pleurotus ostreatus. Biotechnology Letters 20, 569–572. Stolz, A. 2001 Basic and applied aspects in the microbial degradation of azo dyes. Applied Microbiology and Biotechnology 56, 69–80. Swamy, J. & Ramsay, J.A. 1999 The evaluation of white rot fungi in the decoloration of textile dyes. Enzyme and Microbial Technology 24, 130–137. Tien, M. & Kirk, T.K. 1984 Lignin-degrading enzyme from Phanerochaete chrysosporium: purification, characterization and catalytic properties of an unique H2O2-requiring oxygenase. Proceedings of the National Academy of Sciences of the United States of America 81, 2280–2284. Tieng, Y.P. & Sun, G. 2000 Use of polyvinyl alcohol as a cell entrapment matrix for copper biosorption by yeast cells. Journal of Chemical Technology and Biotechnology 75, 541–546. Wong, Y. & Yu, J. 1999 Laccase-catalysed decolorization of synthetic dyes. Water Research 33, 3512–3520. Xu, F. 1999 Laccase. In Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis and Bioseparation, eds. Flickinger, M.C. & Drew, S.W., Vol. 3, pp. 1545–1554. New York: John Wiley & Sons, ISBN 0 471 16667 7. Yesilada, O., Sik, S. & Sam, M. 1998 Biodegradation of olive mill wastewaters by Coriolus versicolor and Funalia trogii: effects of agitation, initial COD concentration, inoculum size and immobilization. World Journal of Microbiology and Biotechnology 14, 37–42. Zhou, J.L. & Kiff, R.J. 1991 The uptake of copper from aqueous solution by immobilized fungal biomass. Journal of Chemical Technology and Biotechnology 52, 317–330.

Springer 2005


Stabilization of a truncated Bacillus sp. strain TS-23 a-amylase by replacing histidine-436 with aspartate Huei-Fen Lo1, Ya-Hui Chen1, Nai-Wan Hsiao2, Hsiang-Ling Chen,1 Hui-Yu Hu1, Wen-Hwei Hsu3 and Long-Liu Lin4,* 1 Department of Food and Nutrition, Hungkuang University, Taichung 433, Taiwan 2 Graduate Institute of Bioinformatics, Taichung Healthcare and Management University, Taichung, Taiwan 3 Institute of Molecular Biology, National Chung Hsing University, Taichung 402, Taiwan 4 Department of Applied Chemistry, National Chiayi University, Chiayi 60083, Taiwan *Author for correspondence: Fax: +886-5-2717901, E-mail: [email protected] Keywords: Bacillus sp. strain TS-23, a-amylase, site-directed mutagenesis, histidine, thermostability

Summary Histidine-436 of a truncated Bacillus sp. strain TS-23 a-amylase (His6-tagged DNC) has been known to be responsible for thermostability of the enzyme. To understand further the structural role of this residue, site-directed mutagenesis was conducted to replace His-436 of His6-tagged DNC with aspartate, lysine, tyrosine or threonine. Starch-plate assay showed that all Escherichia coli M15 transformants conferring the mutated amylase genes retained the amylolytic activity. The over-expressed proteins have been purified to near homogeneity by nickelchelate chromatography and the molecular mass of the purified enzymes was approximately 54 kDa. The specific activity for H436T was decreased by more than 56%, while H436D, H436K, and H436Y showed a higher activity to that of the wild-type enzyme. Although the mutations did not lead to a significant change in the Km value, more than 66% increase in the value of catalytic efficiency (kcat/Km) was observed in H436D, H436K, and H436Y. At 70 C, H436D exhibited an increased half-life with respect to the wild-type enzyme.

Introduction a-Amylases (a-1,4-glucan-4-glucanohydrolase, EC 3.2.1.1) are ubiquitous enzymes that catalyze the hydrolysis of the internal a-1,4 glucosidic bonds in starch and related poly- and oligosaccharides. These enzymes form one of the largest families within the sequence-based classification of glycosyl hydrolases (Henrissat & Bairoch 1996; Henrissat & Davies 1997). As a consequence of their widespread distribution in the three domains of life, a-amylases display a high degree of sequence variability that has been extensively analyzed in terms of evolutionary relationships (Janecˇek 1997; Janecˇek & Sevcˇik 1999). a-Amylases have been used to produce glucose and fructose from starch, to improve texture, volume and flavour of bakery products, to remove starch from textiles, and as additives for detergents for both washing machines and automated dish-washers (Vihinen & Ma¨ntsa¨la¨ 1989; Guzman-Maldonado & Paredes-Lopez 1995; Ito et al. 1998). The conditions prevailing in the commercial applications of these enzymes are rather extreme, especially with respect to temperature and pH. Therefore, there is a continuing demand for stable enzymes to meet the requirements set by specific applications. One approach would be to screen for

novel microorganisms from extreme environments such as hydrothermal vents, salt and soda lakes, and brine pools (Sunna et al. 1997; Niehaus et al. 1999; Vieille & Zeikus 2001). Alternatively, more success has been achieved by protein engineering of the commercial a-amylases (Nielsen & Borchert 2000). The design of thermostable enzymes is among the most spectacular achievements of protein engineering. Since the pioneering work of Perry & Wetzel (1984), the advent of sitedirected mutagenesis methodology has yielded an increasing number of proteins that have been thermostabilized through rational design or empirical means (Matthews 1995; Allen et al. 1998; Sakasegawa et al. 2001, 2002; Nielsen & Borchert 2000). Thermostability of a protein is determined by many criteria such as hydrophobic interactions, loop stabilization, reduced entropy of unfolding, and electrostatic interaction (Vieille et al. 1996). Most natural proteins seem to achieve their individual stability by accumulation of a large number of weakly stabilizing interactions (Demirjian et al. 2001). Accordingly, the characterization of several hundreds of Bacillus licheniformis aamylase variants has identified protein regions and amino acid residues essential for thermostability of the enzyme (Declerck et al. 1990, 2000). In the study of Declerck et al. (2000), amino acid replacements at the

412 six histidine residues of B. licheniformis a-amylase reveal that His-133 is critical for its thermostability. Although no analogous histidine residue is present in the recombinant Bacillus sp. strain TS-23 a-amylase (AmyA) (Lin et al. 1997), His-436 of the N- and C-terminally truncated AmyA (His6-tagged DNC) has been demonstrated to be important for thermostability of the enzyme (Chang et al. 2003). As reported by Lo et al. (2001a), AmyA exhibits optimal activity at pH 9.0 and 60 C, respectively, and is stable at temperatures below 50 C. Under optimal conditions, the enzyme hydrolyzes the a-1,4-linkages in soluble starch, amylose, amylopectin, and glycogen to produce maltopentoase as the main end product. In this investigation, His-436 of His6-tagged DNC was substituted by four amino acids with different side chains. Comparison of the wild type and mutant enzymes shows that thermostability of the truncated enzyme can be modulated by His-436 substitutions. In addition, the increased resistance of the enzyme towards higher temperature is not necessarily accompanied by a decrease in its catalytic activity.

Materials and methods Materials, bacterial strains, plasmid, and growth conditions Restriction and DNA modification enzymes were acquired from Promega Life Sciences (Madison, WI, USA). Luria–Bertani (LB) media and Bacto agar for Escherichia coli cultivation were obtained from Difco Laboratories (Detroit, MI, USA). The primers used were synthesized by Mission Biotechnology, Inc. (Taipei, Taiwan). Ni2+-nitrilotriacetate (Ni2+-NTA) resin was purchased from Qiagen, Inc. (Valencia, CA, USA). Other chemicals were commercially products of analytical grade or molecular biological grade. E. coli NovaBlue (Novagen, Inc., Madison, WI, USA) was used as the host for routine plasmid propagation and DNA cloning procedure. E. coli XL1-Blue (Stratagene, La Jolla, CA, USA) was used for site-directed mutagenesis. T5 RNA polymerase-mediated gene expression was performed in E. coli M15 (Qiagen). The plasmids used were pQE-AMYDNC (Lo et al. 2001b) and pQE-AMYDNC436 (Chang et al. 2003). E. coli strains harbouring the recombinant plasmids were grown aerobically at 28 or 37 C in LB medium supplemented with 100 lg ampicillin/ml for NovaBlue and XL1-Blue strains or 100 lg ampicillin/ml and 25 lg kanamycin/ml for M15 strain. For starch-plate assay, the LB medium contained 1.5% (w/v) agar and the indicated antibiotics.

Huei-Fen et al. QuickChange site-directed mutagenesis kit (Stratagene) according to the manufacturer’s protocol with a pair of complementary primers (Table 1). DNA sequencing then confirmed the presence of the desired mutation in the selected transformants. Expression and purification of wild type and mutant enzymes Escherichia coli M15 harbouring pQE-AMYDNC and its mutated derivatives were grown at 37 C in 100 ml of LB medium supplemented with the above-mentioned antibiotics to an attenuance at 600 nm of approximately 0.6. Isopropyl-b-D-thiogalactopyranoside (IPTG) was then added to a final concentration of 0.5 mM and the cultivation continued at 28 C for 12 h. The cells were harvested by centrifugation at 12,000 · g for 20 min at 4 C, resuspended in 3 ml of binding buffer (5 mM imidazole, 0.5 M NaCl, and 20 mM Tris–HCl; pH 7.9), and disrupted by sonication. The resulting extracts were clarified by centrifugation at 12,000 · g for 20 min, and the supernatants were then mixed with Ni2+-NTA resin pre-equilibrated with the binding buffer. After two volume of washing buffer (50 mM imidazole, 0.5 M NaCl, and 20 mM Tris–HCl; pH 7.9), the His6-tagged enzymes were eluted from the resin by a buffer containing 0.5 M imidazole, 0.5 M NaCl, and 20 mM Tris–HCl (pH 7.9). Protein methods SDS-PAGE was performed in a vertical mini-gel system (Mini Protean III system; Bio-Rad Laboratories, Richmond, CA, USA) with 4% polyacrylamide stacking and 10% polyacrylamide separating gels. Before electrophoresis, the proteins were mixed with 2 · SDS-sample buffer, heated at 100 C for 5 min, and centrifuged at 12,000 · g for 10 min. Electrophoresis was done at room temperature and a constant voltage of 100 V. For activity staining, the gels were immediately immersed into 1% soluble starch in 50 mM Tris–HCl buffer (pH 8.0) and incubated at 50 C for 1 h. The amylolytic

Table 1. Primers used for site-directed mutagenesis of Bacillus sp. strain TS-23 a-amylase gene Enzyme

Nucleotide sequencea

H436D

50 -CGTGATTACATTGACGAGCAAGACATTATTGb 50 -CAATAATGTCTTGCTCGTCAATGTAATCACGc 50 -CGTGATTACATTGACAAGCAAGACATTATTGb 50 -CAATAATGTCTTGCTTGTCAATGTAATCACGc 50 -CGTGATTACATTGACACTCAAGACATTATTGb 50 -CAATAATGTCTTGAGTGTCAATGTAATCACGc 50 -CGTGATTACATTGACTATCAAGACATTATTGb 50 -CAATAATGTCTTGATAGTCAATGTAATCACGc

H436K H436T H436Y

DNA manipulation a

General DNA techniques were performed essentially as described by Sambrook et al. (1989). Site-directed mutagenesis was performed on pQE-AMYDNC by a

Nucleotides underlined represent the mutations that introduce the desired amino acid substitutions. b Sequence for forward primers. c Sequence for reverse primers.

Stabilization of Bacillus sp. strain TS-23 a-amylase

413

band was visualized by soaking the gels into a solution of 0.01 N I2–0.1 N KI. The same gels were subsequently stained with 0.25% Coomassie Brilliant Blue dissolved in 50% methanol-10% acetic acid, and destained in a solution of 30% methanol and 10% acetic acid. The protein size markers were phosphorylase b (97.4 kDa), bovine serum albumin (66.3 kDa), ovalbumin (45.0 kDa), carbonic anhydrase (31.0 kDa), and trypsin inhibitor (21.5 kDa). Protein concentrations were determined by the Bradford method with the Bio-Rad protein assay reagent, and bovine serum albumin was used as the standard. Enzyme assay, kinetic characterization, and thermostability Amylase activity was assayed in accordance with the procedure described by Lin et al. (1994). One unit of amylase activity is defined as the amount of enzyme that releases 1 lmol glucose equivalent per min from starch. The Km and kcat values were estimated by monitoring the hydrolysis of soluble starch in the 0.5 ml reaction mixtures containing various concentrations of the substrate (0.2–4 mg/ml) in 50 mM Tris–HCl buffer (pH 8.0) and a suitable amount of enzyme. The reaction mixtures were incubated at 50 C for 10 min. Values of Km and kcat were calculated by fitting the initial rates as a function of soluble starch concentration to the Michaelis-Menten equation. To determine thermostability of wild type and mutant enzymes, protein concentrations were adjusted to 100 lg/ml with 50 mM Tris–HCl buffer (pH 8.0). The enzyme solutions were incubated at 70 C for designed time periods. Aliquots (50 ll) of the enzyme solution were withdrawn to determine the residual activity under the standard assay conditions.

Results and discussion Expression of wild type and mutant enzymes For structure-stabilization studies, His-436 on His6tagged DNC was replaced by aspartate, threonine, tyrosine, and lysine, respectively. The resulting plasmids were designed pQE-AMY436D/436T/436Y/436K. After confirmation of the altered sequence, pQE-AMYDNC, pQE-AMYDNC436, and the mutated plasmids were transformed into E. coli M15 for IPTG-induced gene expression. As shown in Figure 1a, E. coli M15 (pQEAMY436D/436Y/436K) hydrolyzed the starch in the medium comparable to the control. However, the rest two transformants produced halos smaller than that of the host cell carrying pQE-AMYDNC. These results indicate that His-436 could be important for protein structure but is not essential for the catalytic reaction of the enzyme. A predominant protein band of approximately 54 kDa was observed in the total proteins from IPTG-

Figure 1. Amylolytic activity of E. coli M15 transformants. (a) Starchplate assay. Transformants were cultivated on LB plate containing 1% soluble starch, 0.1 mM IPTG and the indicated antibiotics for 24 h. A clear zone around the colony indicates the expression of the amylase gene. (b) SDS-PAGE analysis of the total cell proteins from E. coli M15 transformants. The amylolytic activity is visualized by activity staining. Numbers denote: 1, E. coli M15 (pQE-AMY436D); 2, E. coli M15 (pQE-AMY436K); 3, E. coli M15 (pQE-AMY436T); 4, E. coli M15 (pQE-AMY436Y); 5, E. coli M15 (pQE-AMYDNC436); 6, E. coli M15 (pQE-AMYDNC).

induced E. coli M15 transformants (data not shown). Activity staining showed that H436D and His6-tagged DNC had amylolytic activity, while a dramatically decrease in activity was observed in H436Y (Figure 1b). The heating step (100 C for 5 min) before SDS-PAGE also inactivated H436K and H436T, suggesting that substitution of His-436 by Tyr, Arg or Thr has a negative effect on the enzyme stability. Purification and kinetic characterization of the recombinant proteins To characterize each variant, the expressed proteins were purified with chelate column chromatography to near homogeneity (Figure 2). As compared with the wild type enzyme, the specific activity for threonine substitution was significantly decreased, while H436D, H436K, and H436Y showed a significant increase in enzyme activity (Table 2). To understand further the basis for variations in specific activity, the kinetic constants, kcat and Km, were determined for wild type and mutant enzymes. As shown in Table 2, H436T was severely compromised catalytically with more than 36% decrease in kcat, indicating that this substation significantly affects catalytic function of the enzyme. H436D, H436K, and H436Y exhibited a similar Km value coupled with an increased catalytic efficiency (kcat/Km) relative to the wild-type enzyme. A generally accepted mechanism for the a-amylase family of enzymes is that it proceeds via an a-retaining double displacement procedure (Kuriki & Imanaka 1999). The mechanism involves two catalytic residues in which a glutamic acid acts as the acid/base catalyst and an aspartate functions as the nucleophile. In the catalytic reaction, the critical histi-

414

Huei-Fen et al.

Log % of residual activity

2

1.5

1

0.5

0 0

Figure 2. SDS-PAGE analysis of the purified His6-tagged DNC and His-436 variants. Lanes: M, protein size marker; 1, H436D; 2, H436K; 3, H436T; 4, H436Y; 5, wild-type enzyme.

dine residues of starch-degrading enzymes have been proposed to be involved in the binding of substrate (Ishikawa et al. 1992, 1993; Nakamura et al. 1993; Takase 1994; Tseng et al. 1999). Three histidine residues implicated in the binding of substrate have generally been located in the highly homologous regions (Matsuura et al. 1984). In AmyA, these residues include His137 (region I), His-269 (region II), and His-361 (region IV) (Lin et al. 1997). Because His-436 of His6-tagged DNC falls outside the conserved regions, and substitutions at this position do not completely inactivate the enzyme, it is clear that this residue plays a role in the global structure of the enzyme. Thermostability Thermostabilities of His6-tagged DNC and His-436 variants were compared. As shown in Figure 3, the wild-type enzyme exhibited a time-dependent decrease in amylolytic activity and had a half-life of 25 min at 70 C. H436Y, H436T, and H436K were more sensitive toward the thermal inactivation to that of His6-tagged DNC. These results are consistent with the findings from activity staining of the total proteins (Figure 1B). Interestingly, H436D retained 57% of the original activity after incubating the enzyme at 70 C for 30 min, indicating that substitution of His-436 by aspartate generates a variant with enhanced thermostability. In the cyclodextrin glycosyltransferase (CGTase) from Thermoanaerobacterium thermosulfurigenes EM1, the

10

20

30

40

Time (min) Figure 3. Thermostability of the purified His6-tagged DNC and His436 variants. These enzymes were incubated at 70 C for the indicated time prior to the determination of the residual activity. Symbols: , H436D; }, His6-tagged n, NC; j;, H436Y; m, H436T; d, H436K.

surface salt bridges have been proposed to contribute its relatively high thermostability (Knegtel et al. 1996). Based on the structural comparison of CGTases, a salt bridge was introduced into the Bacillus circulans enzyme to create a variant with improved thermostability (Leemhuis et al. 2004). Several other examples have also demonstrated that salt bridges play a key role in the maintenance of high enzyme stability (Auerbach et al. 1998; Sanz-Aparicio et al. 1998; Tahirov et al. 1998; Hashimoto et al. 1999). However, computer modeling of three-dimensional structures of the wildtype enzyme and H436D using Bacillus stearothermophilus a-amylase as the template structure (PDB entry 1HVX) and the program CPH model 2.0 (http:// www.cbs.dtu.dk/services/CPHmodels) revealed that the better thermostability observed in H436D is due to the additional hydrogen bond in the vicinity of the substituted amino acid (Figure 4). Hsiao et al. (2004) demonstrated that thermostability of a protein could be quantified by the measurement of its Tm index. In our case, the Tm index of wild type enzyme and H436D are 0.15 and 0.22, respectively. Based on the above facts, it is likely that the created hydrogen bond and larger Tm index in the variant contribute to its higher thermostability.

Conclusion Table 2. Specific activities and kinetic parameters of wild type and mutant enzymes Enzyme

Specific activity (U mg)1)

kcat (s)1)

Wild type H436D H436K H436T H436Y

170.2 231.5 240.2 75.3 232.4

149.3 295.5 274.7 98.4 212.5

± ± ± ± ±

8.3 8.9 9.7 3.1 5.6

± ± ± ± ±

2.7 8.4 7.9 7.0 9.9

Km (mg ml)1)

kcat/ Km (ml mg)1 s)1)

2.8 2.6 2.9 2.9 2.4

53.3 113.6 94.7 33.9 88.5

± ± ± ± ±

0.7 0.5 0.4 0.5 0.3

In this study, His-436 of the truncated Bacillus sp. strain TS-23 a-amylase was replaced with other amino acids by site-directed mutagenesis. H436D showed not only an increased catalytic efficiency but also an increased resistance to thermal inactivation. Since His-436 is not essential for catalytic reaction of the enzyme, the increased kcat value in H436D could be attributed by the improved thermostability. In recent years, many molecular and structural characteristics of the highly thermostable enzyme have been analyzed by

Stabilization of Bacillus sp. strain TS-23 a-amylase

415

Figure 4. Diagram of hydrogen bond and hydrophobic interactions in the 436 residue of wild-type enzyme (a) and H436D (b). The ligand–ligand interactions and hydrogen-bonding network in the 436 residue are represented schematically using the program LIGPLOT (Wallace et al. 1995).

pairwise comparisons on homologous proteins with different thermal stabilities. As a result, several mechanisms and factors have been found to be responsible for the higher thermostability, such as hydrophobic interactions, salt bridges, hydrogen bonds, solvent accessible surface areas, etc (Matthews 1993; Vieille & Zeikus 2001). By computer modelling of Bacillus sp. strain TS-23 AmyA with B. stearothermophilus aamylase, it is clear that the additional hydrogen bond and larger Tm index are responsible for the enhanced thermostability of H436D. The improved thermostability makes H436D more valuable for industrial application.

Acknowledgement The authors are grateful for the financial support (NSC93-2313-B-241-005) by National Science Council of the Republic of China.

References Allen, M.J., Coutinho, P.M. & Ford, C.F. 1998 Stabilization of Aspergillus awamori glucoamylase by proline substitution and combining mutations. Protein Engineering 11, 783–788. Auerbach, G., Ostendorp, R., Prade, L., Korndorfer, I., Dams, T., Huber, R. & Jaenicke, R. 1998 Lactate dehydrogenase from the hyperthermophilic bacterium Thermotoga maritima: the crystal structure at 2.1 A˚ resolution reveals strategies for intrinsic protein stabilization. Structure 6, 769–781.

Chang, C.T., Lo, H.F., Chi, M.C., Yao, C.Y., Hsu, W.H. & Lin, L.L. 2003 Identification of essential histidine residues in a recombinant a-amylase of thermophilic and alkaliphilic Bacillus sp. strain TS23. Extremophiles 7, 505–509. Declerck, N., Joyet, P., Gaillardin, C. & Masson, J.M. 1990 Use of amber suppressors to investigate the thermostability of Bacillus licheniformis a-amylase: amino acid replacement at 6 histidine residues reveal a critical position at His-133. Journal of Biological Chemistry 265, 15481–15488. Declerck, N., Machius, M., Wiegand, G., Huber, R. & Gaillardin, C. 2000 Probing structural determinants specifying high thermostability in Bacillus licheniformis a-amylase. Journal of Molecular Biology 301, 1041–1057. Demirjian, D.C., Moris-Varas, F. & Cassidy, C.S. 2001 Enzymes for extremophiles. Current Opinion in Chemical Biology 5, 144–151. Guzman-Maldonado, H. & Paredes-Lopez, O. 1995 Amylolytic enzymes and products derived from starch: a review. CRC Critical Reviews in Food Science and Nutrition 35, 373–403. Hashimoto, H., Inoue, T., Nishioka, M., Fujiwara, S., Takagi, M., Imanaka, T. &. Kai, Y. 1999 Hyperthermostable protein structure maintained by intra and inter-helix ion-pairs in archaeal O6methylguanine-DNA methyltransferase. Journal of Molecular Biology 292, 707–716. Henrissat, B. & Bairoch, A. 1996 Updating the sequence-based classification of glycosyl hydrolases. Biochemical Journal 316, 695–696. Henrissat, B. & Davies, G. 1997 Structural and sequence-based classification of glycosyl hydrolases. Current Opinion in Structural Biology 7, 637–644. Hsiao, N.W., Lu, P.Y., Wang, T.S., Lai, S.M., Cheng, C.S., Hwang, J.K. & Lyu, P.C. 2004 Prediction of melting temperature directly from protein sequences. In Abstract of the 9th Symposium on Recent Advances in Biophysics held at Taipei, Taiwan, PC02. Ishikawa, K., Matsui, I., Honda, K. & Nakatami, H. 1992 Multifunctional roles of a histidine residue in human pancreatic aamylase. Biochemical and Biophysical Research Communications 183, 286–291.

416 Ishikawa, K., Matsui, I., Kobayashi, S., Nakatani, H. & Honda, K. 1993 Substrate recognition at the binding site in mammalian pancreatic a-amylase. Biochemistry 32, 6259–6265. Ito, S., Kobayashi, T., Ara, K., Ozaki, K., Kawai, S. & Hatada, Y. 1998 Alkaline detergent enzymes from alkaliphiles: enzymatic properties, genetic, and structures. Extremophiles 2, 185–190. Janecˇek, S. 1997 a-Amylase family: molecular biology and evolution. Progress in Biophysics and Molecular Biology 67, 67–97. Janecˇek, S. & Seveìk, J. 1999 The evolution of starch-binding domain. FEBS Letters 456, 119–125. Knegtel, R.M., Wind, R.D., Rozeboom, H.J., Kalk, K.H., Buitelaar, R.M., Dijkhuizen, L. & Dijkstra B.W. 1996 Crystal structure at 2.3 A˚ resolution and revised nucleotide sequence of the thermostable cyclodextrin glycosyltransferase from Thermoanaerobacterium thermosulfurigenes EM1. Journal of Molecular Biology 256, 611–622. Kuriki, T. & Imanaka, T. 1999 The concept of the a-amylase family: structural similarity and common catalytic mechanism. Journal of Bioscience and Bioengineering 87, 557–565. Leemhuis, H., Rozeboom, H.J., Dijkstra, B.W. & Dijkhuizen, L. 2004 Improved thermostability of Bacillus circulans cyclodextrin glycosyltransferase by the introduction of a salt bridge. Proteins 54, 128–134. Lin, L.L., Hsu, W.H. & Chu, W.S. 1997 A gene encoding for an a-amylase from thermophilic Bacillus sp. strain TS-23 and its expression in Escherichia coli. Journal of Applied Microbiology 82, 325–334. Lin, L.L., Tsau, M.R. & Chu, W.S. 1994 General characteristics of thermostable amylopullulanases and amylases from alkaliphilic Bacillus sp. TS-23. Applied Microbiology and Biotechnology 42, 51–56. Lo, H.F., Lin, L.L., Chen, H.L., Hsu, W.H. & Chang, C.T. 2001a Enzymic properties of a SDS-resistant Bacillus sp. TS-23 a-amylase produced by recombinant Escherichia coli. Process Biochemistry 36, 743–750. Lo, H.F., Lin, L.L., Li, C.C., Hsu, W.H. & Chang, C.T. 2001b The Nterminal signal sequence and the last 98 amino acids are not essential for the secretion of Bacillus sp. TS-23 a-amylase in Escherichia coli. Current Microbiology 43, 170–175. Matsuura, A., Kusunok, M., Harada, W. & Kakudo, M. 1984 Structure and possible catalytic residues of Taka-amylase. Journal of Biochemistry (Tokyo) 95, 697–702. Matthews, B.W. 1993 Structural and genetic analysis of protein stability. Annual Reviews of Biochemistry 62, 139–160. Matthews, B.W. 1995 Studies on protein stability with T4 lysozyme. Advances in Protein Chemistry 46, 249–278. Nakamura, A., Haga, K. & Yamane, K. 1993 Three histidine residues in the active center of cyclodextrin gluconotransferase from alkalophilic Bacillus sp. 1011: effects of replacement on pH dependence and transition-state stabilization. Biochemistry 32, 6624–6631.

Huei-Fen et al. Niehaus, F., Bertoldo, C., Kahler, M. & Antranikian, G. 1999 Extremophiles as a source of novel enzymes for industrial application. Applied Microbiology and Biotechnology 51, 711– 729. Nielsen, J.E. & Borchert, T.V. 2000 Protein Engineering of bacterial aamylases. Biochimica et Biophysica Acta 1543, 253–274. Perry, L.J. & Wetzel, R. 1984 Disulfide bond engineered into T4 lysozyme: stabilization of the protein toward thermal inactivation. Science 226, 555–557. Sakasegawa, S., Takehara, H., Yoshioka, T., Takahashi, M., Kagimoto, Y., Misaki, H., Sakuraba, H. & Ohshima, T. 2001 Increasing the thermostability of Flavobacterium meningosepticum glycerol kinase by changing Ser329 to Asp in the subunit interface region. Protein Engineering 14, 663–667. Sakasegawa, S., Takehara, H., Yoshioka, I., Misaki, H., Sakuraba, H. & Ohshima, T. 2002 Stabilization of Flavobacterium meningosepticum glycerol kinase by introduction of a hydrogen bond. Bioscience, Biotechnology and Biochemistry 66, 1374–1377. Sambrook, J., Fritsch, E.F. & Maniatis, T. 1989 Molecular Cloning: A Laboratory Manual. pp. 17.2–17.44. New York: Cold Spring Harbor Laboratory Press. ISSN 0-87969-309-6. Sanz-Aparicio, J., Hermoso, J.A., Martinez-Ripoll, M., Gonzalez, B., Lopez-Camacho, C. & Polaina, J. 1998 Structural basis of increased resistance to thermal denaturation induced by single amino acid substitution in the sequence of b-glucosidase A from Bacillus polymyxa. Proteins 33, 567–576. Sunna, A., Moracci, M., Rossi, M. & Antranikian G. 1997 Glycosyl hydrolases from hyperthermophiles. Extremophiles 1, 2–13. Tahirov, T.H., Oki, H., Tsukihara, T., Ogasahara, K., Yutani, K., Ogata, K., Izu, Y., Tsunasawa, S. & Kato, I. 1998 Crystal structure of methionine aminopeptidase from hyperthermophile, Pyrococcus furiosus. Journal of Molecular Biology 284, 101–124. Takase, K. 1994 Site-directed mutagenesis reveals critical importance of the catalytic site in the binding of a-amylase by wheat proteinaceous inhibitor. Biochemistry 33, 7925–7930. Tseng, C.C., Miyamoto, M., Ramalingam, K.C., Hemavathy, K.C., Levine, M.J. & Ramasubbu, N. 1999 The roles of histidine residues at the starch-binding site in streptococcal-binding activities of human salivary amylase. Archives of Oral Biology 44, 119–127. Vieille, C., Burdette, D.S. & Zeikus, J.G. 1996 Thermozymes. Biotechnology Annual Review 2, 1–83. Vieille, C. & Zeikus G.J. 2001 Hyperthermophilic enzymes: sources, use, and molecular mechanism for thermostability. Microbiology and Molecular Biology Reviews 65, 1–43. Vihinen, M. & Ma¨ntsa¨la¨, P. 1989 Microbial amylolytic enzymes. CRC Critical Reviews in Biochemistry and Molecular Biology 24, 329–418. Wallace, A.C., Laskowski, R.A. & Thornton, J.M. 1995 LIGPLOT: a program to generate schematic diagrams of protein–ligand interactions. Protein Engineering 8, 127–134.


Ó Springer 2005

Development of diagnostic test methods for detecting key wildlife pathogens in bacteria-containing commercial biodegradation products Jennifer A. Sibley1, Rebecca H. Cross1, Anita L. Quon1, Kara Dutcyvich1, Tomas A. Edge2, Frederick A. Leighton1 and Greg D. Appleyard1,* 1 Department of Veterinary Pathology, University of Saskatchewan, 52 Campus Drive, Saskatoon, SK, Canada STN 5B4 2 National Water Research Institute, Environment Canada, Burlington, Ontario, Canada. *Author for correspondence: Department of Veterinary Microbiology, University of Saskatchewan, 52 Campus Drive, Saskatoon, SK, Canada S7N 5B4. Tel.: +1-306-966-7213, Fax: +1-306-966-7244, E-mail: [email protected] Keywords: Bacteria, biodegradation products, diagnostic methodology, polymerase chain reaction, pathogen

Summary Bacteria-containing commercial products, sold to facilitate biodegradation of human and animal wastes, consist of complex mixtures of bacteria. These mixtures are often of undetermined composition and grown in batch cultures from diverse bacteria-rich inocula of proprietary origins. In order to provide a means of testing for the presence of small numbers of microorganisms, pathogenic to terrestrial or avian wildlife, in bacteria-containing biodegradation products, five DNA extraction protocols were tested for their ability to purify total genomic DNA from nine biodegradation products of different formulations. A diatomaceous earth and guanidine thiocyanate-based DNA extraction method was found to be the most reliable. Fourteen microorganism-specific polymerase chain reaction (PCR)-based assays were developed. Each PCR assay was demonstrated to be specific using DNA from 61 other species of microorganisms (105 different isolates). The mean detection limit for 10 assays using cultured organisms spiked into biodegradation products was assessed. The mean was 1 102.62 ± 1 101.58 c.f.u.g)1 (bacteria) and 1 103.88 ± 1101.14 cells g)1 (protozoa). There were no target wildlife pathogens detected by the 14 PCR assays in unspiked biodegradation products. This study has demonstrated that molecular diagnostic means can be used to detect small numbers of selected wildlife pathogens in complex biodegradation products.

Introduction Bacteria-containing commercial products, sold to facilitate biodegradation of human and animal wastes can be purchased in commercial retail stores in a variety of different solid, liquid and powdered formulations. These products are marketed to household, farm and small business consumers, as safe, organic, natural wastetreatment products. Most products of this type are sold for bio-remediation applications such as drain cleaning, enhancement of septic tank performance, pesticide spill clean-up, biofiltration of air emissions, livestock and poultry waste treatment and reduction of farm and sewage odours for use in feed-lots, manure storagelagoons, poultry barns, gutters and waste-holding tanks, septic tanks and waste-water drains in homes, cottages and restaurants. Frequently, these bacteria-based biodegradation products are consortia of bacteria and manufacturers maintain their source as proprietary information. However, one could speculate that sources rich in bacteria with potentially biodegradative properties, such as

municipal wastewater and composted manure may have been used (Entry et al. 2002, Cotta et al. 2003, Lu et al. 2003) where pathogenic bacteria can also be found (Lu et al. 2003, Millner & Karns 2003). Use of these products in close proximity to livestock as well as aquatic, terrestrial and avian wildlife has the potential for deleterious effects on wildlife health (Bryan et al. 1994). Of particular concern is the risk that some bacteria-based products, derived from environmental sources, such as municipal or livestock wastes, may also contain pathogenic organisms which have survived or even proliferated in the manufacturing process. Any risk that these products pose cannot be accurately assessed without reliable and specific diagnostic tests, suited to the identification of small amounts of bacteria in a variety of product matrices. To address the need for valid microorganism detection assays with which to test these commercial bacteriabased biodegradation products, a molecular-diagnostic approach was taken. This report describes the development of a DNA extraction protocol suitable for purifying DNA from many biodegradation products, as well

418 as the development of 14 polymerase chain reaction (PCR) protocols for the detection of selected animal pathogens.

Materials and methods Experimental design Fourteen pathogenic microorganisms (Campylobacter sp., Clostridium piliforme, Clostridium botulinum Type C, Cryptosporidium parvum, Francisella tularensis, Giardia lamblia, Mycobacterium avium, Mycobacterium bovis, Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella multocida, Reimerella anatipestifer, Salmonella enterica and Toxoplasma gondii) were chosen as targets for diagnostic testing because they represent a broad range of important animal pathogens which can survive in synanthropic environments and be a health risk for livestock as well as aquatic, terrestrial and avian wildlife. Fifteen separate PCR protocols were developed, one for each of the 14 selected pathogens in the study and one additional assay specific for Bacillus sp. (present in all the commercial products tested) to be used only to assess the utility of five extraction methods. The 14 pathogen-specific assays were tested for microorganismspecificity using DNA extracted from 105 bacteria isolates representing 61 different species. The lowest limit of detection was obtained for 10 of these assays by spiking the appropriate microorganism into samples of the biodegradation products and testing by PCR. Detection limits for Clostridium piliforme, Clostridium botulinum, Toxoplasma gondii and Francisella tularensis were not determined for technical and biosafety reasons. Bacteria-based commercial products Nine products (A, BioBrick, ZEP Manufacturing Company, Carterville, GA, USA; B, AIRx32 Bio-enzymatic Drain Opener, Airx Laboratories, Folcroft, PA, USA.; C, Drain Guard Plus, ZEP Manufacturing Company, Carterville, GA, USA; D, Septic System & Cesspool, ZEP Manufacturing Company, Carterville, GA, USA.; E, Septonic, A.H.T. Field & Co. Ltd.; F, Septabs, Sanitation Equipment Limited, New Westminister, BC, Canada; G, Sani-zyme, ZEP Manufacturing Company of Canada, Edmonton, AB, Canada; H, Kemsol’s Big ‘‘G’’, Kemsol Products Limited, Saskatoon. SK, Canada; I, Kemsol’s Enzyme Blocks, Kemsol Products Limited, Saskatoon, SK, Canada) were selected based on local availability and formulation styles; solid, liquid or powder. All products were identified on their label as containing bacteria. All products were shown to contain bacterial DNA by a PCR assay which targeted the 16S rRNA gene of Bacillus species. Routine culture of all products revealed primarily Bacillus and Pseudomonas species in each.

J.A. Sibley et al. Bacteria controls One hundred and five isolates representing 61 species of microorganisms used as specificity-controls in this study were obtained from Dr M. Chirino-Trejo (Veterinary Microbiology, WCVM, University of Saskatchewan) and Dr M. Ngeleka (Prairie Diagnostic Services, Saskatoon, Saskatchewan). For positive controls and assay optimisation, Campylobacter sp., Clostridium piliforme, Clostridium botulinum Type C, Francisella tularensis, Pasteurella multocida and Salmonella sp. were obtained from Dr M. Chirino-Trejo (Veterinary Microbiology, University of Saskatchewan). Mycobacterium avium and Mycobacterium bovis were obtained from C. Turenne (National Reference Centre for Mycobacteriology). Cryptosporidium parvum was obtained from Dr Brent Dixon (Bureau of Microbial Hazards, Health Canada) and Pleasant Hill Farms (Troy, Idaho). Reimerella anatipestifer (ATCC 11845), Mycoplasma gallisepticum (ATCC 19610) and Toxoplasma gondii (ATCC 50851) were purchased from American Type Culture Collection (Manassas, Virginia). Giardia lamblia was obtained from Dr B. Dixon (Bureau of Microbial Hazards, Health Canada). Campylobacter sp. was grown on Preston agar, Clostridium botulinum were grown on blood agar (anaerobic), Pasteurella multocida, Salmonella enterica and Reimerella anatipestifer was grown on blood agar. Mycoplasma gallisepticum was grown on Hay-Flick agar. Clostridium piliforme was obtained from formalin-fixed paraffin embedded animal tissue. Isolation of DNA Five different DNA extraction techniques (methods 1–5) were assessed for an ability to purify DNA from the biodegradation products, in sufficient amount and quality, to support PCR amplification of the Bacillus sp.16S rRNA gene. Results were scored as either positive (supporting amplification) or negative (not supporting amplification). This experiment was performed in duplicate. Method 1. This method was adapted from Sambrook et al. (1989). Approximately 0.2 g samples, or pellets centrifuged from 1 ml of liquid products, were homogenized in 500 ll of lysis buffer (100 mM NaCl, 500 mM Tris (pH 8.0), 10% sodium dodecylsulphate, 0.2 mg ml)1 proteinase K), vortexed for 5 s and then incubated for 2 h at 65 °C. An equal volume of Tris-buffered phenol–chloroform (1 : 1 v/v, pH 8.0) was added and the mixture vortexed for 30 s and then centrifuged for 5 min at 15,000 g. The aqueous phase was removed to a clean tube and the phenol–chloroform extraction was repeated. Again the aqueous phase was removed to a clean tube and 2.5 volumes of ice-cold 95% ethanol (containing 0.3 M sodium acetate) was added, mixed by gentle inversions and incubated overnight at )20 °C. DNA was recovered by centrifugation for 15 min at 4 °C and 15,000 g. The ethanol was decanted and the

419

PCR methods for use with biodegradation products DNA pellet washed twice with 80% ethanol, dried under vacuum for 5–10 min and then dissolved in sterile water. Method 2. Approximately 0.2 g samples, or pellets centrifuged from 1 ml of liquid products, were added to tubes containing 1 ml of 10 mM phosphate-buffered saline (8.4 g NaCl, 1.15 g Na2HPO4, 0.2 g KH2PO4, H2O to IL) to dissolve soluble components from the various products. The remaining solid material was concentrated by centrifugation for 30 s at 15,000 g. This washing procedure was repeated twice and the remaining sample was processed as described in method 1. Method 3. This method was adapted from Pitcher et al. (1989). Approximately 0.2 g samples, or pellets centrifuged from 1 ml of liquid products, were added to tubes containing 400 ll D-Solution (4 M guanidine thiocyanate, 25 mM sodium citrate (pH 8.0), 0.5% sarcosyl, 0.1 M 2-mercaptoethanol) and vortexed for 30 s. Chloroform (200 ll) was added and the sample vortexed again and then incubated for 10 min at )20 °C. The samples were centrifuged for 5 min at 4 °C and 15,000 g and the aqueous layer removed to a clean tube containing 200 ll of chloroform. The washing step was repeated and then the aqueous phase was removed to a clean tube containing 500 ll of 95% ethanol (containing 0.3 M sodium acetate). Samples were mixed gently and incubated for at least 1 h at )20 °C. DNA was concentrated by centrifugation for 15 min at 4 °C and 15,000 g. The ethanol was decanted and the DNA pellet, washed twice with 80% ethanol, dried under vacuum for 5–10 min and then dissolved in sterile water. Method 4. This method was adapted from McLauchlin et al. (1999). Approximately 0.2 g samples, or pellets centrifuged from 1 ml of liquid products, were added to tubes containing 200 ll of 0.1 mm diameter zirconiasilica beads (Biopsec Products Inc.), 900 ll GuSCN– Tris buffer (5.5 M guanidine thiocyanate, 0.05 M Tris– HCl (pH 6.4)) and 60 ll isoamyl alcohol. This mixture was vortexed for 2 min and left to stand for 5 min at room temperature. The sample was centrifuged for 5 min at 15,000 g and the supernatant transferred to clean tube containing 100 ll suspension of 20% w/v diatomaceous earth (DE) in 0.17 M HCl. The sample was incubated for 10 min at room temperature with gentle agitation and then centrifuged for 30 s at 15,000 g. The supernatant was discarded and the DE pellet was washed twice with 1 ml of GuSCN–Tris buffer, once with 1 ml of 80% ethanol then once with 1 ml of acetone. The final DE pellet was dried under vacuum for 5 min and DNA was eluted from the DE with 100 ll of sterile water. Method 5. This method was adapted from Cohen et al. (1996). Approximately 0.2 g of the solid or powder products were suspended in 1 ml of lysis buffer (5 M

guanidine thiocyanate, 22 mM EDTA, 0.05 M Tris– HCl (pH 6.4), 0.65% Triton X-100) and incubated at room temperature for 1 h. Alternatively, 1 ml of a liquid product was centrifuged (15,000 g, 5 min) and then the pellet was re-suspended in 1 ml of lysis buffer and incubated at room temperature for 1 h. Lysed samples were centrifuged (15,000 g, 30 s) and the supernatant transferred to a clean tube containing 100 ll of DE suspension (20% DE in 0.17 M HCl). After vortexing 10 s and centrifugation (15,000 g, 30 s), the pellet was washed twice with 1 ml GuSCN–Tris buffer (5.5 M guanidine thiocyanate, 0.05 M Tris–HCl (pH 6.4)), washed twice with 80% ethanol (1 ml) and washed once with acetone (1 ml). The sample was vacuum dried and DNA was eluted from the DE with 100 ll of sterile, ultra-pure water. Polymerase chain reaction The primers and amplification conditions are listed in Table 1. All primer sets were designed specifically for this project with the exception of the primer set for M. bovis (Miller et al. 1997), Cryptosporidium parvum (Lindergard et al. 2003) and Clostridium botulinum (Williamson et al. 1999). PCR reaction mixtures were prepared using sterile water and reagents purchased from Fermentas Inc. (Burlington, Ontario, Canada). The 48 ll PCR reaction mixture contained 5 ll of 10 PCR buffer, 4 ll of 25 mM MgCl2, 0.5 ll of 25 mM dNTP mixture, 2 ll of each primer (20 pmol ll)1), 0.25 ll of Taq polymerase and 34.25 ll of sterile water. Two microlitres of the DNA sample was used in the PCR assay and the remainder stored at )70 °C. The reaction mixture was overlaid with one drop of mineral oil. The thermal cycler (PTC 200, MJ Research Inc., Waltham, MA) conditions began with an initial denaturation at 94 °C for 3 min followed by 40 cycles of, 94 °C for 30 s, an annealing temperature (see Table 1) for 60 s, and an extension at 72 °C for 60 s. Reactions finished with a final extension phase of 72 °C for 5 min. Amplified PCR products were analysed by electrophoresis though a 1.5% agarose gel, staining with ethidium bromide and visualizing with a UV transilluminator. Positive controls consisted of DNA extracted from the appropriate cultured microorganism and negative controls consisted of water instead of DNA. Extraction negative control was also performed. PCR specificity and sensitivity Serial dilutions in water or broth were made from a fresh culture of each pathogen target and 10 ll of each dilution was plated on appropriate nutrient agar. In addition, 10 ll of each dilution was also spiked into 0.2 g samples, or into 1 ml of liquid products, of each biodegradation product. DNA was then extracted (method 5) from the product samples. Each dilution experiment was performed five times. Primer specificity was determined using DNA (extraction method 1) from

420

J.A. Sibley et al.

Table 1. PCR assay conditions, primers and sequence source. Microorganism

PCR assay conditions and primers

Source

Bacillus sp. Bac-F Bac-R Campylobacter sp. Camp-F Camp-R Clostridium piliforme Cpili-F Cpili-F2 Cpili-R Clostridium botulinum Type C ToxC-384 ToxC-625 ToxC-850R ToxC-1049R

Product size = 401 bp Ta = 60 °C CGTGGGGAGCGAACAGGATTAGAT TTGTCACCGGCAGTCACCTTAGAG Ta = 66 °C Product size = 709 bp TACCAAGGCTATGACGCATAACTG GATATCAAGTCCGGGTAAGTTCT Ta = 55 °C Product size = 278 or 441 bp CCTTCGGGGCAATGGAT (278 bp) AACGCAATAAGCACTCCA (441 bp) CCGAACTGGGACTACTTTTATG Ta = 56 °C Product size = see below AAACCTCCTCGAGTTACAAGCCC CTAGACAAGGTAACAACTGGGTTA GAAAATCTACCCTCTCCTACATCA AATAAGGTCTATAGTTGGACCTCC Primer set: 324 and 850R—526 bp Primer set: 625 and 1049R—424 bp Primer set: 625 and 850R—225 bp Ta = 53 °C, 56 °C (2°) Product size = 638 bp GATTAAGCCATGCATGTCTAA (primary) TTCCATGCTGGAGTATTCAAG (primary) CAGTTATAGTTTACTTGATAATC (secondary) CCTGCTTTAAGCACTCTAATTTTC (secondary) Ta = 55 °C Product size = 459 bp GTGTTAGGGCATTTCGAGGAGTCT CTGGCCAGTTCTATCTTGAGG Ta = 58 °C Product size = 480 bp TCTTCCCGGATTTTATGACG AATCTCGCGCTCCTTGAA Ta = 72 °C Product size = 123 bp CTCGTCCAGCGCCGCTTCGG CCTGCGAGCGTAGGCGTCGG Ta = 70 °C Product size = 473 bp CGCGGCTTCGGGTGCTCATCCAGA CGCGTCACCCACCACCGTCACCAC Ta = 52 °C Product size = 185 bp TTGCAGTGGGTGGTGTAAGTT TCGGAGTAGAAGTTGGTTGTGGAT Ta = 55 °C Product size = 210 bp GAGAAGCAAAATAGTGATATCA CAGTCGTCTCCGAAGTTAACAA Ta = 67 °C Product size = 423 bp TCGCGTAGCATATGTGGTAGAT AAGTATGGCGCGATTTTAGAT Ta = 67 °C Product size = 407 bp TAGCGAAAATAAACCATACACTCA GGTCCTGCTACATCAACACAAG Ta = 55 °C Product size = 423 bp CGCAGGTGCCTTTCTCCAT TCGCGCCTTTCCTTATCATCT Ta = 64 °C Product size = 232 bp GAAGCGTGATAGTATCGAAA CACTCTCTCTCAAATGTTCCT

Accession AB055007

Cryptosporidium parvum SSU-1 SSU-2 SSU-3 SSU-4 Francisella tularensis Ftu1-F Ftu1-R Giardia lamblia Gia3-F Gia3-R Mycobacterium bovis IS6110-F IS6110-R Mycobacterium avium Mbav-F Mbav-R Mycoplasma gallisepticum MpGal-F MpGal-R Mycoplasma synoviae MSL-F MSL-R Pasteurella multocida Pmult-R Pmult-F Reimerella anatipestifer Reim2-F Reim2-R Salmonella enterica Salm-F Salm-R Toxoplasma gondii TG-ITS1-F TG-ITS1-R

61 different bacterial species (Table 2) to identify possible sources of PCR cross-reactions using the same PCR conditions as previously described.

Results DNA extraction method 3 did not provide DNA that could support amplification. Methods 1, 2 and 4

Accession AF022768

Accession S72349

Williamson et al. (1999)

Lindergard et al. (2003)

Accession M93695

Accession AB067649

Miller et al. (1997)

Accession U43598

Accession AF214004

Lauerman et al. (1993)

Accession AF411317

Accession AF104937

Accession M18283

Accession L49390

provided amplifiable Bacillus sp. DNA from several but not all of the nine biodegradation products. Method 5 provided Bacillus sp. amplifiable DNA from all nine biodegradation products (Table 3). Given that DNA extraction method 5 worked best for all the products in this study, this method was used to optimize the 15 PCR protocols. None of the 14 target pathogens were detected in any of the biodegradation products assayed, however, each

421

PCR methods for use with biodegradation products Table 2. Bacterial isolates (n=105) representing 61 species were assayed by PCR to determine specificity of the 15 PCR assays developed for this project. All isolates were obtained from the Western College of Veterinary Medicine, Department of Veterinary Microbiology. All assays were negative except when testing with the appropriate PCR primer set. Organism

No. of strains tested

Actinobacillus equuli 1 Actinobacillus lignieres 2 Actinobacillus parasuis 1 Actinobacillus pleuropneumoniae 2 Actinobacillus suis 1 Aeromonas hydrophilia 1 Arcanobacterium pyogenes 1 Bacillus sp. 17 Bacillus subtilis 2 Bordetella bronchiseptica 2 Brucella suis 1 Citrobacter freundii 1 Clostridium perfringens 2 Corynebacterium pseudotuberculosis 1 Corynebacterium renale 1 Enterobacter cloacae 1 Enterobacter sp. 1 Enterococcus faecalis 4 Enterococcus sens 1 Enterococcus sp. 1 Erysipelothrix rhusiopathiae 1 Escherichia coli 1 Haemophilus parasuis 1 Haemophilus somnus 1 Haemophilus sp. 1 Hafnia alvei 1 Klebsiella oxytoca 1 Klebsiella pneumoniae 1 Listeria monocytogenes 1 Micrococcus luteus 1 Moraxella bovis 1 Morganella morganii 1 Mycoplasma arginini 1 Mycoplasma bovis 2 Mycoplasma canis 2 Mycoplasma flocculare 2 Mycoplasma hyopneumoniae 1 Mycoplasma hyorhinis 2 Ornithobacterium rhinotrachealis 1 Pasteurella aerogenes 2 Pasteurella canis 1 Pasteurella gallinarum 1 Pasteurella haemolytica (ATCC# 33365) 1 Pasteurella multocida 9 Pasteurella pneumotrophin 1 Proteus mirabilis 2 Proteus vulgaris 1 Providencia stuartii 1 Pseudomonas aeruginosa 4 Pseudomonas sp. 1 Sacchromyces carlsburgensis 1 Salmonella sp. 1 Serratia marcescens 1 Shigella sp. 1 Staphylococcus aureus 1 Staphylococcus epidermidis 1 Staphylococcus hyicus 2 Staphylococcus intermedius 3 Staphylococcus sens 1 Yersinia enterocolitica 1 Yersinia pseudotuberculosis 1

PCR result

Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg.

Table 3. Amplification of DNA extracted from biodegradation products by different extraction methods (replicates = 2). Product

A B C D E F G H I

Method 1

2

3

)) )) )) )) )) )) )) )) ++

)) )) )) )) )) ++ )) )) ++

) ) ) ) ) ) ) ) )

) ) ) ) ) ) ) ) )

4

5

++ )) )) )) ++ ++ )) ++ ++

+ + + + + + + + +

+ + + + + + + + +

pathogen-specific PCR was able to detect bacterial or protozoan genomic DNA from the correct microorganism when a sufficient number of cells of that microorganism were spiked into bacteria-based biodegradation products. No PCR products were detected when pathogen PCR primers were tested against DNA extracts from 61 other microorganisms. The detection limit (mean log10 c.f.u. and SD) of each PCR assay is presented in Table 4. The mean detection limit for all assays using cultured organisms spiked into biodegradation products was 1 102.62 ± 1 101.58 c.f.u.g)1 (bacteria) and 1 103.88 ± 1 101.14 organisms per gram (protozoa). The range in detection limit for bacteria was 1–1 104.6 c.f.u.g)1 and for protozoa 1 102.2–1 105.8. Values for detection limit sensiti vity in each assay showed no deviation from a Gaussian distribution using the Kolmogorov–Smirnov test (GraphPad Prism version 3.02 for Windows, GraphPad Software, San Diego, California, USA). There was considerable variation between replicates. Two-way analysis of variance showed significant differences within both assay (P ¼ 0.0001) and product groups (P ¼ 0.0002).

Discussion The focus of this study was on developing PCR-based molecular diagnostic assays to identify wildlife pathogens in commercial preparations of live bacteria sold for the purposes of biodegradation of biological wastes. Since domestic and wild animals and birds might be exposed to the introduced microorganisms in agricultural and other synanthropic environments, widespread distribution of such commercial preparations could lead to the inadvertent introduction of a pathogen in sufficient quantity and result in the appearance of a new disease or outbreak. This may occur, for instance, if a pathogen is introduced to a location beyond its normal geographic range or to a population of previously unexposed individuals. In order to assess the safety of these products, there is a need for suitable diagnostic test procedures capable of detecting potentially small numbers of selected pathogenic bacteria contaminating

422

J.A. Sibley et al.

Table 4. Detection cates = 5).

limit

sensitivity

(log10 c.f.u. ± SD),

(repli-

Product

Campylobacter sp.

Cryptosporidium sp.

Giardia

A B C D E F G H I

3.8 3.8 3.8 2.1 3.8 2.1 2.3 3.1 3.8

3.6 2.6 3.0 4.6 3.6 5.4 3.2 2.2 3.2

3.8 4.6 3.2 4.2 4.8 5.8 4.0 2.8 5.2

Product

M. bovis

A B C D E F G H I Product

± ± ± ± ± ± ± ± ±

0.8 0.8 0.8 1.4 0.8 1.4 1.2 1.6 0.8

± ± ± ± ± ± ± ± ±

0.5 0.5 0.7 0.5 0.9 0.5 0.8 0.4 0.4

± ± ± ± ± ± ± ± ±

0.4 0.5 0.4 0.4 1.3 0.4 0.0 0.8 0.4

ND ND ND 1.6 ± 2.2 ND 0.0 ± 0.0 0.0 ± 0.0 ND ND

Mycobacterium avium ND ND ND 3.4 ± 0.5 ND 2.4 ± 2.1 3.0 ± 1.7 ND ND

Mycoplasma gallisepticum 2.7 ± 2.0 3.1 ± 2.0 2.7 ± 1.6 2.0 ± 1.4 3.5 ± 1.0 1.7 ± 1.0 2.5 ± 1.6 2.3 ± 1.3 3.1 ± 1.9

A B C D E F G H I

Mycoplasma synoviae 3.9 ± 0.5 1.2 ± 0.6 2.6 ± 0.0 4.6 ± 1.2 1.2 ± 0.5 2.6 ± 1.2 2.0 ± 0.9 0.2 ± 1.3 2.9 ± 0.5

Pasteurella multocida 3.2 ± 1.0 2.0 ± 0.4 2.0 ± 1.6 1.6 ± 0.5 3.2 ± 1.0 2.9 ± 1.5 2.2 ± 1.3 1.8 ± 1.5 1.8 ± 1.5

Reimerella anatipestifer 3.2 ± 1.8 3.6 ± 1.2 2.4 ± 1.9 1.8 ± 1.7 3.0 ± 2.4 1.6 ± 1.3 0.7 ± 0.9 2.0 ± 2.7 2.7 ± 1.7

Product A B C D E F G H I

Salmonella sp. 3.9 ± 1.4 3.5 ± 1.0 3.9 ± 0.7 3.1 ± 1.0 3.9 ± 0.7 2.7 ± 1.7 3.1 ± 1.0 3.5 ± 1.2 2.9 ± 1.4

ND = not determined, test not conducted.

rich cultures of benign bacteria. Molecular methods were developed and optimized to detect selected wildlife pathogens, first by examining five different DNA extraction protocols and then by demonstrating the efficiency of specific PCR protocols to detect pathogens spiked into nine different commercial products. Until recently microbiological culture of infectious agents was accepted as a ‘‘gold standard’’ for infectious disease diagnosis. However, comparative studies have demonstrated that PCR has a number of advantages compared to microbiological culture methods. PCR assays can analyse minute samples with high specificity. The detection limit of PCR assays is often high enough to detect 10–100 copies of a target region of DNA and theoretically a single molecule of DNA can be detected. Microbiological culture often requires several days,

weeks or even months to obtain results. PCR results can be available in several hours. Isolation of many microorganisms is difficult, expensive or impossible (e.g., parasites and fastidious bacteria). With PCR, any microorganism can be detected regardless of its ability to be cultured in a laboratory. Culture requires viable microorganisms to be present in the specimen. With PCR, both live and dead microorganisms may be detected. For these reasons, PCR was selected as an appropriate approach to the detection of important bacterial and protozoan pathogens in bacteria-based biodegradation products. Detection of amplifiable DNA is an evidence that an extraction method produces both a suitable amount of high quality DNA (not sheared), as well as DNA free of Taq polymerase inhibitors. High quality DNA was consistently obtained from all nine products with extraction method 5. This method, which used DE to capture DNA under conditions of high salt concentrations, has been used previously to successfully extract DNA from faecal samples which are known to contain inhibitors of Taq polymerase (Argyros et al. 2000). As noted above, PCR is able to detect very small numbers of microorganisms when DNA is extracted from fresh cultures that are free of inhibitors and other DNA (Burtscher & Wuertz 2003). In this study, the average minimum detection limit for all 10 pathogenspecific assays was approximately 420 c.f.u. bacteria and 7600 protozoan organisms, suggesting that inhibitors or other interfering components were still present, however, bacteria and protozoa could still be detected when present in relatively small numbers. A detection limit of this magnitude compares favourably with other extraction protocols for microorganisms in problematic substrates such as faeces, soil and ground beef (Braid et al. 2003; Cui et al. 2003; Trochimchuk et al. 2003). Given that these products reportedly contain greater than 1 106 bacteria (c.f.u.g)1 or c.f.u. ml)1; manufacturer’s product literature), standard culturing techniques may not be sufficiently sensitive or specific to detect small amounts of some microorganisms among these product’s intended high bacteria contents. The molecular approach allows for detection of small numbers of pathogens contaminating concentrated bacterial preparations. Significant differences in detection limit were observed within assay or product groups. It is not surprising that different PCR assays have different detection limits, based on differences in sequence-specific primer-binding causing differences in reaction efficiency and frequency of target copy number per microorganism. However, differences in detection limit between product groups suggest that different products contain different amounts or kinds of amplification inhibitors. While the protocols developed in this study appear to work across a variety of product manufacturers and formulations, the detection limit may not be predictable. The quantity of biodegradation products sold and used around the world is not known, though it is likely

PCR methods for use with biodegradation products that their distribution is widespread. To our knowledge, no disease outbreak has been attributed to the use of biodegradation products, however, until studies have been conducted to demonstrate that the processes used to manufacture bacteria-containing commercial products does not permit the survival and growth of pathogenic microorganisms, ongoing surveillance and quality assurance testing needs to be established. The list of microorganisms for which detection assays were developed includes primarily, pathogens of terrestrial or avian wildlife. Similarly, assays to detect pathogens of aquatic wildlife are also urgently required.

Acknowledgements The authors thank Canada’s EMBRR Program for financial support of this project. We thank K. Marshall (National Wildlife Research Centre, Environment Canada) and members of the Canadian Cooperative Wildlife Health Centre for important logistic and scientific support. We thank T. Bollinger (Western College of Veterinary Medicine) for critical review of the manuscript. We are grateful to M. Chirino-Trejo (Western College of Veterinary Medicine), B. Dixon (Bureau of Microbial Hazards, Health Canada) and M. Ngeleka (Prairie Diagnostic Services) for providing control samples. We received the generous cooperation of C. Turenne and A. Kabani at the National Reference Centre for Mycobacteriology, National Microbiology Laboratory, Health Canada, Winnipeg who allowed us to proceed with work on Mycobacterium avium and Mycobacterium bovis from their collection and in their laboratory.

References Argyros, F.C., Ghosh, M., Huang, L., Masubuchi, N., Cave, D.R. & Gru¨bel, P. 2000 Evaluation of a PCR primer based on the isocitrate dehydrogenase gene for detection of Helicobacter pylori in feces. Journal of Clinical Microbiology 38, 3755–3758. Braid, M.D., Daniels, L.M. & Kitts, C.L. 2003 Removal of PCR inhibitors from soil DNA by chemical flocculation. Journal of Microbiological Methods 52, 389–393. Bryan, R.T., Pinner, R.W. & Berkelman, R.L. 1994 Emerging infectious disease in the United States. Annals of the New York Academy of Science 740, 316–361. Burtscher, C. & Wuertz, S. 2003 Evaluation of the use of PCR and reverse-transcriptase PCR for the detection of pathogenic bacteria

423 in biosolids from anaerobic digestors and aerobic composters. Applied and Environmental Microbiology 69, 4618–4627. Cohen, N.D., Martin, L.J., Simpson, R.B., Wallis, D.E. & Neibergs, H.L. 1996 Comparison of polymerase chain reaction and microbiological culture for detection of salmonellae in equine feces and environmental samples. American Journal of Veterinary Research 57, 780–786. Cotta, M.A., Whitehead, T.R. & Zeman, D. 2003 Isolation, characterization and comparison of bacteria from swine faeces and manure storage pits. Environmental Microbiology 5, 737–745. Cui, S., Schroeder, C.M., Zhang, D.Y. & Meng, J. 2003 Rapid sample preparation method for PCR-based detection of Escherichia coli O157:H7 in ground beef. Journal of Applied Microbiology 95, 129– 134. Entry, J.A., Sojka, R.E., Watwood, M. & Ross, C. 2002 Polyacrylamide preparations for protection of water quality threatened by agricultural runoff contaminants. Environmental Pollution 120, 191–200. Lauerman, L.H., Hoerr, F.J., Sharpton, A.R., Shah, S.M. & van Santen, V.L. 1993 Development and application of a polymerase chain reaction assay for Mycoplasma synoviae. Avian Diseases 37, 829–834. Lindergard, G., Nydam, D.V., Wade, S.E., Schaaf, S.L. & Mohammed, H.O. 2003 A novel multiplex polymerase chain reaction approach for detection of four human infective Cryptosporidium isolates: Cryptosporidium parvum, types H and C, Cryptosporidium canis, and Cryptosporidium felis in fecal and soil samples. Journal of Veterinary Diagnostic Investigations 15, 262–267. Lu, J., Sanchez, S., Hofacre, C., Maurer, J.J., Harmon, B.G. & Lee, M.D. 2003 Evaluation of broiler litter with reference to the microbial composition as assessed by using 16S rRNA and functional gene markers. Applied and Environmental Microbiology 69, 901–908. McLauchlin, J., Pedraza-Dı´ az, S., Amar-Hoetzeneder, C. & Nichols, G.L. 1999 Genetic characterization of cryptosporidium strains from 218 patients with diarrhea diagnosed as having sporadic cryptosporidiosis. Journal of Clinical Microbiology 37, 3153–3158. Millner, P. & Karns, J. 2003 Animal manure: bacterial pathogens and disinfection technologies. EPA Report (in press). Miller, J., Jenny, A., Rhyan, J., Saari, D. & Suarez, D. 1997 Detection of Mycobacterium bovis in formalin-fixed, paraffin-embedded tissues of cattle and elk by PCR amplification of an IS6110 sequence specific for Mycobacterium tuberculosis complex organisms. Journal of Veterinary Diagnostic Investigations 9, 244–249. Pitcher, D.G., Saunders, N.A. & Owen. R.J. 1989 Rapid extraction of bacterial genomic DNA with guanidinium thiocyanate. Letters in Applied Microbiology 8, 151–156. Sambrook, J., Fritsch, E.F. & Maniatis, T. 1989 Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, ISBN 0 87969 309 6. Trochimchuk, T., Fotheringham, J., Topp, E., Schraft, H. & Leung, K.T. 2003 A comparison of DNA extraction and purification methods to detect Escherichia coli O157:H7 in cattle manure. Journal of Microbiological Methods 64, 165–175. Williamson J.L., Rocke, T.E. & Aiken, J.M. 1999 In situ detection of the Clostridium botulinum Type C1 toxin gene in wetland sediments with a nested pcr assay. Applied and Environmental Microbiology 65, 3240–3243.

Springer 2005


A study of polynucleotide phosphorylase production by Escherichia coli in a hollow fibre reactor Shi-Jian Nie1, Lin Ma2, Lian-Xiang Du1 and Bei-Zhong Han2,* 1 School of Food Science and Bioengineering, Tianjin University of Science and Technology, Tianjin 300222, China 2 College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China *Author for correspondence: Tel.: +86-10-62395665, Fax: +86-10-82381443, E-mail: [email protected] Keywords: Escherichia coli, fermentation, hollow fibre reactor, polynucleotide phosphorylase

Summary A 30-l hollow fibre reactor with continuous fermentation for cell recycling of Escherichia coli AS 1.183 was used to remove the inhibitory effects on cell growth and extend the fast growth phase to increase the yield of polynucleotide phosphorylase (PNPase) in E. coli cells. When the dilution rate was 1.5 h)1, the cell concentration of E. coli reached 235 g/l (wet wt, 70% moisture content), with PNPase activity above 90 u/g (wet wt). With the dilution rate is 1.0 h)1, the fermentor volumetric productivity of PNPase in a hollow fiber reactor can reach 974 (u/h * l) compared to 20 (u/h * l) in a conventional batch culture.

Introduction Since its discovery by Ochoa et al. in 1955, polynucleotide phophorylase (PNPase) (EC 2.7.7.8) has been used widely in polynucleotide research (Marumo et al. 1993; Zhang & Yang 1984). PNPase is an intracellular enzyme that can be extracted from bacteria, yeast, eukaryotic, and higher animal and plant cells (Glazunov et al. 1997). Escherichia coli (E. coli) cell has often been used for large-scale production of PNPase (Xie et al. 1988). However, metabolic inhibitors (mainly organic acids, and other low molecular chemicals) substantially limits the growth of E. coli, the cell concentration of E. coli can only reach 8–15 g/l (wet wt, 70% moisture content) in batch cultures (Zhang & Yang 1984). Industrial production requires a large fermentor to obtain commercial quantities of E. coli cells for extracting PNPase. PNPase’s extractive rate is relatively low because the cell’s PNPase accumulation in the harvest phase is not high, and PNPase activity is also affected by lengthy downstream treatments (Xie et al. 1988). The purpose of this paper is to investigate the relationship between PNPase activity and the growth rate of E. coli. Potentially, the faster the growth, the higher the PNPase activity in the cells, as PNPase plays a key role in the metabolism of RNAs in bacteria (Jones et al. 2003). The highest PNPase activity should occur during the fast growth phase. Cell concentration in the fast growth phase, however, is usually too low as a result of low PNPase productivity. To overcome these problems, a cell recycling fermentor with a hollow fibre membrane filter was used to extend the fast growth phase, so that more E. coli cells could be harvested during

latter stages of the fast growth phase while the activity of PNPase in cells is still at a high level (Chang et al. 1994). Materials and methods Cell recycling system and its operation The E. coli strain used in this study (AS 1.183) came from the Chinese Academy of Science. The experimental design for the cell recycling membrane system is shown in Figure 1. A hollow fibre membrane filter cartridge was attached to a 30-l fermentor (MD-300, L.E. MARUBISHI, Japan, working volume 20 l). Cell broth was recirculated in the fermentor using a peristaltic pump (7554-50 Cole Parmer Co. USA). A fresh medium was continuously supplied to the fermentor and the inhibitor removed by the membrane filter. To balance outlet flow, a peristaltic pump was used to adjust the feed rate of the medium (Bibal et al. 1991; Piret & Cooney 1991). Cells were collected by continuous centrifuge (CM-60RN, TOMY SEIKO Co. Japan) at 12,000 · g and then preserved at )20 C prior to further use (Zhang & Yang 1984). Filter membrane The asymmetric hollow fibre membrane (Tianjin Institute for Membrane, China) was made of polysulfone, with inner and outer diameters of 1.0 and 1.2 mm and a molecular cut-off of 100,000 Da (Kang et al. 1990; Uribelarrea et al. 1990). The total hollow fibre surface area was 2 m2. The filter system, sterilized with 5 mg/l sodium hypochlorite solution for 2 h and washed with

426

S.-J. Nie et al. 6

7

8 1

3 4

2

5

Figure 1. Hollow fibre reactor system: (1), fermentor; (2), hollow fibre membrane filter; (3), medium tank; (4), 2 M NaOH solution; (5), pH meter and controller; (6), pump; (7), value; (8), flowmeter.

2–4 C, a supernatant as raw PNPase was obtained. The reaction mixture contained 30 mg sodium cytidine diphosphate (CDP-Na), 5 lM MnCl2, 1 ml 0.2 M Tris–HCl buffer (pH 9.0), 0.5 ml PNPase, and 0.5 ml water. The mixture was incubated at 37 C for 30 min, and the reaction stopped using 1 ml perchloric acid (100 g/l). After centrifuging at 6,000 · g for 30 min at 2–4 C, the precipitate was re-suspended in 3 ml of 0.02 M Tris buffer (pH 8.0) and read with a OD257 (a unit of PNPase was defined as 1.0 OD257 under the conditions mentioned above) (Pupkova et al. 1983; Zhang & Yang 1984). Productivity calculation

Cell concentration was estimated by measuring optical density (OD) at 570 nm during the E. coli fermentation (Zhang & Yang 1984). Data for cell concentration estimation were standardized at 70% moisture using a dry weight test and recalculation. The specific growth rate (l, h)1) was calculated according to: l ¼ ð1=X Þ ðdX =dtÞ where X is cell concentration (g/l) and t is time (h) (Ohleyer et al. 1985; Chang et al. 1994; ). PNPase activity was measured using a 20 g (slurry) of E. coli suspended in a 500 ml buffer (0.02 M Tris0.001 M EDTA, pH 8.2–8.5). The cell walls were broken using an ultrasonic wave at 2–4 C for 5 min. After the suspension was centrifuged at 6,000 · g for 30 min at

Batch culture of E. coli The relationship between PNPase activity and E. coli growth phase is presented in Figure 2. The results indicate that PNPase activity was related to the specific growth speed of the cells, reaching its highest value in the growth phase, suggesting that cell collection should be done in this phase or later. Unfortunately, the cell density was very low during the growth phase in batch culture, that resulting in the following new method. The PNPase productivity and growth rate were synchronous. Continuous cell recycle culture of E. coli Figure 3 shows the relationship between cell concentration, specific growth rate, and PNPase activity in the

20

200

150

100

50

0

Cell Concentration PNPase Activity Specific Growth Rate

15

2 -1

Analytical methods

Results and discussion

1.5

1

10

0.5

5

Specific Growth Rate (h )

The growth medium of glucose (20 g/l), yeast extract (10 g/l), Na2HPO4 (2 g/l), and K2HPO4 (2 g/l) was sterilized at 121 C for 30 min. For the batch culture, E. coli AS 1.183 were grown aerobically in a 500-ml flask with a 100 ml growth medium in a rotary shaker incubator at 37 C for 16 h. A 2-l inoculum was then introduced into a 30-l fermentor (Joao & Xivier 2000). The fermentation conditions were as follows: agitation rate 350 rev/min, pH 6.5–7.0, temperature 37 C, and dissolved oxygen (DO) at 5 mg/l (Uribelarrea et al. 1990). Oxygen-rich air was used to keep the DO concentration above the 5 mg/l level during fermentation. pH was maintained by automatic addition 10 g/l NaOH solution. For the continuously recycled culture, the inoculum preparation and other controlling conditions were the same as those for the batch culture. The cell recycling system was not operated after inoculation. Cell recycling began after 2 h. The dilution rate ranged from 0.25 to 1.5 h)1 (Charley et al. 1983).

Cell Concentration (g/l)

Culture and medium

Productivity was determined as: medium (u/l) ¼ Average PNPase activity (u/g) · Cell concentration (g/ l) · Working volume (l)/Amount of medium (l) Volumetric productivity of the fermentor (u/ hl) ¼ Average PNPase activity (u/g) · Cell concentration (g/l) · Working volume (l)/Fermentor volume (l) · Culture time (h)

PNPase Activity (u/g)

sterile distilled water, was connected to the fermentor (Bibal et al. 1991; Uribelarrea et al. 1997).

0

0 0

2

4

6

8

10

12

14

16

Time (h)

Figure 2. Cell concentration, PNPase activity and specific growth rate in batch culture. Averages of triplicate experiments.

427 2

150

1.5 Cell Concentration PNPase Activity Specific Growth Rate

100

50

Table 2. Comparison between batch and continuous culture (Dilution rate = 1.0 h)1). -1

200

1

0.5

0

Specific Growth Rate (h )

PNPase Activity (u/g) Cell Concentration (g/l)

PNPase Production by E. coli

0 0

2

4

6

8

10

12

14

16

Culture time (h) Working volume (l) Amount of medium (l) Cell concentration (g/l) Average PNPase activity (u/g) Productivity based on medium (u/l) Volumetric productivity of fermentor (u/hl) a

Time (h)

Figure 3. Cell concentration, PNPase activity and specific growth rate in hollow fiber reactor. Averages of triplicate experiments.

Table 1. PNPase activity and dilution rate. Dilution rate (h)1)

0.5

1

1.5

Cell concentration (g/l) PNPase activity (u/g)

58 ± 3a 61 ± 2

148 ± 5 79 ± 8

235 ± 5 94 ± 12

a

Averages of triplicate ± standard deviations.

hollow fibre reactor when the dilution rate was at 1.0 h)1. PNPase productivity and specific growth rate were also synchronous in the continuous cell recycling culture as they were in the batch culture. Cells numbers harvested in the continuous cell recycling culture were much higher than that in batch culture indicating that the low molecular chemical metabolite inhibitors in the culture were successfully removed and the higher productivity obtained.

Batch culture

Continuous culture

8 20 20 12 ± 2a 20 ± 3 240 20

8 20 160 148 ± 5 79 ± 8 1461 974

Averages of triplicate ± standard deviations.

higher than that in a batch fermentor. Not only was the concentration of E. coli higher (10 times) than that of the batch culture, but the fast growth phase was longer, making it possible to harvest more cells containing high activity of PNPase. The fermentation productivity of PNPase was dramatically enhanced in this experiment, although the dilution rate, the amount of DO, and the supply of nutrients affected the efficiency of cell recycle system. Filtration capacity appears to limits the dilution rate. In this study, the highest dilution rate was at 1.5 h)1; a limit imposed by the pressure capacity of the hollow fibre. The rate of cell growth was also affected by DO concentration. When the concentration of cell was high, oxygen-rich air had to be used to maintain the DO level above a prescribed minimum. Nutrient levels of the medium and availability can also limit the efficiency of the cell recycling system. However, based on the findings presented here, the cell recycling fermentor appears to be suitable for producing material with high value.

Dilution rate and PNPase activity The metabolite inhibitors of E. coli were continuously removed from the culture system by hollow fibre membrane as fresh medium was continuously fed into fermentor. However, the dilution rate can affect the rate of growth of cells as well as PNPase productivity. Table 1 shows that higher dilution rates can lead to increases in E. coli cell concentration and more PNPase accumulation. Ultimately, the dilution rate was finally limited by the capacity of filter membrane. As such, a dilution rate of 0.5, 1.0, 1.5 h)1 was used in this study. Comparison between batch and continuous recycled cell culture Table 2 shows a comparison between the batch culture and continuously recycled cell culture. The results indicate that the continuously recycled cell culture was more efficient than batch culture in producing PNPase (at dilution rate 1.0 h)1). Further, the results suggest that both PNPase and cell concentration in a cell recycling fermentor were much

References Bibal, B., Vayssier, Y. & Goma, G. 1991 High-concentration cultivation of Lactococcus cremoris in a cell-recycle reactor. Biotechology and Bioengineering 37, 746–754. Chang, H.N., Yoo, I.-K. & Kim, B.S. 1994 High density cell culture by membrane-based cell recycle. Biotechnology Advances 12, 467–487. Charley, R.C., Fein, J.E., Lavers, B.H., Lawford, H.G. & Lawford, G.R. 1983 Optimization of process design for continuous ethanol production by Zymomonas mobilis ATCC 29191. Biotechnology Letters 5, 169–174. Glazunov, E.A., Surzhik, M.A. & Dyatlova, N.G. 1997 Specific features of synthesis of the poly (C,U) copolymer by mesophilic and thermophilic polynucleotide phosphorylases. Applied Biochemistry and Microbiology 33, 349–352. Joao, C. & Xavier, A.P. 2000 Model for micro/ultrafiltration cell deactivation in cell-recycle reactors. Journal of Chemical Technology and Biotechnology 75, 315–319. Jones, G.H., Symmons, M.E., Hankins, J.S., & Mackiea, G.A. 2003 Overexpression and purification of untagged polynucleotide phosphorylases. Protein Expression and Purification 32, 202–209. Kang, W., Shukla, R. & Sirkar, K. K. 1990 Ethanol production in a microporous hollow-fiber based extractive fermentor with immobilized yeast. Biotechology and Bioengineering 36, 826–833. Marumo, G., Noguchi, T. & Midorikawa, Y. 1993 Efficient method for the preparation of Escherichia coli polynucleotide

428 phosphorylase suitable for the synthesis of polynucleotides. Bioscience, Biotechnology, and Biochemistry 57, 513–514. Ohleyer, E., Blanch, H.W. & Wilke, C.R. 1985 Continuous production of lactic acid in a cell recycle reactor. Applied Biochemistry and Biotechnology 11, 317–332. Piret, J.M. & Cooney, C.L. 1991 Model of oxygen transport limitations in hollow fiber bioreactors. Biotechology and Bioengineering 37, 80–92. Pupkova, V.I. & Raspopina, G.I. 1983 Measurement of activity of polynucleotide phosphorylase from E. coli. Prikladnaia Biokhimiia Mikrobiologiya 19, 555–559. Uribelarrea, J.L., Queiroz, J.H. & Pareileux, A. 1997 Growth of Schizosaccharomyces pombe on glucose malate mixtures in

S.-J. Nie et al. continuous cell recycle cultures. Applied Biochemistry and Biotechnology 66, 69–81. Uribelarrea, J.L., Winter, J. & Goma, G. 1990 Determination of maintenance coefficients of Saccharomyces cerevisiae cultures with cell recycle by cross-flow membrane filtration. Biotechology and Bioengineering 35, 201–206. Xie, B.-T., Xu, J.-H., Shen, J., Zhang, L.-C., Chen, C. & Wu, F.-Q. 1988 Studies on microbial polynucleotide phosphorylase. Acta Microbiologica Sinica 28, 149–154. Zhang, S.Z. & Yang, K.Y. 1984 Polynucleotide Phosphorylase. In Industrial Enzyme Part 21. ed. Wu, T.S. pp. 768–779. China: Science Press. ISBN 7-03-001543-6/Q1228.

Springer 2005


Optimization of carotenoid production by Rhodotorula glutinis using statistical experimental design P.K. Park1, D.H. Cho1, E.Y. Kim1,* and K.H. Chu2 1 Department of Chemical Engineering, The University of Seoul, Seoul 130-743, Korea 2 Department of Chemical and Process Engineering, University of Canterbury, Private Bag 4800, Christchurch, New Zealand *Author for correspondence: Tel.: +82-2-2210-2530, Fax: +82-2-2216-0570, E-mail: [email protected] Keywords: Carotenoids, factorial design, medium optimization, Rhodotorula glutinis

Summary A two-step optimization strategy of statistical experimental design was employed to enhance carotenoid production from sugar cane molasses (SCM) in the yeast Rhodotorula glutinis. In the first step, a fractional factorial design was used to evaluate the impact of five fermentation factors (pH and concentrations of SCM, urea, KH2PO4, and NaCl). The results revealed that three factors (concentrations of SCM, urea, and KH2PO4) had a significant influence on biomass and carotenoid production. A face-centered central composite design was then used in the second step to optimize the three significant factors to further enhance the biomass yield and carotenoid production. Through this two-step optimization strategy, the carotenoid concentration could be increased from an average of 1.39 mg/l to an average of 3.46 mg/l, representing a 2.5-fold carotenoid production enhancement.

Introduction Carotenoids are a group of natural pigments produced by a wide range of microorganisms and plants. They are used commercially as food colorants and as a source in pigmentation of fish and shellfish in aquaculture. Due to the recent discovery of their anticancer and antioxidant properties, wider use of carotenoids as pharmaceuticals and nutraceuticals is expected. The worldwide demand for carotenoids has been estimated at around US$ 1 billion in 2005 (Lee & Schmidt-Dannert 2002). As a result, microbial production of carotenoids has attracted considerable interest. Recent research efforts have focused on the economic production of carotenoids in useful quantities. One promising approach to reduce the production costs is to use low cost fermentation media. A number of studies have demonstrated the feasibility of producing carotenoids from low cost substrates such as whey ultrafiltrate (Frengova et al. 1994), sugar cane juice (Florencio et al. 1998), corn starch hydrolysate (Siva Kesava et al. 1998), peat hydrolysate (Vazquez & Martin 1998), grape must (Buzzini 2000), corn syrup (Buzzini 2001), and sugar cane molasses (SCM) (Bhosale & Gadre 2001; Goksungur et al. 2002). In Korea, SCM is readily available and is considered a low cost carbon substrate (10% of pure sugar cost) for fermentation. This work reports on the optimization of carotenoid production from SCM in the yeast Rhodotorula glutinis. Yeasts are suitable for production-scale

fermentations due to their relatively high growth rate compared to algae or fungi. The R. glutinis culture performance is affected by numerous environmental and fermentation parameters such as aeration, agitation, temperature, pH, and concentrations of the medium components. Optimization of the fermentation conditions is therefore very important for maximizing the yield and productivity and minimizing the production costs. Most of the recent optimization efforts have relied on statistical experimental design and response surface analysis (Haaland 1989) and, to a lesser extent, artificial intelligence techniques such as genetic algorithms (Kennedy & Krouse 1999; Weuster-Botz 2000). Statistical design is a powerful tool that can be used to account for the main as well as interactive influences of fermentation parameters on process performance. It is an efficient way to generate useful information with limited experimentation, thereby cutting the process development time and cost (Myers & Montgomery 2002). In this study, a two-step optimization strategy of statistical experimental design was employed to optimize carotenoid production from SCM in shake flasks. In the first step, a fractional factorial design was used to evaluate the impact of five factors (pH and concentrations of SCM, urea, KH2PO4, and NaCl) on cell mass yield and volumetric production of carotenoids. A face-centered central composite design was then employed in the second step to optimize the

430 significant factors identified in the initial screening step to further enhance the carotenoid production. Materials and methods Materials SCM was obtained from Cheil Jedang Co., Korea. Acid hydrolysis of the SCM was carried out in an autoclave at 120 C for 15 min using 0.02 M H2SO4. This was followed by membrane filtration to remove precipitates. All solvents used for carotenoid extraction were of analytical grade. Microorganism and culture conditions The microorganism used was R. glutinis KCTC (Korean Collection for Type Cultures) 7989 isolated from soil and identified by morphologic characteristics, biochemical properties, and carbon assimilation tests (Kim et al. 1998). The cells were maintained on yeast malt agar plates at 4 C and transferred monthly. The inoculum of R. glutinis was grown in Erlenmeyer flasks at 22 C for 42 h containing 50 ml of a culture medium with the following composition (in g/l): glucose 10, yeast extract 3, and peptone 5. The basal medium used for carotenoid production had the following composition (in g/l): reducing sugars 20, urea 2, KH2PO4 1, and NaCl 0.1. The initial pH of the medium was adjusted to pH 5.5 by adding 2 M HCl or NaOH before autoclaving. Erlenmeyer flasks containing 100 ml of the basal medium were inoculated with 5% of a preculture and incubated on a reciprocating shaker at 150 rpm and 20 C for 5 days. The culture conditions were varied according to the experimental design described below. All shake flask experiments were performed in duplicate. Analytical methods Cell density was determined by turbidity measurements using a spectrophotometer at 660 nm and correlated to dry cell weight. The amount of reducing sugars in SCM was determined after inversion of sucrose with 2 M HCl by the dinitrosalicylic acid method (Miller 1959). Carotenoid extraction was carried out according to the method of Park and Kim (2002). To extract carotenoids, cells were first harvested by centrifugation, washed twice with distilled water, and frozen at )48 C. The lyophilized cells (0.1 g) were mixed with 1 ml each of DMSO (55 C), acetone, petroleum ether, and 20% w/v NaCl solutions. The upper petroleum ether layer containing the extracted carotenoids was collected and analyzed by thin layer chromatography.

P.K. Park et al. (A) concentration of SCM, (B) concentration of urea, (C) concentration of KH2PO4, (D) concentration of NaCl, and (E) pH on cell mass, carotenoid content, and carotenoid production. Fractional factorial design is well-suited for screening purposes because it allows for the separation of the important influences from the unimportant ones at an early stage of experimentation. However, some information on higher order interactions among factors can be lost in a fractional design compared to a full factorial design. In this study, a twolevel fractional factorial design was selected which required 16 experimental runs for five factors. Table 1 shows the experimental ranges and levels of the five factors tested in the fractional factorial design ()for the lower level, + for the upper level, and 0 for the center point level). Table 2 displays the design matrix and experimental results (responses) after 5 days of culture. The carotenoid production was calculated from the experimentally measured cell mass and carotenoid content. Note that four additional runs at the center point level were included in the design matrix to check reproducibility. The runs were conducted in randomized order to guard against systematic bias. The results of the fractional factorial design revealed that three out of the five factors (SCM, urea, and KH2PO4) exerted significant effects on the responses (cell mass and carotenoid production). In the second step, a face-centered central composite design was used to optimize the levels of the three factors. The selected design matrix, shown in Table 3, consisted of nine experimental runs and four additional runs at the center point level to check reproducibility. Note that the SCM and urea factors have been combined to create a new factor known as the carbon–nitrogen (C/N) ratio, reducing the number of factors from three to two. In the experimental design, the two factors are coded according to the following equation xi ¼

Xi X 0 DX

ð1Þ

where xi is the coded value of the ith factor (x1 ¼ C/N ratio and x2 ¼ KH2PO4), Xi is the natural value of the ith factor, X0 is the factor’s natural value at the center point level, and DX is the step change value. Two experimental responses (cell mass and carotenoid content) and one calculated response (carotenoid production) are also listed in Table 3. Each response shown was used to develop an empirical model of the response Table 1. Experimental ranges and levels of the five factors tested in the fractional factorial design. Factor

Symbol

)

Experimental design A two-step optimization strategy was employed to optimize carotenoid production from SCM in shake flasks. In the first step, a fractional factorial design was used to evaluate the effects of the following five factors:

Ranges and levels

SCM (g/l) Urea (g/l) KH2PO4 (g/l) NaCl (g/l) pH

A B C D E

10 1 0 0 4

0

+

20 3 1.5 1.5 5.5

30 5 3 3 7

Carotenoid production by Rhodotorula glutinis

431

Table 2. Experimental design matrix and experimental results for the fractional factorial design. Run

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Design matrix

Experimental results

A

B

C

D

E

Cell mass (g/l)

Carotenoid content (lg/g)

Carotenoid production (mg/l)

) ) ) ) + ) ) ) ) + + + + + + + 0 0 0 0

) ) ) + ) ) + + + + + + ) ) ) + 0 0 0 0

) ) + ) ) + ) + + + ) ) + + ) + 0 0 0 0

) + ) ) ) + + ) + ) + ) ) + + + 0 0 0 0

+ ) ) ) ) + + + ) ) ) + + ) + + 0 0 0 0

4.3 3.9 4.7 1.7 11.3 4.4 2.3 2.6 3.6 9.5 7.3 7.5 11.9 9.8 11.6 8.0 5.4 5.6 5.8 5.7

297 202 310 280 201 269 300 393 192 167 218 220 217 250 251 159 156 161 170 189

1.28 0.79 1.46 0.48 2.27 1.18 0.69 1.02 0.69 1.59 1.59 1.65 2.58 2.45 2.91 1.27 0.84 0.90 0.99 1.08

Table 3. Experimental design matrix and experimental results for the face-centered central composite design. Run

1 2 3 4 5 6 7 8 9 10 11 12 13 a

Design matrix

a

Experimental results

x1 C=N ratio

x2 KH2 PO4

Cell mass (g/l)

Carotenoid content (lg/g)

) ) ) 0 0 0 + + + 0 0 0 0

) 0 + ) 0 + ) 0 + 0 0 0 0

8.8 11.1 12.3 11.5 12.0 11.9 11.3 12.4 11.8 12.0 12.2 11.9 12.5

194 101 85 352 294 455 404 386 379 294 300 297 290

Carotenoid production (mg/l) 1.71 1.12 1.05 4.05 3.53 5.41 4.57 4.79 4.47 3.53 3.66 3.53 3.63

C/N ratio: )(4), 0(27), +(50); KH2PO4 : )(0), 0(1.5), +(3.0).

surface in which each dependent variable was obtained as the sum of the contributions of the two investigated factors through first-order, second-order, and interaction terms, according to the following quadratic polynomial: y ¼ b0 þ b1 x1 þ b2 x2 þ b11 x21 þ b22 x22 þ b12 x21 x22

ð2Þ

where y is the predicted response and b0, b1, b2, b11, b22, and b12 are the coefficients obtained by multiple regression of the experimental data. The commercial software Design Expert v6.06 (STAT-EASE Inc., Minneapolis, MN, USA) was used for statistical and regression analyses of the data obtained from the fractional factorial design and face-centered central composite design.

Results and discussion Fractional factorial design A fractional factorial design was employed to evaluate the influence of five fermentation factors on carotenoid production from SCM in shake flasks. The design matrix and experimental responses are shown in Table 2. As can be seen from Table 2, significantly different cell mass and carotenoid yields exist within the 16 runs and that the highest values of cell mass, carotenoid content, and carotenoid production were obtained in different runs: a maximum cell mass concentration of 11.9 g/l was observed in run 13, the carotenoid content reached the highest value of 393 lg/g

432 in run 8, and run 15 produced the highest carotenoid production of 2.91 mg/l. The mean cell mass concentration and carotenoid production, averaged over all runs, are 6.3 g/l and 1.39 mg/l, respectively. The results presented in Table 2 for cell mass and carotenoid production were subjected to regression analysis and the analysis of variance (ANOVA). Firstorder models were fitted to the data to evaluate the main effects of the five factors. The statistic test factor, F, was used to evaluate the significance of the models and factors at the 95% confidence level. If the calculated value of F is greater than the tabular F at the specified probability level, a statistically significant model or factor is obtained. After applying the ANOVA statistical test, it was found that the first-order models for cell mass and carotenoid concentrations were satisfactory. In addition, The SCM, urea, and KH2PO4 factors and the SCM and urea factors showed significant effects on the cell mass and carotenoid production, respectively. The NaCl and pH factors did not show a major impact on either the cell mass or carotenoid production within the ranges explored in our experiments. Consequently, these two factors were kept at the level of the center point while carrying out the central composite design experiments described below. The nature of the influence of the three significant factors (SCM, urea, and KH2PO4) on cell mass and the two significant factors (SCM and urea) on carotenoid production may be deduced by examining the data trends shown in Table 2. Notice that runs 5, 13, 14, and 15 in Table 2 are characterized by the high (+) level for SCM and the low ()) level for urea, i.e. high carbon–nitrogen (C/N) ratios. The mean cell mass and carotenoid concentrations for these runs are 11.2 g/l and 2.55 mg/l, respectively. In contrast, runs 4, 7, 8, and 9 are characterized by the low ()) level for SCM and the high (+) level for urea, i.e. low C/N ratios. The mean cell mass and carotenoid concentrations for these runs are 2.6 g/l and 0.72 mg/l, respectively. It is evident that there is an alternating pattern of high and low cell mass and carotenoid production which corresponds to the high/low variations of the C/N ratio. A direct correlation between the C/N ratio and cell mass and carotenoid concentrations is obvious. Clearly, a higher C/N ratio will lead to a higher cell mass and carotenoid production. However, the influence of KH2PO4 is not so conspicuous. Comparing the mean cell mass concentration at the low level of KH2PO4 with the mean cell mass concentration at the high level in Table 2 indicates that the cell mass was somewhat positively affected by KH2PO4 (6.2 vs. 6.8 g/l), suggesting that KH2PO4 was of secondary significance. Based on the results of the fractional factorial design, the levels of the significant factors – SCM and urea (combined as one factor: the C/N ratio), and KH2PO4 – were further optimized using a face-centered central composite design in the second optimization step. Higher C/N ratios were used in these experiments compared to those used in the fractional

P.K. Park et al. factorial design since higher levels have been shown to favor cell mass and carotenoid production. Face-centered central composite design A face-centered central composite design for the two factors (C/N ratio and KH2PO4) was used for optimizing cell mass and carotenoid production in shake flasks. Table 3 shows the design matrix and experimental responses. The level of the C/N ratio was varied from 4 to 50 while the level of KH2PO4 was varied from 0 to 3.0 g/l. Note that the C/N ratio was varied by changing the urea concentration at a fixed SCM concentration. As can be seen from Table 3, these runs produced substantially improved results for the cell mass and carotenoid production over those obtained in the fractional factorial design. The mean cell mass and carotenoid concentrations, averaged over all runs, are 11.7 g/l and 3.46 mg/l, respectively. In comparison to the mean cell mass and carotenoid concentrations in the fractional factorial design experiments, the mean cell mass concentration in the central composite design experiments is higher by a factor of 1.9, and the mean carotenoid concentration is higher by a factor of 2.5, thus confirming the positive effect of high C/N ratios observed in the previous fractional factorial design. By using multiple regression analysis, the experimental responses shown in Table 3 were correlated with the two significant factors according to Equation (2): ½cell mass ¼ 12:2 þ 0:55x1 þ 0:728x2 0:492x21 0:608x22 0:736x1 x2

ð3Þ

½carotenoid production ¼ 3:74 þ 1:66x1 þ 0:105x2 1:18x21 þ 0:59x22 þ 0:14x1 x2

ð4Þ

The factors x1 and x2 are specified in their coded units. The goodness of fit of the quadratic polynomials is expressed by the coefficient of determination, R2. The closer the value of R2 is to 1, the better is the correlation between the observed and predcited values. The R2 values for Equations (3) and (4) are 0.891 and 0.901, respectively, indicating that about 90% of the variations in cell mass and carotenoid concentrations can be explained by the quadratic polynomials. This means that Equations (3) and (4) are adequate for correlating the experimental results. The experimental cell mass and carotenoid concentrations versus the corresponding values calculated by the regression models are shown in Figures 1 and 2, respectively. The line of perfect fit is also shown in these figures. These plots therefore visualize the performance of the two quadratic models in an obvious way. The results in Figures 1 and 2 confirm that the two regression models provide an accurate description of the experimental data.

Carotenoid production by Rhodotorula glutinis

433

13

12

10

8 10

8

12

14

Experimental cell mass concentration (g/l)

Calculated carotenoid concentration (mg/l)

Figure 1. Cell mass concentration calculated from second-order regression model (Equation (3)) vs. the corresponding experimentally measured values.

8

Cell mass concentration (g/l)

Calculated cell mass concentration (g/l)

14

12 11 10 9

3

50

KH

1.5

2 PO 4

(g/l

27

)

0 4

C/N

o rati

Figure 3. Response surface and contour plot obtained from Equation (3) showing the effect of the C/N ratio, KH2PO4, and their mutual interaction in natural units on cell mass concentration. Solid circles: measured values of cell mass concentration.

6

4

2

0 0

2

4

6

8

Experimental carotenoid concentration (mg/l)

Figure 2. Carotenoid production calculated from second-order regression model (Equation (4)) vs. the corresponding experimentally measured values.

The regression models were used to construct the response surfaces and contour plots shown in Figures 3 and 4. The measured values of cell mass and carotenoid concentrations are also shown in these figures (solid circles). Figure 3 depicts the interactive effect of the C/N ratio and KH2PO4 concentration on cell mass concentration. At low to moderate C/N ratios, increases in KH2PO4 led to increased production of cell mass. At high C/N ratios, the cell mass concentration increased marginally and then decreased with increasing KH2PO4. Similar trends were observed for cell mass concentration as a function of the C/N ratio at fixed KH2PO4 levels. At low to moderate KH2PO4 levels, the cell mass concentration increased with increase in the C/N ratio. At high KH2PO4 levels, the cell mass showed no significant increase with increase in the C/N ratio up to the center point level and decreased thereafter. The contour plot in Figure 3 indicates that a local optimum exists in the area experimentally investigated; a set of values on the two factors that leads to maximum cell mass production. The location of this optimum can be obtained by differentiating Equation (3) with respect to x1 and x2 and solving

the resulting set of algebraic equations. According to Equation (3), the optimum point for maximum cell mass production is located at a C/N ratio of 31.6 and a KH2PO4 concentration of 2.2 g/l. The effects of varying the C/N ratio and KH2PO4 concentration on carotenoid production are shown in Figure 4. The response surface indicates that the carotenoid concentration was not significantly affected by KH2PO4 throughout the range of the C/N ratio employed. This is not surprising as the fractional factorial design results have already indicated that KH2PO4 was not a significant factor affecting carotenoid production. However, it is interesting to note that the carotenoid production decreased and then increased gradually with increasing KH2PO4. From the contour plot shown in Figure 4, it can be seen that a saddle point exists in the region of high C/N ratios. By contrast, increases in the C/N ratio led to noticeable increases in the carotenoid production irrespective of the KH2PO4 concentration. The increase in carotenoid production was marginal at high C/N ratios compared to the steep increase at low C/N ratios. It can be seen that there is no clear optimum within the experimental area investigated because the best carotenoid production lies at the upper bound of the KH2PO4 concentration range. Nevertheless, the contour plot indicates that the best carotenoid production occurs at a C/N ratio of approximately 44.5 when the KH2PO4 concentration is equal to 3 g/l. This C/N ratio for maximum carotenoid production differs from the C/N ratio of 31.6 which maximizes cell mass yield. Also, the C/N ratio of 44.5 observed in this study for maximum carotenoid production differs from the results of Somashekar and Joseph (2000). They inves-

434

P.K. Park et al.

Carotenoid concentration (mg/l)

References

6

4

2

0 3

50

KH

1.5

27

o

2 PO 4 (g/

l)

0 4

C/N

rati

Figure 4. Response surface and contour plot obtained from Equation (4) showing the effect of the C/N ratio, KH2PO4, and their mutual interaction in natural units on carotenoid concentration. Solid circles: measured values of carotenoid concentration.

tigated carotenoid production from semi-defined minimal salts media with three different C/N ratios by the yeast R. gracilis, and found a C/N ratio of 10 favored maximum carotenoid production. Perhaps the difference is due to the different types of medium and yeast strain used.

Conclusions Using a sequential optimization strategy (fractional factorial design followed by central composite design coupled with response surface analysis), the concentrations of SCM, urea, and KH2PO4, were shown to affect the production of cell mass and carotenoids in the yeast R. glutinis. The two-step optimization strategy resulted in a 1.9-fold enhancement of the mean cell mass concentration and a 2.5-fold enhancement of the mean carotenoid concentration. Two of the three significant factors, SCM and urea, were combined as a single factor (C/N ratio) in the central composite design experiments. The response surface analysis of the central composite design results indicates that the best cell mass yield and carotenoid production within the experimental area investigated could be obtained at a C/N ratio of 31.6 and a KH2PO4 concentration of 2.2 g/l and at a C/N ratio of 44.5 and a KH2PO4 concentration of 3 g/l, respectively.

Bhosale, P. & Gadre, R.V. 2001 b-Carotene production in sugarcane molasses by a Rhodotorula glutinis mutant. Journal of Industrial Microbiology and Biotechnology 26, 327–332. Buzzini, P. 2000 An optimization study of carotenoid production by Rhodotorula glutinis DBVPG 3853 from substrates containing concentrated rectified grape must as the sole carbohydrate source. Journal of Industrial Microbiology and Biotechnology 24, 41–45. Buzzini, P. 2001 Batch and fed-batch carotenoid production by Rhodotorula glutinis Debaryomyces castellii co-cultures in corn syrup. Journal of Applied Microbiology 90, 843–847. Florencio, J.A., Soccol, C.R., Furlanetto, L.F., Bonfim, T.M.B., Krieger, N., Baron, M. & Fontana, J.D. 1998 A factorial approach for sugarcane juice-based low cost culture medium: increasing the astaxanthin production by the red yeast Phaffia rhodozyma. Bioprocess Engineering 19, 161–164. Frengova, G., Simova, K., Pavlova, K., Beshkova, D. & Grigorova, D. 1994 Formation of carotenoids by Rhodotorula glutinis in whey ultrafiltrate. Biotechnology and Bioengineering 44, 888–894. Goksungur, Y., Mantzouridou, Y. & Roukas, T. 2002 Optimization of the production of b-carotene from molasses by Blakeslea trispora: a statistical approach. Journal of Chemical Technology and Biotechnology 77, 933–943. Haaland, P.D. 1989 Experimental Design in Biotechnology. New York: Dekker. Kennedy, M. & Krouse, D. 1999 Strategies for improving fermentation medium performance: a review. Journal of Industrial Microbiology and Biotechnology 23, 456–475. Kim, E.Y., Park, P.K. & Chae, H.J. 1998 Optimization of culture conditions for extracellular lipid production from Rhodotorula glutinis K-501. Korean Journal of Biotechnology and Bioengineering 13, 58–64. Lee, P.C. & Schmidt-Dannert, C. 2002 Metabolic engineering towards biotechnological production of carotenoids in microorganisms. Applied Microbiology and Biotechnology 60, 1–11. Miller, G.L. 1959 Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry 31, 426–429. Myers, R.H. & Montgomery, D.C. 2002 Response Surface Methodology: Process and Product Optimization Using Designed Experiments, 2nd edn. New York: John Wiley & Sons. Park, P.K. & Kim, E.Y. 2002 Extraction method of carotenoids from Rhodotorula glutinis. Korean Journal of Biotechnology and Bioengineering 17, 44–48. Siva Kesava, S., An, G.-H., Kim, C.-H., Rhee, S.-K. & Choi, E.-S. 1998 An industrial medium for improved production of carotenoids from a mutant strain of Phaffia rhodozyma. Bioprocess Engineering 19, 165–170. Somashekar, D. & Joseph, R. 2000 Inverse relationship between carotenoid and lipid formation in Rhodotorula gracilis according to the C/N ratio of the growth medium. World Journal of Microbiology and Biotechnology 16, 491–493. Vazquez, M. & Martin, A.M. 1998 Optimization of Phaffia rhodozyma continuous culture through response surface methodology. Biotechnology and Bioengineering 57, 314–320. Weuster-Botz, D. 2000 Experimental design for fermentation media development: statistical design or global random search? Journal of Bioscience and Bioengineering 90, 473–473.

Springer 2005


Purification and characterization of lignin peroxidases from Penicillium decumbens P6 JinShui Yang, HongLi Yuan*, HeXiang Wang and WenXin Chen Key Laboratory of Agro-Microbial Resource and Application, Ministry of Agriculture, College of Biological Science, China Agricultural University, Yuanmingyuan West Road 2, Haidian District, Beijing 100094, China *Author for correspondence: Tel.: +86-10-62893464, Fax: +86-10-62891332, E-mail: [email protected] Keywords: lignin peroxidase, Penicillium decumbens, lignite, purification, characterization

Summary Peroxidases are essential enzymes in biodegradation of lignin and lignite which have been investigated intensively in the white-rot fungi. This is the first report of purification and characterization of lignin peroxidase from Penicillium sp. P6 as lignite degradation fungus. The results indicated that the lignin peroxidase of Penicillium decumbens P6 had physical and chemical properties and a N-terminal amino acid sequence different from the lignin peroxidases of white-rot fungi. The lignin peroxidase was isolated from a liquid culture of P. decumbens P6. This enzyme had a molecular weight of 46.3 KDa in SDS-PAGE and exhibited greater activity, temperature stability and wider pH range than those previously reported. The isolation procedure involved (NH4)2SO4 precipitation, ion-exchange chromatography on DEAE-cellulose and CM-cellulose, gel filtration on Sephadex G-100, and non-denaturing, discontinuous polyacrylamide gel electrophoresis. The Km and Vmax values of this enzyme using veratryl alcohol as substrate were 0.565 mmol L)1 and 0.088 mmol (mg protein))1 min)1 respectively. The optimum pH of P6 lignin peroxidase was 4.0, and 70.6% of the relative activity was remained at pH 9.0. The optimum temperature of the enzyme was 45 C.

Introduction Lignin is a complex polymer consisting of phenylpropane units interconnected by a variety of carbon–carbon bonds and ether linkages (Adler 1977; Ramachandra et al. 1987). It is the main component of wood and lignite. In nature, lignin physically encrusts cellulose and is resistant to biodegradation (Kirk & Farrell 1987). Most active lignin degraders such as Phanerochaete chrysosporium, Phlebia radiata, Trametes versicolor, Bjerkandera adusta, Chrysonilia sitophila, Streptomyces badius and Streptomyces flavovirens belong to the basidiomycetes (Kirk & Farrell 1987; Blanchette 1991), though some of them are ascomycetes (Duran et al. 1987) or actinomycetes (Crawford et al. 1983; Ramachandra et al. 1988). In fungi, the biodegradation of lignin is an enzymatic procedure. The ligninolytic enzyme system consists mainly of manganese peroxidase, lignin peroxidase and laccase. Some evidence has shown that many ligninolytic fungi use a combination of any two from these three enzymes (Kuwahara et al. 1984; Kantelinen et al. 1989). Lignin peroxidase (LiP; EC 1.11.1.14) is thoroughly investigated ligninolytic enzyme that was first discovered in the white-rot fungus P. chrysosporium (Glenn et al. 1983). The biochemistry and molecular genetics underlying the ligninolytic systems of P. chrysosporium are

quite complex. Various LiP isozymes have been found, and the genome of P. chrysosporium contains at least 10 structurally related genes encoding LiP proteins, named as lipA to lipJ respectively (Gaskell et al. 1994). About 940 million tons of lignite are produced worldwide each year. In China, the conservative reserves of lignite are about 130.3 million tons, accounting for 13% of total coal resources. Converting this low grade coal to useful materials poses a significant problem both in China and worldwide. Since the typical structures of the original lignin are preserved in coal, some authors have designated lignite as demethylated and dehydrated lignin (Durie et al. 1960; Hayatsu et al. 1979; Hatcher 1990). Therefore, most of the main coal-biodegrading microorganisms are ligninolytic microorganisms. In previous work, we obtained a lignite degradation fungus, Penicillium decumbens P6 (Yuan et al. 1999, 2000). We found that extracellular enzymes played an important role in lignite degradation (Yang et al. 2004), but the mechanism of degradation was not clear. Compared with the white-rot fungi, it is possible that LiP also play an important role in the biodegradation of lignite. However, very few data exist on the production and purification of lignin peroxidase or manganese peroxidase in Penicillium sp. (Laborda et al. 1999; Kumari et al. 2002). The present paper deals with the

436 lignin peroxidase excreted by P. decumbens P6, including the purification and characterization of this enzyme from liquid culture.

Materials and methods Fungal strain and preparation of crude enzyme P. decumbens P6 (CGMCCNo.0866) was maintained on a yeast extract-malt agar (Lamar et al. 1990). Slants inoculated with P6 were incubated at 28 C for 1 week and maintained at 4 C. Spores from the slants were suspended in sterilized water and inoculated at concentration of 106 spores ml)1 into 500 ml flasks containing a 100 ml medium of 10 g glucose, 3 g malt extract, 3 g yeast extract, 2 g KH2PO4, 0.5 g MgSO4Æ7H2O, and 0.2 g FeSO4ÆH2O in a litre of distilled water with pH 5.0 and sterilized at 115 C for 30 min. Cultures were incubated with shaking at 28 C for 7 days at 150 rev/min. Then liquid fermentation cultures were filtered. The filtrate was precipitated with an 80% saturated (NH4)2SO4 solution and centrifuged at 10600 · g for 15 min at 4 C. The precipitate was dissolved in 100 ml distilled water and dialysed three times with 4 h in each time against 1000 ml 5 mM potassium phosphate buffer, pH 7.2 (PB) at 4 C using dialysis tubing with a molecular weight cut off of about 8000 Da. Protein concentration Protein concentrations were determined by using the Bradford method and bovine serum albumin as the standard. LiP concentration in the column effluents was monitored by measuring the absorbance at 409 nm (Farrell et al. 1989). Detection of peroxidase activity in P. decumbens P6 Non-denaturing discontinuous PAGE was used to analyse peroxidase enzymes (Ramachandra et al. 1987). After electrophoresis, the gel was treated for 10 min at 37 C with a reaction mixture containing 10 mM caffeic acid (Sigma), 0.05 mM aminoantipyrine (Sigma), 4.0 mM hydrogen peroxide, 0.1 M potassium phosphate buffer (pH 7.0). Peroxidase bands stained red. Reactions were stopped by placing the gel in a solution of ethanol-water (1:1). Enzyme assay LiP activity was determined by monitoring the conversion of veratryl alcohol to veratryl aldehyde at 25 C by hydrogen peroxide at 310 nm as described by Tien & Kirk (1984). One unit of enzyme activity was defined as the amount of enzyme that transformed 1 lmol of substrate per min.

JinShui Yang et al. Ion-exchange chromatography The first step in peroxidase purification involved a DEAE-cellulose (Sigma) column (2.5 · 18 cm), which had been equilibrated with 5 mM PB (pH 7.2). Following elution of unbound material with the same buffer, the column was washed stepwise with 50, 150, 300, 500 mM and finally 1 M NaCl in 5 mM PB. The eluting solution was collected in fraction of 5 ml. Protein concentration and LiP concentration were determined respectively for each fraction by the absorption at 280 and 409 nm. Then the LiP activity was estimated as mentioned as above in each fraction with high absorption at 280 and 409 nm. The active fractions were then loaded onto a CMcellulose (Sigma) column (2.5 · 18 cm) equilibrated with 5 mM ammonium acetate buffer (pH 4.5). After the unadsorbed materials had been eluted by 300 ml 5 mM ammonium acetate buffer (pH 4.5), the adsorbed proteins were eluted with a linear gradient of 0–1 M NaCl in ammonium acetate buffer. Fractions of 5 ml were collected. A409 and A280 were measured for each fraction. LiP activity in each fraction with highest A409 and A280 was also assayed as mentioned above. Gel filtration The fraction on the CM-cellulose column with LiP activity was concentrated into 3 ml using ultra-filtration with a molecular weight cut off of 1000 Da and dialysed for 4 h against 500 ml 5 mM PB (pH 7.2) at 4 C. Then the enzyme solution was supplied to a Sephadex G-100 (Sigma) column (2.6 · 100 cm) pre-equilibrated with 5 mM PB (pH 7.2) and eluted with the same buffer. Fractions of each 3 ml were collected. All the fractions with high A409 were pooled and concentrated and LiP activity was measured using non-denaturing, discontinuous PAGE (10% polyacrylamide gel) as described above. The bands with LiP activity were cut out respectively and the proteins recovered from the gel using an elution buffer (1% Triton X-100, 50 mM TrisHCl, pH 9.5), shaken gently for 10 min and centrifuged at 4942 · g at 4 C. The supernatant was collected and concentrated by lyophilization. SDS-PAGE The purity and subunit molecular weight of purified enzyme was checked using SDS-PAGE (12% polyacrylamide gel). After electrophoresis, the protein bands were visualized by silver staining (Guo 1991). The molecular weights of proteins were estimated according to molecular weight standards (Sigma). Properties of the LiP The Km and Vmax values for the enzyme, using veratryl alcohol as substrate, were determined by a LineweaverBurk plot. Also, LiP activity was measured at 25 C in

Lignin peroxidases from Penicillium decumbens P6 the pH range 3–9 (0.1 M NH4OAc buffer at pH values of 3, 4 and 5. A 0.1 M phosphate buffer was used to assess pH 6 and pH 7, and 0.1 M Tris-HCl buffer used for pH 8 and pH 9). The LiP activity was also determined at various temperatures between 25 and 65 C at optimal pH. Amino acid sequencing The purified LiP protein was subjected to SDS-PAGE using 12% separating gel. Proteins in the gel were transferred onto a polyvinylidene fluoride membrane by blotting at 16 V for 30 min in a semi-dry transfer cell (Bio-Rad USA). After transfer, the membrane was stained and then washed extensively with Milli-Q water. The protein band was cut out and air-dried. The N-terminal amino acid sequencing was conducted using a 491 Protein Sequencer (ABI USA). The sequence of P. decumbens P6 LiP obtained was compared to other fungal LiPs in the sequence database by BLAST search.

437 and a big peak (C2) in the fractions between the elution volumn of 360–600 ml. These two peaks corresponded to the main protein peaks. Fractions corresponding to the C2 peak were subsequently purified using a Sephadex G-100 column. One major peak and several small peaks appeared. The major activity was found in the first peak (S1), but there was an overlap zone between the peak S1 and the second peak (S2) while the collected S1 avoided S2. The yields and specific activities of the chromatographic fractions are presented in Table 1. The purification efficiency of each method is shown in Fig 2. After purification, the specific activity had increased from 0.05 to 7.5 U/mg, demonstrating a 150.4-fold purification. The recovery of activity was 19.6%. The protein patterns in SDS-PAGE (Fig. 2) also showed that while the enzyme was getting purer, the number of protein bands was decreasing with the degree of purification. The sample of combined peak S1 was purified finally by PAGE. Selective staining for peroxidase showed only one band with a high level of peroxidase activity. A total of 0.3 mg LiP was recovered from the gel.

Results Characterization of LiP in P. decumbens P6 Detection and purification of LiP in P. decumbens P6 The excretion of LiP in liquid culture of P. decumbens P6 was evidenced by the results of selective staining of the enzyme in PAGE. It showed that P. decumbens P6 had two peroxidase isoenzymes, L1 and L2, in liquid culture (Fig. 1). The L1 isozyme was the major one. With the ion-exchange chromatography on DEAEcellulose, LiP activity was detected in 6 eluated fractions by absorption at 409 nm. They were an unadsorbed peak (D1) and five adsorbed peaks (D2–D6). Most of the lignin peroxidase activity was located in the two major protein peaks (D3 and D4) eluted with 150 and 300 mM NaCl. The D3 peak exhibited more LiP activity than the D4 peak. In further purification of the D3 peak on the CMcellulose column, the LiP activity was detected in two fractions: a small peak (C1) in the unadsorbed fraction

Enzyme recovered from the PAGE gel possessed a subunit molecular weight of 46.3 KDa (Fig 3). In analysis of veratryl alcohol oxidation at 25 C, the Km of LiP from P. decumbens P6 was 0.565 mmol/l and the Vmax was 0.088 mmol (mg protein) min)1, which was similar with to the values for white-rot fungal LiPs (Farrell et al. 1989; Glumoff et al. 1990; Rothschild et al. 2002). The optimum pH was 4 at 25 C for the LiP of P. decumbens P6. At pH 9.0, 70.6% of the relative activity was still retained. The optimum temperature was 45 C at pH 4. Enzymatic activity declined with increase or decrease of temperature. And LiP from P. decumbens P6 exhibited relatively high temperature tolerance, retaining 62.5% of the relative enzymatic activity at 55 C. Ten amino acid residues in the N-terminus of the 46.3 KDa band of LiP were sequenced and compared to other fungal peroxidase sequences (Table 2). P. decumbens P6 LiP had the conserve amino acid residues VLL as in fungal MnP and other peroxidases, but no conservative amino acid residues with other fungal LiPs.

Discussion

Figure 1. PAGE analysis of P. decumbens P6 liquid culture showing the existence of peroxidase activity. Seperation gel concentration was 10%. Enzyme were visualized by selective staining. The enzyme bands were marked as L1 and L2 and L1 was major band.

To reduce environmental damage from weathering and coal burning, biotechnological processes are needed to convert hard coal or lignite to clean, cost-effective energy sources or other useful materials. A microbial, enzymatic or enzyme-mimetic technology that can take place at moderate temperatures and pressures (Fakoussa 1992) would have great advantages compared to the current physical and chemical coal conversion technologies. Biocatalytic particles are also smaller than conventional catalytic particles and thus more efficient.

438

JinShui Yang et al.

Table 1. Yields and specific activities during purification of extracellular lignin peroxidase from 10 L culture. Fraction

Protein (mg)

Total activity (U)

Specific activity (U/mg)

Purification fold

Recovery of activity (%)

Culture filtrate (NH4)2SO4 precipitation DEAE-cellulose (D3) CM-cellulose (C2) Sephadex G-100 (S1)

1287.6 621.4 18.2 6.8

60 49.9 38.6 25.3

0.05 0.08 2.1 3.7

1.0 1.6 42.8 74.2

100.0 83.2 64.3 42.1

1.6

11.7

7.5

150.4

19.6

The strain of P. decumbens P6 used in this study was isolated from coalmine soil in Inner Mongolia, China and could completely degrade Chinese lignite in less than 3 days in liquid culture or in 36 h on a plate colony. The products of degradation were humic acids and fulvic acids, both had obvious biological effects (Yuan et al. 1999, 2002). In addition, the characteristics of the

Figure 2. SDS- PAGE of proteins from P. decumbens P6 showing the purification efficiency at different stages. Lane 1: molecular weight standards; lane 2: crude enzyme; lane 3: D3 (from DEAE); lane 4: C2 (from CM); lane 5: S1 (from Sephadex G-100).

Figure 3. SDS-PAGE pattern of purified LiP 1. molecular weight markers; 2. purified LiP.

degradation products changed distinctly (Yuan et al. 2000). Furthermore, P6 can excrete extracellular enzymes in the process of coal liquefaction (Yang et al. 2004). Compared with P. chrysosporium and other white-rot fungi, P6 has obvious advantages in the biodegradation of lignite, such as being easy to grow and resistant to contamination and so on. Laborda et al. (1999) reported that Penicillium sp. could excrete extracellular manganese peroxidase in the processes of liquefaction/solubilization of Spanish coals, but their study only focused on the fundamental aspects of microbial coal liquefaction/ solubilization involved in coal solubilization. P. decumbens P6 can excrete peroxidase isoenzymes under liquid fermentation conditions. Peroxidase activity was detected in PAGE by selective staining. The optical absorption spectra of enzyme showed that P6 peroxidase had a Soret band (Yang 2004), which was the typical adsorption spectra of peroxidase (Glumoff et al. 1990). Furthermore, enzyme activity indicated that P6 peroxidase was different from aryl alcohol oxidase, which could oxidase aryl alcohol to produce H2O2 (Guilleń et al. 1992; Gutie´rrez et al. 1994). P6 LiP had high veratryl alcohol activity, without MnP activity, and enzyme activity had to be activated by H2O2. The comparation of N-terminal amino acid residues of P6 LiP with those of P. chrysosporium, Ceriporiopsis subvermispora, Armoracia rusticana and Arabidopsis thaliana peroxidase revealed that P6 LiP had the conserved peroxidase sequence VLL. All of these data confirmed that the purified enzyme from P. decumbens P6 was a peroxidase. LiPs are the most investigated ligninolytic enzymes in white-rot fungi, but not in Penicillium sp. The subunit molecular weight range of white-rot fungal LiP was 38– 47 KDa and that of MnP was 38–50 KDa (Fakoussa & Hofrichter 1999). P6 LiP had a subunit molecular weight of 46.3 KDa, that was within this range. Its pure enzyme turnover number was 2.3)1 and activity was 7.5 U/mg, 68.4 times than that of commercial LiP from whit-rot fungi (0.11 U/mg) (Fluka), indicating it had production potential. Fakoussa & Hofrichter (1999) reported that the pH range for LiP was between 2.0–5.0, with an optimum somewhere between 2.5–3.0. The pH range for MnP was between 2.0–6.0, with an optimum between 4.0–4.5. In our case, the P6 LiP is different from other fungal LiP and similar to MnP, since the optimum pH of P6 LiP was 4.0. However, the P6 LiP had a wider range of pH.

Lignin peroxidases from Penicillium decumbens P6

439

Table 2. Comparison of N-terminal amino acid sequences of Penicillium decumbens P6 and other fungal peroxidase sequences. Accession number

Q02567 AAA62243 A32630 JC2579 Q42517 Q9SZH2

Strains origin and peroxidases

Penicillium decumbens P6 LiP Phanerochaete chrysosporium MnP 1 Phanerochaete chrysosporium MnP H3 Phanerochaete chrysosporium MnP H4 Ceriporiopsis subvermispora MnP 1 Armoracia rusticana Peroxidase N Arabidopsis thaliana Peroxidase 43

N terminal amino acid sequences

V V V V V V V

At pH 9.0, 70.6% of the relative activity was still retained, coinciding with the lignite degradation phenomenon. P6 LiP also exhibited relatively high temperature tolerance, retaining 62.5% of the relative enzymatic activity at 55 C. The optimum temperature of P6 LiP was 45 C, higher than that reported for LiP in other researches (Fakoussa & Hofrichter 1999; Kumari et al. 2002). Conclusively, our results confirmed the excretion of LiP by P. decumbens P6. The LiP we obtained from P. decumbens P6 was different from those produced by other fungi in the amino acid sequence, optimum pH and optimum temperature. These findings offered basic information for the utilization of this strain in the biodegradation of lignite.

Acknowledgements This research was a part of project No. 30370040 supported by the National Science Foundation of China and No.2003AA241170 supported by the Ministry of Science and Technology of China (863 program). We thank Dr. EnTao Wang for his constructive review of the manuscript.

References Adler, E. 1977 Lignin chemistry - past, present and future. Wood Science and Technology 11, 69–218. Blanchette, R.A. 1991 Delignification by wood decay fungi. Annual Review of Phytopathology 29, 381–398. Crawford, D.L., Pometto, A.L. III & Crawford, R.L. 1983 Lignin degradation by Streptomyces viridosporous: isolation and characterization of new polymeric lignin degradation intermediate. Applied and Environmental Microbiology 45, 898–904. Duran, N., Ferrer, I. & Rodriguez, J. 1987 Ligninases from Chrysonilia sitophila (TFB-27441). Applied Biochemistry and Biotechnology 16, 157–167. Durie, R.A., Lynch, B.M. & Strenhell, S. 1960 Comparative studies of brown coal and lignin. Australian Journal of Chemistry 13, 156–168. Fakoussa, R.M. 1992 Mikroorganismen erschlie b en Kohle-Ressourcen. Bioengineering 4, 21–28. Fakoussa, R.M. & Hofrichter, M. 1999 Biotechnology and microbiology of coal degradation. Applied Microbiology and Biotechnology 52, 25–40. Farrell, R.L., Murtagh, K.E., Tien, M., Mozuch, M.D. & Kirk, T.K. 1989 Physical and enzymatic properties of lignin peroxidase

L L L L L L L

L L L L L L L

P K K K K D S

A G G G G G A

D V V T V T A

E G G G G N H

K F F F F S T

N P P P P E I

A G G G G K G

isoenzymes from Phanerochaete chrysosporoium. Enzyme and Microbial Technology 11, 322–328. Gaskell, J., Stewart, P., Kersten, P.J., Covert, S.F., Reiser, J. & Cullen, D. 1994 Establishment of genetic linkage by allelc-specific polymerase chain reaction: application to the lignin peroxidase gene family of Phanerochaete chrysosporium. Biotechnology 12, 1372–1375. Glenn, J.K., Morgan, M.A. & Mayfield, M.B. 1983 An extracellular H2O2-requiring enzyme preparation involved in lignin biodegradation by the white-rot basidiomycete Phanerochaete chrysosporium. Archives of Biochemistry and Biophysics 242, 329–341. Glumoff, T., Harvey, P.J., Molinari, S., Goble, M., Frank, G., Palmer, J.M. & Leisola, M.S.A. 1990 Lignin peroxidase from Phanerochaete chrysosporium-molecular and kinetic characterizartion of isozymes. European Journal of Biochemistry 187, 515–520. Guilleń, F., Martı´ nez, A.T. & Martı´ nez, M.J. 1992 Substrate specificity and properties of the aryl-alcohol oxidase from the ligninolytic fungus Pleurotus eryngii. European Journal of Biochemistry 209, 603–611. Gutie´rrez, A., Caramelo, L., Prieto, A., Martı´ nez, M.J. & Martı´ nez, A.T. 1994 Anisaldehyde production and aryl-alcohol oxidase and dehydrogenase activities in ligninolytic fungi of the genus Pleurotus. Applied and Environmental Microbiology 60, 1783–1788. Guo, Y.J. 1991 The progress of SDS electrophoresis technology. Progress in Biochemistry and Biophysics 18, 32–37 (in Chinese ). Hatcher, P.G. 1990 Chemical structural models for coalified wood (vitrinite) in low rank coal. Organic and Geochemistry 16, 959–970. Hayatsu, R., Winans, R.E., Mcbeth, R.L., Scott, R.G., Moore, L.P. & Studier, M.H. 1979 Lignin-like polymers in coal. Nature 278, 41–43. Kantelinen, A., Hatakka, A. & Viikari, A. 1989 Production of lignin peroxidase and laccase by Phlebia radiate. Applied Microbioogy andl Biotechnology 31, 234–239. Kirk, T.K. & Farrell, R.L. 1987 Enzymatic combustion: the microbial degradation of lignin. Annual Review of Microbiology 41, 465–505. Kumari, M., Yadav, R.S. & Yadav, K.D. 2002 Secretion of ligninperoxidase by Penicillium citrinum, Fusarium oxysporum and Aspergillus terreus. Indian Journal of Experimental Biology 40, 802–806. Kuwahara, M., Glenn, J.K., Morgan, M.A. & Gold, M.H. 1984 Separation and characterization of two extracellular H2O2-dependent oxidases from ligninolytic cultures of Phanerochaete chrysosporium. FEBS Letters 169, 247–250. Laborda, F., Monistrol, I.F., Luna, N. & Fernańdez, M. 1999 Processes of liquefaction/solubilization of Spanish coals by microorganisms. Applied Microbiology and Biotechnology 52, 49–56. Lamar, R.T., Larsen, M.J., & Kirk, T.K. 1990 Sensitivity to and degradation of pentachlorophenol by Phanerochaete sp. Applied and Environmental Microbiology 56, 3519–3526. Ramachandra, M., Crawford, D.L. & Hertel, G. 1988 Characterization of an extracellular lignin peroxidase of the lignocellulolytic Actinomycete Streptomyces Viridosporus. Applied and Environmental Microbiology 12, 3057–3063. Ramachandra, M., Crawford, D.L. & Pometto, A.L III. 1987 Extracellular enzyme activities during lignocellulose degradation by Streptomyces spp.: A comparative study of wild-type and

440 genetically manipulated strains. Applied and Environmental Microbiology. 12, 2754–2760. Rothschild, N., Novotny´, C., Sˇasˇ ek, V. & Dosoretz, C.G. 2002 Ligninolytic enzymes of the fungus Irpex lacteus (Polyporus tulipiferae) isolation and characterization of lignin peroxidase. Enzyme and Microbial Technology 31, 627–633. Tien, M. & Kirk, T.K. 1984 Lignin-degrading enzyme from Phanerochaete chrysosporium: purification, characterization, and catalytic properties of a unique H2O2–requiring oxygenase. Proceedings of the National Academy of Sciences, USA 81, 2280–2284. Yang J.S. 2004 Purification and characterication of lignin peroxidases from lignite degradation strain-Penicillium decumbens P6. Ph.D Thesis, CAU, Beijing, China.

JinShui Yang et al. Yang, J.S., Yuan, H.L. & Chen, W.X. 2004 Studies on extracellular enzyme of lignite degrading fungi-Penicillium sp. P6. China Environmental Science 24, 24–27 (in Chinese). Yuan, H.L., Cai, Y.Q., Zhou, X.G. & Chen, W.X. 1999 Breeding of lignite degrading fungi and analysis of the degraded products. Chinese Journal of Applied and Environmental Biology 5(Suppl), 21–24 (in Chinese). Yuan, H.L., Cai, Y.Q., Zhou, X.G. & Chen, W.X. 2000 Study on chemical properties of humic acid of microbial degraded lignite. Environmental Chemistry 19, 240–243 (in Chinese ). Yuan, H.L., Wang, F.Q., Li, B.Z. & Chen W.X. 2002 Biological activation of humic acid derived from lignite degraded by microorganism. Acta Pedologica Sinica 39, 129–134 (in Chinese).


Springer 2005

Growth and survival potentials of immobilized diazotrophic cyanobacterial isolates exposed to common ricefield herbicides Surendra Singh and Pallavi Datta* Algal Biotechnology Laboratory, Department of Biological Science, Rani Durgavati University, Jabalpur 482001 (M.P.), India *Author for correspondence: Tel.: +0761-2609519, Fax: +0761-2603752, E-mail: [email protected] Keywords: Biofertilizers, cyanobacteria, herbicides, immobilization, survivability of immobilized cyanobacteria

Summary The effect of graded concentrations of four common ricefield herbicides (Arozin, Butachlor, Alachlor, 2,4-D ) on diazotrophic growth, macromolecular contents, heterocyst frequency and tolerance potentials of Ca-alginate immobilized diazotrophic cyanobacterial isolates Nostoc punctiforme, N. calcicola, Anabaena variabilis, Gloeocapsa sp., Aphanocapsa sp. and laboratory strain N. muscorum ISU (Anabaena ATCC 27893) was studied and compared with free-living cultures. Cyanobacterial isolates showed progressive inhibition of growth with increasing dosage of herbicides in both free and immobilized states. There were significant differences in the relative toxicity of the four herbicides. Arozin proved to be more growth toxic in comparison to Alachlor, Butachlor and 2,4-D . Growth performance of the immobilized cyanobacterial isolates under herbicide stress showed a similar diazotrophic growth pattern to free cells with no difference in lethal and sub-lethal dosages. However, at lethal concentrations of herbicides, the immobilized cells exhibited prolonged survivability of 14–16 days as compared to their free-living counterparts (8–12 days). The decline in growth, macromolecular contents and heterocyst frequency was found to be similar in both the states in graded dosages of herbicides. Of the test organisms, A. variabilis showed maximum natural tolerance towards all the four herbicides tested. Evidently immobilization by Ca-alginate seems to provide protection to the diazotrophic cyanobacterial inoculants to a certain extent against the growth-toxic action of herbicides.

Introduction Cyanobacteria are oxygenic, photosynthetic, prokaryotes that grow and multiply at the simple expense of water, light and air (Fay 1983). They are cosmopolitan in distribution, capable of growth and multiplication in a wide range of ecological habitats (Whitton & Potts 2000). The dual capacity of fixing atmospheric carbon and nitrogen makes them attractive as a source of nitrogenous biofertilizer in rice agriculture (Stewart et al. 1987). Extensive and regular use of herbicides in modern rice agriculture is reported to adversely affect the diversity, biology or even sustainability of cyanobacteria often leading to their complete elimination from the field (Padhy 1985; Singh et al. 2003). Thus strategy is required to improve the ecological viability of biofertilizer strains of cyanobacteria under herbicide stress. Biological actions of common ricefield herbicides particularly Arozin, 2,4-D , Butachlor and Alachlor on free-living diazotrophic cyanobacteria include inhibition of growth, macromo-

lecular synthesis, photosynthesis, nitrogenase and glutamine synthetase activity has been investigated (Singh et al. 1978; Singh & Tiwari 1988; Goyal et al. 1991; Leganes & Fernandez 1992; Fairchild et al. 1998). But the action of such herbicides on biofertilizer strains of diazotrophic cyanobacteria in an immobilized state has not yet been investigated, despite the reported role of immobilized N2-fixing cyanobacteria in increasing chlorophyll content, rice grain and straw yield of paddy crop (Kannaiyan et al. 1997). To further improve cyanobacterial biofertilizer technology it would be of great interest to investigate the performance of immobilized biofertilizer strains of diazotrophic cyanobacteria in the presence of ricefield herbicides. Therefore, the performance of certain naturally occurring biofertilizer strains of diazotrophic cyanobacteria (N. muscorum ISU, N. punctiforme, N. calcicola, Anabaena variabilis, Aphanocapsa sp. and Gloeocapsa sp.) in an immobilized state exposed to four common ricefield herbicides (Arozin, 2,4-D , Butachlor and Alachlor) was examined.

442 Materials and methods Source of organisms and growth conditions The diazotrophic cyanobacteria Nostoc punctiforme, Nostoc calcicola, Anabaena variabilis, Gloeocapsa sp. and Aphanocapsa sp. used in the present investigation were isolated from ricefields (Singh et al. 2000). Standard laboratory strain Nostoc muscorum ISU (ATCC 27893) was obtained from Prof. A.K. Kashyap, Department of Botany, Banaras Hindu University, Varanasi, India. Cultures were grown in BG11 medium (Rippka et al. 1979) devoid of any combined nitrogen source (N2-medium). Cultures were incubated in an air-conditioned culture room maintained at 25 ± 1 C and illuminated with cool day fluorescent lights. The photon flux density of light on the surface of the vessel was 45 lE m2 s)1 for 18 h day)1. Immobilization technique The cells were immobilized by entrapment in sodium alginate gel following the method of Codd (1987). The immobilized cells were freed for analytical purpose without loss of viability by placing the washed Caalginate beads in 0.5 M trisodium citrate buffer for 20 min. Growth characterization, macromolecular synthesis and heterocyst differentiation of immobilized cyanobacterial isolates under graded concentrations of herbicides The impact of increasing concentrations (0–100 mg l)1) of the herbicides Arozin, Alachlor, Butachlor and 2,4-D on the growth and survival of immobilized diazotrophic cyanobacterial isolates was determined in N2-medium by monitoring variations in the concentrations of chlorophyll a pigments (Mackinney 1941) at regular intervals of 24 h as a parameter of growth. For all the experiments, exponentially growing cells (6 days old) were harvested by centrifugation (3000 · g, 5 min), washed three times with sterilized double distilled water and divided into two equal parts. One half was dispensed as such equally in assay flasks as free cells while the other half was used to obtain Ca-alginate immobilized cells. The beads so obtained were washed with sterile distilled water and dispensed in equal number in their respective assay flasks. The initial biomass inoculated into each flask was equivalent to 15 lg chlorophyll a. The cultures were incubated under photoautotrophic growth conditions. The untreated cultures were taken as control. All the experiments were repeated three times. To test the correlation between the graded concentration of herbicides and its effect on growth measured in terms of chlorophyll a, in free and immobilized cells, the Spearman–Rank correlation coefficient (rs) was determined. The phycocyanin and phycoerythrin pigments were determined using the method of Benett & Bogorad

S. Singh and P. Datta (1973). Total cellular protein was estimated by the Lowry method. The heterocyst frequency was determined microscopically and expressed as the total number of heterocysts occurring per 100 vegetative cells for each cyanobacterial culture. The specific growth rate constant was calculated by applying the method of Kratz & Myers (1955). Binomial tests were performed to examine whether the proportion of free and immobilized cells under sublethal concentration of herbicides differs significantly from the test proportion. The growth, macromolecular content and heterocyst frequency of free cells were compared with immobilized cells under herbicide stress using paired t-test in order to account for any significant difference, using 0.05 level of significance as the critical value for rejecting the null hypothesis. Herbicides All the herbicides used were of commercial grade, Arozin (30 EC): Trade name Arozin; Alachlor (45.1 EC): Trade name – Lasso; Butachlor (93.34 EC): Trade name – Machete; 2,4-D Ethyl ester (38 EC): Trade name-Slash. Arozin was obtained from Agr. Evo. Ltd. (Ankleshwar, India), Alachlor and Butachlor from Evid and Co Pesticides Pvt. Ltd. (Ankleshwar, India) and 2,4-D Ethyl ester from Monsanto Chemicals of India Ltd. (Mumbai, India). Different concentrations of the respective herbicides were prepared by appropriate dilution (according to EC) in precooled double distilled water and were filter sterilized through a Millipore membrane filter.

Results The growth and survival potential of free and immobilized cyanobacterial isolates under herbicide(s) stress was monitored by exposing N2-grown cultures to graded concentrations of herbicides. Free and immobilized cyanobacterial isolates showed gradual but substantial inhibition in growth, with increasing concentration of herbicides (data not shown) showing a strong negative correlation exhibited by their rs (Spearman–Rank correlation coefficient) values which lay between )1 and )0.5. Growth kinetics of diazotrophic cultures in both free and immobilized states followed the same pattern. Immobilized cells even under graded dosage of herbicides followed similar growth kinetics to free cells, as evident from their growth rates (Tables 1 and 2). The complete lysis of the immobilized cultures occurred at 10 mg l)1 (Aphanocapsa sp.), 15 mg l)1 (N. muscorum; Gloeocapsa sp.), 20 mg l)1 (N. punctiforme; N. calcicola), 25 mg l)1 (A. variabilis) of Arozin; 20 mg l)1 (Aphanocapsa sp.; Gloeocapsa sp.; N. muscorum), 25 mg l)1 (A. variabilis; N punctiforme; N. calcicola) of Alachlor; 20 mg l)1 (N. muscorum; Aphanocapsa sp.; N. calcicola), 25 mg l)1 (A. variabilis; N. punctiforme; Gloeocapsa sp.) of Butachlor; 15 mg l)1

443

Immobilized cyanobacteria exposed to herbicides Table 1. Effect of graded concentration of herbicides on growth rates of free-living cyanobacterial isolates.

Table 2. Effect of graded concentration of herbicides on growth rates of immobilized cyanobacterial isolates.

Herbicide (mg l)1) Nostoc muscorum 0.0 2.0 5.0 10.0 15.0 20.0 25.0 Nostoc punctiforme 0.0 2.0 5.0 10.0 15.0 20.0 25.0 Nostoc calcicola 0.0 2.0 5.0 10.0 15.0 20.0 25.0 Anabaena variabilis 0.0 2.0 5.0 10.0 15.0 20.0 25.0 Aphanocapsa sp. 0.0 2.0 5.0 10.0 15.0 20.0 25.0 Gloeocapsa sp. 0.0 2.0 5.0 10.0 15.0 20.0 25.0 a

Butachlor

Alachlor

Arozin

2,4-D

Herbicide (mg l)1)

Butachlor

Alachlor

Arozin

2,4-D

1.1 1.0 0.6 0.4 NDa ND ND

1.1 1.1 0.6 0.3 0.1 ND ND

1.1 1.5 0.4 0.1 ND ND ND

1.1 1.1 0.5 0.4 ND ND ND

Nostoc muscorum 0.0 2.0 5.0 10.0 15.0 20.0 25.0

1.0 1.0 0.7 0.4 NDa ND ND

1.0 1.0 1.0 0.9 0.6 0.5 ND

1.0 1.0 0.4 0.1 ND ND ND

1.0 1.0 0.5 0.4 ND ND ND

1.0 1.0 1.0 0.7 0.6 ND ND

1.0 1.0 1.0 0.6 0.6 0.4 ND

1.0 1.0 0.6 0.4 ND ND ND

1.0 1.0 0.6 0.6 0.6 0.4 ND

Nostoc punctiforme 0.0 2.0 5.0 10.0 15.0 20.0 25.0

0.9 0.9 0.6 0.5 0.4 ND ND

0.9 1.0 0.9 0.9 0.6 0.4 ND

0.9 0.9 0.5 0.4 ND ND ND

0.9 1.0 0.6 0.6 0.5 0.2 ND

0.9 0.9 0.6 0.3 0.1 ND ND

0.9 0.9 0.7 0.6 0.6 0.2 ND

0.9 0.9 0.4 0.2 0.1 ND ND

0.9 1.0 0.6 0.5 0.3 0.1 ND

Nostoc calcicola 0.0 2.0 5.0 10.0 15.0 20.0 25.0

1.0 1.0 0.7 0.6 0.3 ND ND

1.0 1.0 0.8 0.8 0.7 0.6 ND

1.0 1.0 0.6 0.5 0.4 ND ND

1.0 1.0 0.9 0.6 0.9 0.6 ND

1.1 1.0 1.0 0.7 0.7 0.3 ND

1.1 1.1 0.9 0.7 0.7 0.4 ND

1.1 1.0 0.8 0.8 0.6 0.5 ND

1.1 1.1 1.0 0.8 0.6 0.3 ND

0.9 0.9 0.5 0.5 0.3 ND ND

0.9 0.9 0.5 0.5 0.3 ND ND

0.9 0.9 ND ND ND ND ND

0.9 0.1 ND ND ND ND ND

Anabaena variabilis 0.0 2.0 5.0 10.0 15.0 20.0 25.0

1.0 1.0 0.9 0.7 0.7 0.4 ND

1.0 1.0 1.0 0.8 0.8 0.5 ND

1.0 1.0 0.8 0.7 0.5 0.4 ND

1.0 1.0 1.0 0.8 0.6 0.4 ND

0.9 0.8 0.6 0.4 ND ND ND

0.9 0.9 0.7 0.6 0.5 0.3 ND

0.9 0.9 0.1 ND ND ND ND

0.9 0.9 0.3 ND ND ND ND

Aphanocapsa sp. 0.0 2.0 5.0 10.0 15.0 20.0 25.0

1.0 0.9 0.7 0.6 0.5 ND ND

1.0 1.0 0.7 0.6 0.5 ND ND

1.0 0.9 0.5 ND ND ND ND

1.0 1.0 0.9 0.6 0.5 0.2 ND

Gloeocapsa sp. 0.0 2.0 5.0 10.0 15.0 20.0 25.0

0.9 0.9 0.9 0.5 0.4 0.2 ND

0.9 0.9 0.7 0.7 0.6 0.4 ND

0.9 0.9 0.4 ND ND ND ND

0.9 0.9 0.3 ND ND ND ND

Not detectable.

(Aphanocapsa sp; N. muscorum), 20 mg l)1 (Gloeocapsa sp.), 25 mg l)1 (N. punctiforme; N. calcicola; A. variabilis) of 2,4-D . These dosages were considered as the lethal dosages and the dosages viz. 5 mg l)1 (N. muscorum; N. calcicola; Aphanocapsa sp.; Gloeocapsa sp.), 10 mg l)1 (N. punctiforme), 20 mg l)1 (A. variabilis) of Arozin; 15 mg l)1 (N. muscorum; Aphanocapsa sp; Gloeocapsa sp.), 20 mg l)1 (A. variabilis; N punctiforme; N. calcicola) of Alachlor; 10 mg l)1 (N. muscorum); 15 mg l)1 (N. calcicola; Gloeocapsa sp.; Aphanocapsa sp.), 20 mg l)1 (A. variabilis) of Butachlor; 5 mg l)1 (Gloeocapsa sp.; Aphanocapsa sp.), 10 mg l)1 (N. muscorum), 15 mg l)1 (N. calcicola),

a

Not detectable.

20 mg l)1 (A. variabilis; N punctiforme) of 2,4-D were considered as sub-lethal dosages for the isolates. The complete lysis of the cultures at lethal dosages of herbicides under immobilized conditions took place at 14–16 days of incubation whereas in the free state the lysis was recorded at 8–12 days of incubation in different strains. Similarly under sub-lethal dosages the survivability of free cells was recorded up to 20–25 days, whereas immobilized cells survived up to 35–45 days of incubation.

444

S. Singh and P. Datta

Arozin as compared to 2,4-D , Alachlor and Butachlor had shown most deleterious effect on growth of all the cyanobacterial isolates both in free and immobilized state (Table 3). As compared to other strains, the highest inhibition in chlorophyll a content was observed in N. muscorum. The initial chlorophyll a (lg ml)1) of 0.24 in free-living cells was increased to 1.61 in untreated control culture as compared to, 0.56 chlorophyll in cells treated with sub-lethal dosages of Arozin on day 8 of growth. Similarly 1.54 and 0.60 chlorophyll a content was found in control and treated culture of immobilized N. muscorum with respect to the initial level of 0.2. The protein content and heterocyst frequency followed a similar pattern of inhibition to chlorophyll a. Phycobilins were substantially reduced in free or immobilized isolates as compared to chlorophyll a following treatment with Arozin (Tables 4 and 5). In 2,4-D -treated cultures the phycobilin pigments and heterocyst frequency were more adversely affected than chlorophyll a and protein both in free and immobilized conditions (Tables 4, 5 and 7). On day 8 of growth, phycocyanin (lg ml)1) was significantly reduced to 0.45 and 0.75 from an initial level of 1.40 in the free and 1.21 in the immobilized state respectively. Likewise phycoerythrin (lg ml)1) was markedly reduced to 0.02 in the free state and 0.07 in the immobilized state from an initial level of 0.10 at a sub-lethal dosage in N. muscorum.

Microscopic examination of the cells revealed that the heterocyst frequency which was 2%–3% in the filamentous forms in both free and immobilized states in untreated diazotrophic cultures had increased to 5–9% in the immobilized state at day 8 of growth, but only a 4–6% increase was recorded in the free cultures. At sublethal dosages of herbicides, heterocyst frequency was reduced to 16–37% from the initial frequency in free cultures. However, under immobilized conditions, no change in heterocyst frequency was recorded in the test cyanobacterial strains from the initial frequency on day 8 of growth (data not shown). Butachlor, an inhibitor of protein synthesis showed a more marked inhibition of total protein content than of chlorophyll a and heterocyst frequency (Table 6). Significant reduction in protein content (lg ml)1) was recorded at a sub-lethal dosage in N. muscorum and N. calcicola where the initial level of 12.0 and 11.2 was reduced to 6.0 and 4.1 in free, and 9.5 and 7.5 in immobilized conditions respectively by the end of day 8 of growth. Phycobilin pigments followed a similar trend of inhibition (Tables 4 and 5). Alachlor, which is also an inhibitor of protein synthesis exhibited marked inhibition in total protein content (Table 6). At sub-lethal concentrations maximum inhibition in protein content was observed in N. calcicola and Gloeocapsa sp. where the protein level (lg ml)1) declined to 10.0 and 11.5 from initial

Table 3. Effect of sub-lethal dosages of herbicides on percent inhibition of chlorophyll a content of cyanobacterial isolates at the end of day 8 of diazotrophic growth. Cyanobacterial isolates

Arozin Fa

N. muscorum ISU N. punctiforme N. calcicola A. variabilis Aphanocapsa sp. Gloeocapsa sp.

Alachlor Ib

65 49 44 60 62 67

61 45 37 56 51 53

(p (p (p (p (p (p

= = = = = =

c

0.7) 0.7) 0.4) 0.7) 0.3) 0.2)

F

I

53 35 39 36 47 41

47 28 30 29 42 38

(p (p (p (p (p (p

= = = = = =

0.5) 0.4) 0.3) 0.4) 0.6) 0.7)

Butachlor

2,4-D

F

I

F

I

53 41 34 42 50 43

43 35 27 34 41 36

57 46 36 47 59 53

52 ( p 41 ( p 30 ( p 38 ( p 51 ( p 47 ( p

(p (p (p (p (p (p

= = = = = =

0.3) 0.5) 0.2) 0.3) 0.3) 0.4)

= = = = = =

0.6) 0.6) 0.5) 0.3) 0.4) 0.5)

a

Free cells. Immobilized cells. c The p-values calculated from binomial test on the paired absolute data indicate that the proportion of free and immobilized cells does not differ significantly from the test value (0.5). b

Table 4. Effect of sublethal dosages of herbicides on percent inhibition of phycocyanin content of cyanobacterial isolates at the end of 8th day of diazotrophic growth. Cyanobacterial isolates

N. muscorum ISU N. punctiforme N. calcicola A. variabilis Aphanocapsa sp. Gloeocapsa sp. a

Arozin

Alachlor

Fa

Ib

77 65 57 75 78 69

71 59 53 63 63 63

(p (p (p (p (p (p

= = = = = =

0.6)c 0.6) 0.7) 0.3) 0.2) 0.6)

F

I

71 70 74 63 68 69

61 62 67 53 61 62

(p (p (p (p (p (p

= = = = = =

0.4) 0.5) 0.5) 0.3) 0.5) 0.5)

Butachlor

2,4-D

F

I

F

I

68 68 49 70 80 79

61 63 42 61 72 68

94 86 85 83 79 70

89 79 78 76 73 74

(p (p (p (p (p (p

= = = = = =

0.5) 0.7) 0.5) 0.4) 0.5) 0.4)

(p (p (p (p (p (p

= = = = = =

0.7) 0.6) 0.6) 0.6) 0.6) 0.7)


445

Immobilized cyanobacteria exposed to herbicides

Table 5. Effect of sub-lethal dosages of herbicides on percent inhibition of phycoerythrin content of cyanobacterial isolates at the end of day 8 of diazotrophic growth. Cyanobacterial isolates

Arozin


Alachlor

Fa

Ib

89 68 70 80 85 74

83 57 65 69 69 66

(p (p (p (p (p (p

= = = = = =

0.6)c 0.3) 0.7) 0.4) 0.2) 0.5)

F

I

81 82 80 70 75 82

75 69 70 58 66 71

(p (p (p (p (p (p

= = = = = =

0.6) 0.3) 0.4) 0.2) 0.4) 0.4)

Butachlor

2,4-D

F

I

F

I

81 77 69 74 82 75

75 65 60 67 74 64

97 91 70 86 84 77

88 83 63 79 79 68

(p (p (p (p (p (p

= = = = = =

0.6) 0.3) 0.4) 0.5) 0.2) 0.7)

(p (p (p (p (p (p

= = = = = =

0.5) 0.5) 0.5) 0.6) 0.7) 0.4)

a


Table 6. Effect of sub-lethal dosages of herbicides on percent inhibition of protein content of cyanobacterial isolates at the end of day 8 of diazotrophic growth. Cyanobacterial isolates

Arozin Fa


47 41 50 73 58 57

Alachlor Ib 42 33 43 68 51 54

(p (p (p (p (p (p

= = = = = =

c

0.6) 0.3) 0.5) 0.7) 0.5) 0.8)

Butachlor

F

I

68 68 75 69 66 72

63 64 68 63 62 63

(p (p (p (p (p (p

= = = = = =

0.7) 0.7) 0.5) 0.6) 0.7) 0.4)

2,4-D

F

I

88 76 90 68 77 69

75 70 81 61 71 59

(p (p (p (p (p (p

= = = = = =

0.3) 0.6) 0.5) 0.5) 0.6) 0.4)

F

I

52 53 40 60 51 50

46 46 33 53 44 43

(p (p (p (p (p (p

= = = = = =

0.5) 0.5) 0.4) 0.5) 0.5) 0.5)

a


Table 7. Effect of sub-lethal dosages of herbicides on percent inhibition of heterocyst frequency of cyanobacterial isolates at the end of day 8 of diazotrophic growth. Cyanobacterial isolates

Arozin Fa

N. muscorum ISU N. punctiforme N. calcicola A. variabilis

50 52 50 68

Alachlor Ib 42 45 42 59

(p (p (p (p

= = = =

c

0.4) 0.2) 0.4) 0.4)

Butachlor

F

I

50 52 50 45

38 42 39 38

(p (p (p (p

= = = =

0.2) 0.3) 0.2) 0.4)

2,4-D

F

I

50 52 50 44

40 44 40 39

(p (p (p (p

= = = =

0.3) 0.4) 0.3) 0.6)

F

I

75 76 74 74

64 73 58 67

(p (p (p (p

= = = =

0.3) 0.4) 0.2) 0.5)

a


levels of 11.2 and 12.2 respectively in free state. Under immobilized conditions protein was reduced to 12.8 in N. calcicola from the initial level of 14.2 but no change was recorded in case of Gloeocapsa sp. by the end of day 8 of growth. A similar pattern of inhibition was observed in case of phycobilin pigments (Tables 4 and 5).

Discussion The results of growth rates of free and immobilized cells indicate that immobilization does not affect the multi-

plication of cells, even in the presence of herbicides suggesting that immobilization had no modifying effect on the overall growth behaviour of cells. No difference in the lethal and sub-lethal dosages of herbicides was recorded for both the free and immobilized states, indicating that immobilization did not modify the sensitivity of cultures towards the herbicide toxicity. Nevertheless significant delay in lysis of the cultures at lethal and sub-lethal dosages of herbicides under the immobilized state does suggest that immobilized cells are somehow able to survive for longer periods of time. Immobilization-induced longevity of cultures does indi-

446 cate that the Ca-alginate gel matrix possibly helps in delaying the acute toxicity of herbicides to the cyanobacterial isolates as observed in bacterial cultures of E. coli, P. putida and S. aureus where immobilization in Ca-alginate beads reduced the growth inhibition caused by bacteriostatic concentrations of phenol (Keweloh et al. 1989) indicating protection of bacterial cells against the toxicity of phenol. The highest reduction of phycobilin pigments (a nitrogen reserve) does suggest that under herbicide stress there was a diversion to meet the nitrogen demand, possibly through the induction of proteolytic enzymes. Free-living herbicide-treated cultures exhibited a marked reduction in heterocyst frequency, while no such reduction was noticed in immobilized cultures under similar set of conditions. It seems that immobilization protects heterocyst differentiation to some extent. It is suggested that physical pressure of entrapment and low oxygenic conditions either induces heterocyst differentiation or relieves heterocyst differentiation control mechanisms from cellular differentiation control mechanism (Mattiason & Hagerland 1982). It is clear from the foregoing discussion that cyanobacterial isolates have a higher frequency of heterocysts and prolonged survivability under the immobilized state than their free-living counterparts under herbicide stress. This protective action could be due to a mechanical diffusion barrier provided by the alginate matrix up to a certain extent limiting the fast access of herbicides to the cells present in the core of the beads, thus allowing certain cells to grow and multiply normally for a longer period of time, although statistical analysis does not suggest any significant variation in the responses of free or immobilized cultures in sub-lethal dosages of herbicides. The sustained growth, heterocyst differentiation and survival of immobilized diazotrophic cyanobacteria under graded dosages of common ricefield herbicides do suggest that N2-fixing cyanobacteria in the immobilized state could be used as better inocula delivery system for enhancing rice agriculture. Acknowledgements Thanks are due to Head, Department of Biological Science, R.D. University, Jabalpur (M.P.), India for facilities and to C.S.I.R. and U.G.C., New Delhi for financial assistance.

S. Singh and P. Datta References Benett, A. & Bogorad, L. 1973 Complementary chromatic adaptation in filamentous blue green algae. Journal of Cell Biology 58, 419–435. Codd, G.A. 1987 British Phycological Society. News Letter 24. Fay, P. 1983 The Blue Greens (Cyanophyta - Cyanobacteria). ArnoldHeinemann, London. ISBN 071312878X. Fairchild, J.F., Ruessler, D.S. & Carlson, A.R. 1998 Comparative sensitivity of five species of macrophytes and six species of algae to atrazine, metribuzin, alachlor and metachlor. Environmental Toxicology and Chemistry 17, 1830–1834. Goyal, D., Roy-Choudhury, P. & Kaushik, B.D. 1991 Effect of two new herbicides on the growth and nitrogen fixation in Anabaena and Tolypothrix. Acta Botanica Indica 19, 25–28. Kannaiyan, S., Aruna, S.J., Merina-Prem Kumari, S. & Hall, D.O. 1997 Immobilized cyanobacteria as a biofertilizer for rice crops. Journal of Applied Phycology 9, 167–174. Keweloh, H., Heipieper, H.A. & Rehm, H.J. 1989 Protection of bacteria against toxicity of phenol by immobilization in calcium alginate. Biotechnology 31, 383–389. Kratz, W.A. & Meyers J. 1955 Nutrition and growth of several blue green algae. American Journal of Botany 42, 282–287. Leganes F. & Fernandez-Valientl E. 1992 Effect of phenoxy acetic herbicides on growth photosynthesis and nitrogenase activities in cyanobacteria from ricefield. Archives of Environmental Contamination and Toxicology 22, 130–134. Mackinney, G. 1941 Absorption of light by chlorophyll solutions. Journal of Biological Chemistry 140, 315–322. Mattiason, B. & Hahn-Hagerland, B. 1982 Micro environmental effects on metabolic behaviour of immobilized cells. A hypothesis. European Journal of Applied Microbiology 16, 52–62. Padhy, R.N. 1985 Cyanobacteria and pesticides. Residue Reviews 95, 1–44. Rippka, R., Dereulles, J., Waterbury, J.B., Herdman, M. & Stanier, R.V. 1979 Generic assignments, strain histories and properties of pure cultures of cyanobacteria. Journal of General Microbiology 111, 1–61. Singh, L.J. & Tiwari, D.N. 1988 Effect of selected rice field herbicides on photosynthesis, respiration and nitrogen assimilating enzyme system of paddy soil diazotrophic cyanobacteria. Pesticide Biochemistry and Physiology 31, 120–128. Singh, S., Datta, P. & Patel R. 2000 Cyanobacterial flora and properties of ricefield soils of Jabalpur and Katni districts of Madhya Pradesh. Phykos 39, 135–140. Singh, S., Datta, P. & Patel, R. 2003 Survival and growth of diazotrophic cyanobacterial isolates exposed to ricefield herbicides. Bulletin of Environmental Contamination and Toxicology 70, 1052–1058. Singh, V.P., Singh, B.D., Singh, R.B., Dhar, B., Singh, R.M. & Shrivastava, J.S. 1978 Effect of herbicide Alachlor on growth and nitrogen fixation in cyanobacteria and rhizobia. Indian Journal of Experimental Biology 16, 1325–1327. Stewart, W.D.P., Rowell, P., Kerby, N.W., Reed, R.H. & Machray, G.C. 1987 N2-fixing cyanobacteria and their potential application. Philosophical Transactions of the Royal Society of London 317, 245–258. Whitton, B.A. & Potts, M. 2000 Introduction to the cyanobacteria. In The Ecology of Cyanobacteria, eds. Whitton, B.A. & Potts, M. Kluwer Academic Publishers. ISBN 071312878X.

Springer 2005


Characterization of a wine-like beverage obtained from sugarcane juice Yadira Rivera-Espinoza, Elsa Valdez-Lo´pez and Humberto Hernańdez-Sańchez* Departamento de Graduados e Investigacioń en Alimentos, Escuela Nacional de Ciencias Biolo´gicas, Instituto Politećnico Nacional, Carpio y Plan de Ayala, C.P. 11340, Me´xico, D.F., Me´xico *Author for correspondence: Tel.: 5729-6000 ext. 62461, Fax: 5729-6000 ext. 62359, E-mail: [email protected] Keywords: Alcoholic beverage, fermentation, sugarcane juice, wine, yeast

Summary Two yeasts (Saccharomyces cerevisiae and Saccharomyces cerevisiae var. ellipsoideus) were tested for their ability to ferment sugarcane (Saccharum officinarum) juice. In order to do this, time course studies of volatile, fixed, and total acidity, pH, alcohol, total sugars and Bx were performed and the presence of methanol was tested. The fermentation studies were carried out at 25, 28 and 30 C and the juice was inoculated with 1 and 5% (v/v) suspensions of both yeasts containing 1 · 108 cells ml)1. Time course studies indicated a similar fermentative pattern at the three temperatures evaluated, hence 25 C was chosen as the cheapest alternative. The size of the inoculum made no difference in the fermentation. Analyses of the sugarcane juice wine showed the following results: pH, 3.2; alcohol, 10 GL; total solids, 16.5 g l)1; ash, 1.4 g l)1; total acidity, 5.4 g l)1; volatile acidity, 0.12 g l)1; fixed acidity, 5.3 g l)1 and no methanol was detected. Two additional products were obtained after adding passion fruit juice and roselle (Hibiscus sabdarifa Linn) concentrates. The fruit-flavoured wines were significantly preferred (P £ 0.05) over the plain product. These results indicated that the elaboration of wine-like beverages is a good alternative use for sugarcane.

Introduction Sugarcane, Saccharum officinarum L. is one of the tallest members of the grass family with the potential to grow up to 14 ft high under tropical conditions. It has been the subject of much recent genetic improvement to increase its sugar content, or to give it disease resistance. The sugarcane industry is the principal agroindustry in Latin America. Mexico has 650, 000 ha of land planted with sugarcane. Over the years, sugarcane has been used as a source of sucrose, however, due to the introduction of high fructose corn syrup (HFCS), a cheaper sweetener, a dramatic reduction in the use of sucrose by the food industry has occurred (Tijerina & Crespo 1998). It is very important then, to find alternative uses for this crop. Sugarcane juice composition may vary according to cane variety, geographical location, cultural practices, maturity at harvest and also mechanical treatment during harvesting and transportation. The principal constituents of cane juice are sugars, salts, organic acids and other organic non-sugars such as proteins (Poel et al. 1998). Fresh sugarcane juice has been used as a thirstquenching drink in some places such as South East Asia (Khor et al . 1990) and also in Mexico and some parts of South America. In addition, the sugarcane juice is an

excellent medium for fermentation in order to elaborate alcoholic beverages. Rum is produced from molasses, the final by-product in the manufacture of raw sugar from sugarcane and fresh juice has also been used as a substrate to make traditional beverages (Tanimura et al. 1977). However, there are no reports about the kinetics of the fermentation of sugarcane juice in order to elaborate a wine. In the ordinary sense of the word, wine is a fermented beverage produced from grapes only. Otherwise, the wine is given the prefix of the fruit from which it originates (Voguel 2003). For simplicity, however, in this study, the word ‘‘wine’’ will be used to name the fermented, but not distilled, beverages obtained from sugarcane juice. In the traditional wine-making process, fermentation is usually achieved using the natural biota existing on the grape skins (Ubeda & Briones 2000); however, selected yeasts are currently being used to ferment a sweet juice to produce grape and fruit wines. A young wine’s fruity aromas and flavours come mainly from the grapes, though some of the aroma is also produced during the fermentation. The majority of volatile compounds of the grape aroma are known to be constituents of many other fruits as well (Mingorance-Cazorla et al . 2003). For this reason, the aim of this work was to explore the possibility of the elaboration of a fermented

448

Y. Rivera-Espinoza et al.

beverage harbouring the sweet characteristics of the sugarcane juice. It is hoped that our analysis will provide some incentive for an eventual commercial production of wine from sugarcane juice.

Clarification


Flavour addition

Sugarcane juice (substrate)

Two additional products were obtained after adding passion fruit (Passiflora edulis) or roselle flower (Hibiscus sabdariffa L.) extract to the fermented beverage to increase the acceptance of the wine, using a concentrate to wine ratio of 1:10.

The substrate used was obtained from washed and peeled sugarcane. Sugarcane was squeezed through a roller mill to extract the juice. Then, the juice was filtered to remove solids, pasteurized for 15 min at 15 lb in)2, and its physical and chemical characteristics were measured. Yeast strains In order to find the best yeast to ferment the sugarcane juice, Saccharomyces cerevisiae and Saccharomyces cerevisiae var. ellipsoideus strains from the Microbiology Laboratory collection of the Escuela Nacional de Ciencias Biolo´gicas were used. The yeast inoculum was grown in sugarcane juice with orbital shaking at 160 rev min)1 for 2 days. A loopful of this stock culture was plated on malt extract agar and incubated at 28 C for 2 days. The number of viable yeast expressed as colony forming units per millilitre (c.f.u. ml)1) was estimated. Serial dilutions (in 0.9% NaCl) of each sample were plated in triplicate and the plates were incubated at 28 C until the appearance of the colonies. The water to prepare the agar was substituted by sugarcane juice for conditioning of the yeast strains. The absorbance at 590 nm of the serial dilution was also measured. Fermentation The filtered and pasteurized sugarcane juice was adjusted to a pH between 3.5 and 4 with citric acid and to 20 Brix (soluble solids). The initial population of the yeast used for fermenting the juice was 1% (0.9 · 108 for S. cerevisiae and 1 · 108 cells ml)1 for S. c. var. ellipsoideus). Fermentation was carried out, in duplicate, in capped sterile flasks containing 4000 ml of unsterile sugarcane juice at 30 C without shaking for 7 days. Brix and ethanol contents were monitored. After yeast selection, fresh juice was used to carry out a new fermentation. A 5% inoculum (containing 1 · 108 cells ml)1) of cells was used to inoculate the juice whose pH and Brix content were previously adjusted. The inoculated juice was incubated at different temperatures: 25, 28 and 30 C while monitoring Brix, ethanol, total acidity, volatile acidity, reducing sugars and methanol. Samples were taken from the flasks every 24 h for analyses until a constant Brix concentration was obtained.

After the fermentation stopped, the liquid was clarified by centrifugation at 10,000 · g for 30 min at 5 C and then stored for about 2 weeks at 4 C.

Analyses Sugarcane juice was analysed to determine the following parameters (AOAC 2003): Brix (AOAC 2003): Brix (AOAC procedure number 31.009), moisture (AOAC procedure number 31.006), ash (AOAC procedure number 31.012), nitrogen (AOAC procedure number 31.019), invert sugar (AOAC procedure number 31.034), acidity (AOAC procedure number 31.202) and pH (AOAC procedure number 31.203). The following parameters were analysed in the final products: total acidity (AOAC procedure number 11.035), total volatile acidity (AOAC procedure number 11.036), volatile acidity (AOAC procedure number 11.039), fixed acidity (AOAC procedure number 11.040), alcohol (AOAC procedure number 11.003), extract (AOAC procedure number 11.012), ash (AOAC procedure number 11.017) and methanol (AOAC procedure number 9.086). Sensory evaluation of the wines was carried out by a semi-trained panel of 40 potential consumers. A rating test with a five-point hedonic scale was used and the final score was the average of individual scores. A oneway analysis of variance was used for the statistical analysis.

Results and discussion The characteristics of the sugarcane juice were: pH, 5.1; Brix, 19.7; total sugars, 200 g l)1; total acidity (citric acid), 1.16 g l)1; nitrogen, 2.3 g l)1, ash, 0.28 g l)1. Fermentation Figure 1 shows the substrate consumption and ethanol production during sugarcane juice fermentation at 30 C using a 1% suspension of the yeast S. cerevisiae or S. c. var. ellipsoideus containing 1 · 108 cells ml)1 over a period of 7 days. Approximately 85% of soluble solids were consumed by S. c. var. ellipsoideus after 6 days of fermentation, whereas 10% of soluble solids in the juice inoculated with S. cerevisiae were consumed. In consequence, the ethanol concentration was higher in the juice fermented

449

Sugarcane juice wine 25

20

15 Brix

Bx Saccharomyces cerevisiae Bx S. cerevisiae var. ellipsoideus

10

% Ethanol S. cerevisiae

5 % Ethanol .S cerevisiae var. ellipsoideus

0 0

1

2

3

4

5

6

7

Time (days) Figure 1. Substrate consumption and ethanol production during sugarcane juice fermentation at 30 C using a 1% inoculum of yeasts Saccharomyces cerevisiae or S.c. var. ellipsoideus.

effect on the rate of decrease of the soluble solids measured as Brix (Figure 2). The fermentation at 30 C was apparently faster than at the other temperatures, however the analysis of variance did not show significant differences among temperatures. Temperature did not show any significant effect (P £ 0.05) on ethanol production (Figure 3). The size of the inocula made no difference in the characteristics of the product, but the time of fermentation was shorter when the juice was inoculated with 5% (v/v) of the yeast suspension. White grape juices are fermented at lower temperatures than are red juices, often 15 C or lower, to retain the fruity character (Thornton & Rodriguez 1996). In sugarcane juice, the fermentation temperature did not have a significant effect on the flavour of the wine. A fruity wine was obtained at the three temperatures used. Nitrogen compounds are important components of the grape juice for wine production. Low levels of assimilable nitrogen compounds for the yeast have been related to lower fermentation rates, longer fermentation

25 20 °Bx a 25°C °Bx a 28°C

15

°Bx a 30°C

Brix

with S. c. var. ellipsoideus than in the one fermented with S. cerevisiae (10% v/v and 1.6% v/v, respectively). In addition, S. c. var. ellipsoideus improved the fruitiness in the bouquet. The results were significatively different (P £ 0.05). The depletion of most of the sugar content during the fermentative process showed that S. c. var. ellipsoideus was better to ferment the sugarcane juice than S. cerevisiae. No change was detected in Brix after 6 days. The results obtained with S. c. var. ellipsoideus are in agreement with Regodon et al . (1997), when they used selected yeasts for wine-making and the traditional spontaneous fermentation in grape juice. They reported a decrease in soluble solids during the first 7 days of the alcoholic fermentation (25 C). They used 11 yeast strains, three microvinification trials and 21 grape juices (with 20 Brix), and obtained, in all cases, wines of good quality. It was observed that during the first 7 days of fermentation, the wine had a nice fruity aroma, but after this time, the product showed an undesirable taste so it was decided to stop the fermentation after day 7. The sensory properties of wine were modified when the wine was left with the yeast longer than 7 days at 30 C, probably due to autolysis of the yeast. This phenomenon has been observed also in grape wines (Martı´ nezRodriguez & Polo 2000). In this process, the yeast constituents (amino acids, proteins and polypeptides) are released into the medium (Perrot et al. 2002).

10

Effect of temperature on the fermentation 5

In the second stage of this study, S. c. var ellipsoideus was used, due to its better ability to ferment the sugarcane juice. After adjusting the pH of the juice to 3.5–4, the fermentation was carried out at 25, 28 and 30 C and increasing the yeast content to 5% (1 · 108 cells ml)1). The temperature had very little

0 0

1

2

3

Time (days) Figure 2. Substrate consumption by S. cerevisiae var. ellipsoideus during sugarcane fermentation at 25, 28 and 30 C.

450

Y. Rivera-Espinoza et al.

12 Total acidity (g l-1 tartaric acid)

6

Ethanol (% vol)

10 8 6 4

25 °C 28 °C 30 °C

2 0

5 4 3 2

25 ºC 28 ºC 30 ºC

1 0

0

1

3

2

0

1

Time (days) Figure 3. Ethanol production by S. cerevisiae var. ellipsoideus during sugarcane fermentation at 25, 28 and 30 C.

times or stuck fermentations (Ferreira-Monteiro & Bisson 1992). S. cerevisiae does not have the ability to carry out the fermentation in the sugarcane juice. The fermentation could be stuck probably due to the fact that nitrogen limits the rate of glycolysis. Many authors have described differences in the amount of amino acids consumed by different yeast strains. In grape juice, ammonia is the preferred nitrogen source for the yeasts. Some studies have shown that amino acids increase the fermentation rate and decrease the fermentation time (Albers et al . 1996). Others have shown that a mixed source (ammonia and amino acids) is more effective for promoting yeast growth and fermentation rate (Ribe´reau-Gayon et al. 2000). In our results, unlike some reports, it was not necessary to add a nitrogen source. The fermentation time without nitrogen source was shorter (7 days to consume all fermentable sugars) than the one reported by Torija et al. (2003) (8 days to consume the fermentable sugars) when they used ammonium sulphate as a nitrogen source in a grape must. Figure 4 shows a small effect of temperature on the formation of the volatile acidity at 25, 28 and 30 C (0.12–0.28 g l)1), however all results are in agreement with the values reported for white wines, also according to the procedures of the Official Mexican Standards

Volatile acidity (g l-1 acetic acid)

0.35 0.3 0.25

2 Time (days)

3

4

Figure 5. Total acid production by S. cerevisiae var. ellipsoideus at 25, 28 and 30 C.

(maximum 1.12 acetic acid g l)1). Volatile acidity was found to be similar to the values obtained for grape wine by Regodon et al . (1997) (values between 0.42–0.8 g l)1) and Korkoutas et al . (2002) at 30–30 C (values between 0.7–0.13 g l)1). Also, the fermentation curves for the decrease of Brix (Figure 2) in sugarcane juice were similar to those shown for Garnacha Tintorera grape juice not inoculated and inoculated with select yeast strains in a grape must (Regodon et al .1997). The amount of total acidity in this experiment appeared to be very similar to the values reported by other authors (Figure 5). Korkoutas et al. (2002) found a total acidity in the range of 3.3–6.6 g l)1 of tartaric acid at 15–30 C and a value of 4.6 g l)1, at 25–30 C, was obtained in this experiment after 7 days. Wine analysis The results of the sugarcane juice fermentation at the three different temperatures and the values from the Mexican Regulations for the grape wines are summarized in Table 1. According to the Mexican Regulations, all the parameters of the sugarcane wines are within the normal ranges. Ethanol production measured at 15 C represented approximately 10% v/v in the temperature range of 25–30 C. Ash content was near the minimal requirement. Total acidity was in the range 4.72– 4.98 g l)1. Methanol was not detected in the course of the fermentation. Sensory evaluation

0.2

25 ºC 28 ºC 30 ºC

0.15 0.1 0.05 0

0

1

2

3

Time (days) Figure 4. Volatile acid production by S. cerevisiae var. ellipsoideus at 25, 28 and 30 C.

Regodon et al. (1997) reported that the aroma and flavour of the resulting wines depend on the yeast strain used. This could be appreciated in the results of this study, since the product obtained from sugarcane juice was considered to have good quality according to the sensory evaluation test. It is very likely that some phenolic compounds and esters could be formed during the fermentation process and that they could greatly influence the sensory attributes (Gil-Munõz et al. 1999; Plata et al . 2003).

451

Sugarcane juice wine Table 1. Mexican Regulations for the grape wines and experimental results (average of three replicates) for the sugarcane juice wines. Specifications

Minimum

Maximum

25 C

28 C

30 C

Alcohol content (GL at 15 C) Ash (g l)1) Total acidity (as tartaric acid g l)1) Volatile acidity (as acetic acid g l)1) Fixed acidity (as tartaric acid g l)1) Methanol (mg per 100 ml in 100% alcohol)

9.5 1 4.5

14

10.1 0.96 4.42 0.12 4.30 Negative

10 0.94 4.54 0.23 4.31 Negative

9.8 0.96 4.59 0.32 4.27 Negative

10 1.2

4 300

Table 2. Hedonic test for flavour acceptance of the sugarcane wine samples. Sugarcane wine samples

Like very much

Like moderately

Neither like nor dislike

Dislike moderately Dislike very much Total

Natural flavour Passion fruit flavour Roselle flavour

0 14 14

14 4 22

6 6 3

17 5 1

Forty panelists were chosen from the staff and students of the Escuela Nacional de Ciencias Biolo´gicas and trained in their ability to describe the flavour of the products. The analyses were carried out with three different products: plain, passion fruit- and roselleflavoured wines. The judges considered that the flavour of the sugarcane wine was good; however the addition of passion fruit or roselle flavours increased even more the acceptance of the product. The results of the hedonic test (flavour acceptance) of the three different presentations of sugarcane wine are shown in Table 2. Half of the panelists accepted the wine without flavour addition, 60% accepted the passion fruit-flavoured wine and 97.5% accepted the roselle-flavoured wine. The plain wine had 2Brix and was definitely a dry wine. This could have some influence in its acceptance. The flavoured beverages had 6–7Brix, and this could be essential for the acceptance by the people who do not usually drink wine. This sensory evaluation was useful for considering some of the factors that influenced the acceptance of the wine obtained from sugarcane. It was clear that the offering of three different flavours increased the interest in this kind of wine. This was important, since Mexico is a spirit and beer country and wine is the last choice among people who consume alcohol beverages. Conclusions Finally, it can be concluded that the elaboration of wine with acceptable characteristics, using sugarcane juice as a substrate, is technically feasible and a good alternative use for this raw material. It is our hope that this analysis could be an incentive for an eventual commercial production of wines from sugarcane juice. Acknowledgments This study was supported by fellowships from COFAA—IPN and a grant from CGPI—IPN. Author

3 1 0

40 40 40

Rivera-Espinoza received a scholarship from Consejo Nacional de Ciencia y Tecnologı´ a (CONACyT).

References Albers, E., Larsson, C., Lideń, G., Niklasson, C. & Gustafsson, L. 1996 Influence of the nitrogen source on Saccharomyces cerevisiae anaerobic growth and product formation. Applied and Environmental Microbiology 62, 3187–3195. Association of Official Analytical Chemists (AOAC). 2003 Official Methods of Analysis 17th edn., ed. Horwitz, W. Washington, DC. 20044, ISBN 0 93558 67 6. Ferreira-Monteiro, F. & Bisson, L.F. 1992 Nitrogen supplementation of grape juice. Effect on amino acid utilization during fermentation. American Journal of Enology and Viticulture 43, 1–10. Gil-Munõz, R., Go´mez-Plaza, E., Martı´ nez, A. & Lo´pez-Roca, J.M. 1999 Evolution of phenolic compounds during wine fermentation: influence of grape temperature. Journal of Food Composition and Analysis 12, 259–272. Khor, G.L., Tee, E.S. & Kandiah, M. 1990 Patterns of food production and consumption in the ASEAN region. World Reviews of Nutrition and Diet 61, 1–40. Kourkoutas, Y., Koutinas, A.A., Kanellaki, M., Banat, I.M. & Marchant, R. 2002 Continuous wine fermentation using a psychrophilic yeast immobilized on apple cuts at different temperatures. Food Microbiology 19, 127–134. Martı´ nez-Rodriguez, A. & Polo, M.C. 2000 Characterization of the nitrogen compounds released during yeast autolysis in a model wine system. Journal of Agricultural and Food Chemistry 48, 1081–1085. Mingorance-Cazorla, L., Clemente-Jimeńez, J.M., Martı´ nez-Rodriguez, S. & Las Heras-Va´squez, F.J. 2003 Contribution of different natural yeast to the aroma of two alcoholic beverages. World Journal of Microbiology and Biotechnology 19, 297–304. Perrot, L., Charpentier, M., Feuillat, M. & Chassagne, D. 2002 Yeast adapted to wine: nitrogen compounds released during induced autolysis in a model wine. Journal of Industrial Microbiology and Biotechnology 29, 134–139. Plata, C., Millan, C., Mauricio, J.C. & Ortega, J.M. 2003 Formation of ethyl and isoamyl acetate by various species of wine yeasts. Food Microbiology 20, 217–224. Poel, van der P.W., Schiweck, H. & Schawartz, T. 1998 Sugar Technology Beet and Cane Sugar Manufacture. Berlin, Germany: Verlarg Dr. Albert Bartens KG. ISBN 3 87040 065 X. Regodon, J.A., Perez, F., Valdes, M.E., de Miguel, C. & Ramirez, M. 1997 A simple and effective procedure for selection of wine yeast strains. Food Microbiology 14, 247–254.

452 Ribe´reau-Gayon, P., Dubourdieu, D., Done`che, B. & Lonvaud, A. 2000 The microbiology of wine and vinifications. In Handbook of Enology. Chichester, England: Wiley, ISBN 0 471 97362 9. Tanimura, W., Sańchez, P.C. & Kosaki, M., 1977 Fermented foods of the Philipphines. II. Basi (sugarcane wine). Journal of Agricultural Science 22, 135–141. Thornton, R.J. & Rodriguez, S.B. 1996 Deacidification of red and white wines by a mutant of Schizosaccharomyces malidevorans under commercial winemaking conditions. Food Microbiology 13, 475–482. Tijerina, Ch. Z. & G. Crespo P. 1998 Ana´lisis a nivel nacional de la produccioń de canã de azućar. Ed. INEGI. Me´xico, ISBN 970 13 1179 5.

Y. Rivera-Espinoza et al. Torija, M.J, Beltran, G., Novo, M., Poblet, M., Roze´s, N., Guillamoń, J.M. & Mas, A. 2003 Effect of the nitrogen source on the fatty acid composition of Saccharomyces cerevisiae. Food Microbiology 20, 255–258. Ubeda, J. & Briones, A. 2000 Characterization of differences in the formation of volatiles during fermentation within synthetic and grape must by wild Saccharomyces strains. Lebensmittelwissenschaft und -Technologie 33, 408–414. Voguel, W. 2003 ¿Que es el vino? In Elaboracioń casera de vinos. Vinos de uvas, manzanas y bayas. Ed. Acribia, S.A. Zaragoza. pp. 4–7. Spain, ISBN 84 200 1002 2.

Springer 2005

World Journal of Microbiology & Biotechnology (2005) 21:453–456 DOI 10.1007/s11274-004-1879-z

A novel Candida glycerinogenes mutant with high glycerol productivity in high phosphate concentration medium Bin Zhuge1, Xue-Na Guo1, Crispen Mawadza2, Hui-Ying Fang1, Xue-Ming Tang1, Xi-Hong Zhang1 and Jiang Zhuge1,* 1 School of Biotechnology and Key Laboratory of Industrial Biotechnology, Ministry of Education, Southern Yangtze University, Huihe Road No.170, Wuxi, Jiangsu Province 214036, P. R. China 2 Department of Microbiology, University of Stellenbosch, Private Bag X1, Matieland 7602, South Africa *Author for correspondence: Fax:+86-510-588664, E-mail: [email protected] Keywords: Candida glycerinogenes mutant, cytoplasmic glycerol-3-phosphate dehydrogenase (ctGPD), glycerol, phosphate

Summary A novel Candida glycerinogenes mutant, which possesses high glycerol productivity in a high phosphate concentration medium, was obtained by mutagenesis of an industrial glycerol producer. The mutant accumulated a total biomass of 11.5 g l)1, which is less than the 15 g l)1 of the wild-type strain, but it consumed glucose faster than the wild-type strain did. The mutant reached its maximal glycerol concentration of 129 g l)1 in 84 h compared to 96 h for the wild-type strain. High cytoplasmic glycerol-3-phosphate dehydrogenase activity of the mutant in the early glycerol formation phase, leading to a rapid glycerol synthesis and accumulation, may be the main reason for the short fermentation process.

Introduction Glycerol, an important feedstock for the production of various chemicals, can either be recovered as a byproduct of soap manufacture from fats or produced by chemical synthesis from petrochemicals. As an alternative route, glycerol production by fermentation has been studied since the First World War and has become more popular recently. We isolated Candida glycerinogenes, a novel osmotolerant yeast, and succeeded in the industrialization of glycerol fermentation with the wild-type strain (Wang et al. 2001; Zhuge et al. 2001). However, there is an urgent business need to shorten the fermentation time for cost saving and productivity increase. In a previous study (Guo et al. 2002), we reported that one of the main factors affecting the production of glycerol is the concentration of phosphate in the medium. The lower the phosphate concentration, the lower the biomass yield and the lower the rate of glucose consumption. The fermentation time is therefore protracted giving a low glycerol concentration. Though high concentration of phosphate can shorten the fermentation time, the yield of glycerol from glucose by the wild-type strain is far from satisfactory. This paper describes the isolation of a C. glycerinogenes mutant with high productivity and short fermentation time in high concentration phosphate

medium. The fermentation performances between the mutant and wild-type strain are also comparatively investigated.

Materials and methods Microorganism and media C. glycerinogenes, from the Research and Design Glycerol Fermentation Center, Southern Yangtze University, was propagated in a seed culture medium containing 100 g l)1 glucose, 2 g l)1 urea and 10 g l)1 corn steep liquor (CSL). The screening was carried out in a medium comprising different phosphate concentrations. (2 g CSL l)1 and potassium dihydrogen phosphate (KDP)) (Table 1), 250 g l)1 glucose, 2 g l)1 urea, pH 5.5. The fermentation medium was composed of 250 g l)1 glucose, 2 g l)1 urea and 10 g l)1 CSL (300 mg l)1 phosphate). Mutation and screening of C. glycerinogenes mutants The wild-type strain described above on shaker at 30 C and for 15 min at 3000

was cultivated in seed medium a 110 rev min)1 reciprocating the yeast cells were centrifuged rev min)1 and collected. After

454

B. Zhuge et al.

Table 1. The quantity of corn steep liquor (CSL) and potassium dihydrogen phosphate (KDP) in different media. Corn steep liquor (CSL) (g l)1)

Potassium dihydrogen phosphate (KDP) (g l)1)

Final phosphate concentration (mg l)1)

1.6667 2.0000 2.0000 2.0000 2.0000 2.0000

0.0000 0.0573 0.2005 0.3437 0.4869 0.6301

50 100 200 300 400 500

in Table 1. Experimental data shows that glycerol was accumulated at the highest level (129 mg l)1) when the phosphate concentration in the medium was 100 mg l)1 and fermentation time was 96 h. A further increase in the phosphate concentration to 300, 400 and 500 mg l)1, the fermentation time was shortened to 85, 80 and 80 h, respectively, but the glycerol productivity declined to 115.6, 109.1 and 73.1 g l)1, respectively. Therefore, by balancing fermentation time and glycerol productivity, a phosphate concentration of 400 mg l)1 was employed in the screening medium.

washing with 8 g l)1 NaCl solution, the cells were centrifuged for 10 min at 3000 rev min)1 again. Then, the cells (107 cells ml)1) were added into a tube containing 40 mg l)1 NTG solution, shaken for about 30– 40 min at 30 C, and centrifuged again at 3000 rev min)1 for 10 min. Less than 20% of the cells survived mutagenesis. Subsequently, the cells were cultured in seed medium again for 4 h, washed twice with 8 g )1 NaCl solution and spread on glucose–urea–agar medium after dilution. All the mutants obtained were screened using the screening medium.

In order to obtain a mutant that has a high rate of fermentation and high productivity of glycerol at high phosphate concentration, we investigated the glucose consumption rate and glycerol productivity of mutants in medium containing 400 mg l)1 phosphate. After screening, a mutant that could reduce fermentation time by about 12 h without an observed decrease in productivity was obtained. The mutant was designated as C. glycerinogenes UN-1 and was used for further study.

Fermentation

Comparison of mutant with the wild-type strain

All shake-flask fermentations were carried out in 250-ml gauze-covered, conical flasks with a working volume of 25 ml at 30 C on a 110 rev min)1 reciprocating shaker. The medium was inoculated at 5% (v/v). For 5-l scale experiments, an automated magnetically stirred fermentor FK-5L (Korea Fermentor Co Ltd) was used with a 3-l culture volume. The fermentor was agitated at 450 rev min)1 and aerated at 2 l min)1.

Fermentation experiments were done in order to identify differences in fermentation processes between the mutant and wild-type strains. According to the experimental data, there were some differences in the rate of glucose consumption, glycerol productivity, biomass and ctGPD activity. As shown in Figure 1a, b, the glucose consumption rate of the mutant was slightly slower than that of the wild-type strain during the first 48 h; later, the glucose consumption rate of the mutant evidently outstripped that of the wild-type one. The same phenomenon was observed for glycerol productivity. During the first 48 h, the mutant gave a lower yield of glycerol than the original strain did, but the mutant produced more glycerol from 44 to 96 h. Remarkably, the mutant strain reached its peak at 84 h for glycerol production, compared to 96 h of the wild-type strain. Figure 1a shows that the mutant strain yielded a total biomass of 11.5 g l)1 in the medium containing either 300 or 200 mg l)1 phosphate, but the wild-type strain in the medium containing 300 mg l)1 phosphate generated more biomass than in medium containing 200 mg l)1 phosphate during the fermentation process and reached more than 15 g l)1. The ctGPD activity of the mutant was higher than that of the wild-type strain over the period from 12 to 55 h (Figure 1b).

Analytical methods Glucose was determined by immobilized glucose oxidase using a glucose analyser. Glycerol was monitored by the method of Zhuge et al. (2001) and the biomass concentration was determined after drying the cells at 80 C for 24 h. The activity of cytoplasmic glycerol-3-phosphate dehydrogenase (ctGPD) was determined by the method of Blomberg & Adler (1989). One unit of ctGPD activity was defined as the amount of enzyme that consumes 1 lmol NADH per minute.

Results Determination of phosphate concentration in the screening medium The CSL that was used as the phosphate source has many other components. To avoid the effects of other components, the CSL was added together with KDP into the medium. The phosphate concentration in CSL was 30 mg g)1. The quantity of CSL and KDP in the medium of different phosphate concentrations is shown

Choice of mutant for fermentation

Fermentation characteristics of the C. glycerinogenes in a 5-1 fermentor The time courses of glycerol formation by the C. glycerinogenes mutant and wild-type in a 5-l fermentor are shown in Figure 2a and b, respectively. Both a and b

Candida glycerinogenes Mutant

Figure 1. (a) Comparison of the biomass and the glucose consumption rate between the mutant and the wild-type strain in 250 ml conical flasks. The volume of medium containing 200 mg l)1 phosphate was 25 ml. (·) the biomass of mutant, (m) the biomass of wild-type strain. (n) the biomass of mutant in medium containing 300 mg l)1 phosphate, (r) wild-type strain in medium containing 300 mg l)1 phosphate, (d) the glucose consumption rate of mutant and ( ) the glucose consumption rate of wild-type strain. (b) Comparison of the ctGPD activity and the glycerol production between the mutant and the wildtype strain in 250 ml conical flasks. The volume of medium containing 200 mg l)1 phosphate was 25 ml. (n) the ctGPD activity of mutant, (r) the ctGPD activity of wild-type strain, (·) the glycerol production of mutant and (m) the glycerol production of wild-type strain.

455

Figure 2. (a) The fermentation process of mutant in a 5-l fermentor at 30 C. (b) The fermentation process of wild-type strain in a 5-l fermentor at 30 C. (·) Glucose, (m) biomass, ( ) glycerol, pH and (n) O2 consumption rate.

show a sharp increase in the biomass and O2 consumption rate during the growth phase. Figure 2a shows that the mutant reached its biomass peak of 12 g l 1 after 24 h. Thereafter, the glycerol increased and glucose decreased gradually. When the glucose concentration had declined to 4 g l)1, glycerol reached 129 g l)1 in the medium. The oxygen consumption rate of the mutant decreased gradually after the growth phase with a sharp decrease from 48 to 57 h. The pH value fluctuated between 2.5 and 4. The fermentation was complete in 84 h. Compared with Figure 2a, Figure 2b shows that the wild-type strain formed more biomass and consumed more oxygen than the mutant did. The fermentation time of the wild-type was prolonged 12 h, with a maximal glycerol concentration of 114 g l)1 synthesized by wildtype strain versus 129 g l)1 synthesized by mutant.

cultures in high-phosphate concentration medium. A phosphate-rich medium can provide more phosphate for cell growth and generate more biomass in the medium that leads to an increased dissolved oxygen demand by the yeast cells (Jin et al. 2003). With an insufficient O2 supply, the re-oxidation of NADH becomes restricted and as the cell must maintain its redox balance (Michnick et al. 1997; Wang et al. 2001), some NADH is used to reduce pyruvate or acetyl-CoA, thereby producing more ethanol and lactic acid (Jin et al. 2003). Compared to the wild-type strain, in high-phosphate concentration medium (300 mg l)1), the total biomass of the C. glycerinogenes mutant decreased significantly (Figure 1a). This indicates that glycerol fermentation by the mutant can be carried out in a wider phosphate concentration range without an adequate O2 supply. ctGPD plays an important role in glycerol formation (Chen et al. 1999). High ctGPD activity of the mutant in early glycerol formation phase caused rapid glycerol synthesis and accumulation (Figure 1b) and this is the main reason for the shorter fermentation process. It is suggested that a research should be aimed at enhancing the expression of the gene encoding ctGPD in C. glycerinogenes to further shorten the fermentation process.

Discussion

Acknowledgements

An insufficient O2 supply was the main reason for the low yield of glycerol by the wild-type C. glycerinogenes

This work was supported by Chinese Science and Technology Development grant, 96c-03-03, to J. Zhuge.

456 References Blomberg, A. & Adler, L. 1989 Roles of glycerol and glycerol-3phosphate dehydrogenase(NAD+) in acquired osmotolerance of Saccharomyces cerevisiae. Journal of Bacteriology 171, 1087–1092. Chen, J. & Zhuge, J. 1999 The role of cytoplasmic glycerol 3-phosphate dehydrogenase of Canadida glycerolgenesis on its glycerol overproducing. Journal of Wuxi University of Light Industry 18, 1–6. Guo, X.N., Zhuge, B., Qiu, C.Y. & Zhuge, J. 2002 Screening Candida glycerolgenes mutants with high productivity and fermentation performance of the mutants. Journal of Wuxi University of Light Industry 21, 336–339. Jin, H.R., Fang, H.Y. & Zhuge, J. 2003 By-product formation by a novel glycerol-producing yeast, Candida glycerinoge-

B. Zhuge et al. nes, with different O2 supplies. Biotechnology Letters 25, 311– 314. Michnick, S., Roustan, I.L. & Dequin, S. 1997 Modulation of glycerol and ethanol yield during alcoholic fermentation in Saccharomyces cerevisiae strains over expressed or disrupted for GPD1 encoding glycerol-3-phosphate dehydrogenase. Yeast 13, 783–797. Wang, Z.X., Zhuge, J. & Prior, B.A. 2001 Glycerol production by microbial fermentation: a review. Biotechnology Advances 19, 210–223. Zhuge, J. & Fang, H.Y. 1994 Glycerol production by aerobic fermentation. China Patent CN1110321A. Zhuge, J., Fang, H.Y. & Wang, Z.X. 2001 Glycerol production by a novel osmotolerant yeast Candida glycerinogenes. Applied Microbiology and Biotechnology 55, 686–692.

Springer 2005

World Journal of Microbiology & Biotechnology (2005) 21:457–461 DOI 10.1007/s11274-004-2467-y

Oxidation of carbonyl compounds by whole-cell biocatalyst K.R. Gawai*, P.D. Lokhande, K.M. Kodam and I. Soojhawon Biochemistry Section, Department of Chemistry, University of Pune, Pune 411 007, India *Author for correspondence: Tel.: +91-20-25691728, Fax: +91-20-25691728, E-mail: [email protected] Keywords: Acinetobacter junii, biocatalyst, biotransformation, cytochrome P-450

Summary Acinetobacter junii was found to catalyse the oxidative biotransformation of benzaldehyde, 4-methoxybenzaldehyde, vanillin, 3,4-dimethoxybenzaldehyde, 3-methoxybenzaldehyde and phthalaldehyde within 48 h of incubation. During this process, the activities of drug-metabolizing enzymes, such as cytochrome P-450 and acetanilide hydroxylase were found to be increased significantly. Such an increase in activity indicates their involvement in the biotransformation processes. The purified biotransformed products of each carbonyl compound were characterized by H1 NMR and IR spectroscopy, confirming that oxidation to the corresponding carboxylic acid had occurred.

Introduction Several strategies have been employed for the bioconversions of carbonyl compounds to acids, using purified enzymes, crude extracts or whole cells (Karra-Chaabouni et al. 2003). Zigova´ et al. (2000) have shown the strong oxidative biotranformation potential of Acetobacter, Gluconobacter, Saccharomyces, Hansenula, Pichia, Candida and Kluyveromyces. The enzyme system which catalyses the bioconversions is a three-component mixed function oxygenase, consisting of a cytochrome P-450 reductase, iron–sulphur ferredoxin reductase and a terminal haemoprotein oxidoreductase. The whole system is known as cytochrome P-450. Cytochrome P-450 monoxygenases are a superfamily of haem-containing proteins that universally exist in animals, plants and microorganisms (Guengerich 1991; Maier et al. 2001). They catalyse a wide spectrum of metabolic reactions, such as oxidation, hydroxylation, epoxidation, dealkylation, deamination, sulphoxidation and dehalogenation (Sariaslani 1991; Coon 2003). Cytochrome P-450 proteins are well known to have commercial potential in biotransformation processes. They can be used to introduce functional groups into compounds that would be difficult to modify chemically (Guengerich 2002). The main features of these enzymes which makes them interesting for preparative organic chemistry are their tuneable, chemo-and regio-selectivity and stereo-selectivity. Moreover, the conditions of enzyme-catalysed reactions are usually mild with relatively low energy consumption (Pachlatko 1999). Cytochrome P-450, produced in large quantities from fungal or bacterial sources can also be applied for

degradation of environmentally unfriendly substances (Lee et al. 1998; Linko et al. 1998; Bramucci & Nagarajan 2000; Miles et al. 2000; Shimada et al. 2002; Noworyta & Trusek-Holownia 2004). However, application of cytochrome P-450 enzymes on an industrial scale is limited due to the following reasons. First, cytochrome P-450 proteins require an electron transport chain that consists of two enzymes (a reductase and ferredoxin) and reduced nicotinamide adenine dinucleotide (NADH). Second, unnatural substances that fit loosely in the active site are hydroxylated with poor regioselectivity and require more than one equivalent of NADH for each hydroxylation cycle. Whole cells are usually preferred at industrial scale in order to avoid the problem of cofactor regeneration (Barbieri et al. 2001) and because of their rapid adaptability to the new environments (Handelsman & Lawrence 2002). Acinetobacter junii is widespread in nature and is strictly aerobic. The nutritional properties of A. junii and its ubiquitous occurrence in the soil allow it to use a variety of carbon sources for growth, which can be natural or man-made. Much is known about the oxidative biotransformation of carbonyl compounds by various strains of microorganisms. However, the drawbacks associated with these microorganisms are the inhibition of cell growth and the drug-metabolizing enzyme activity by the acids formed (Zigova´ et al. 2000). Potential improvements are expected from genetic engineering of microorganisms from natural environments with increased ability for environmental and industrial applications (Desouky 2003). For example, p-hydroxybenzoate synthesis is normally done by a Pseudomonas putida mutant (Miller & Peretti 2002).

458 The aim of the present study was to observe the biotransformation of some carbonyl compounds and their effect on drug-metabolizing enzymes like cytochrome P-450 and acetanilide hydroxylase which are key enzymes in the biotransformation processes.

Materials and methods Bacterial culture Acinetobacter junii, obtained from the Department of Microbiology, University of Pune, Pune, India was cultured aerobically in nutrient broth medium (50 ml, pH 7.0) containing (g l)1): yeast extract, 5.0, peptone, 5.0, along with mineral sources (mg l)1): KH2PO4, 170.0, Na2HPO4, 980.0, (NH4)2SO4, 100.0, MgSO4, 4.87, MgO, 0.1, FeSO4, 0.05, CaCO3, 0.20, ZnSO4, 0.08, CuSO4, 0.016, CoSO4, 0.015, H3BO3, 0.006, at 28 C. Substrates Benzaldehyde, 4-methoxybenzaldehyde, vanillin, 3,4dimethoxybenzaldehyde, 3-methoxybenzaldehyde and phthalaldehyde were purchased from Sisco Research Laboratories, India. All chemicals were of the highest purity available. Biotransformation of carbonyl compounds by Acinetobacter junii Biotransformation experiments were performed by adding 600 ll of benzaldehyde, 4-methoxybenzaldehyde, 3-methoxybenzaldehyde and 100 mg of vanillin, 3,4-dimethoxybenzaldehyde and phthalaldehyde to 50 ml of the 24 h-grown bacterial culture (during the log phase), respectively. The conical flasks were placed on a rotary platform incubator shaker at 200 rev min)1 at room temperature for further 48 h. The culture medium of each flask was then centrifuged at 10000 · g for 15 min in a refrigerated centrifuge (Dupont Sorvall RC-5B) to separate the bacterial cell mass. Preparation of cell extracts and enzyme assays The bacterial cells were washed with saline and centrifuged as described above. The microbial pellet was weighed and sonicated in 50 mM Tris-HCl buffer (pH 7.4). The cell extract was centrifuged again at 10000 · g for 10 min at 4 C and the cytosolic fraction was used for enzyme assays. The protein was measured by the Lowry method. The measurement of cytochrome P-450 was carried out using a Shimadzu UV–visible recording spectrophotometer (UV-1601) as described by Omura & Sato (1964). Acetanilide hydroxylase activity was assayed as described by Schenkman et al. (1967). p-Hydroxyacetanilide formed during the hydroxylation was estimated by the procedure of Weisburger & Goodall (1968).

K.R. Gawai et al. Extraction of biotransformed products The supernatant containing the biotransformed products were extracted with ethyl acetate and then dried over anhydrous magnesium sulphate. The solvent was evaporated and the residue was then chromatographed on silica gel. The H1 NMR spectra of the purified samples were determined on Varian Mercury spectrometer (YH 300). The IR spectrum was determined on a Shimadzu FTIR spectrophotometer (FTIR-8400).

Results and discussion Effect of carbonyl compounds on protein content and drug-metabolizing enzymes Studies on the effect of these compounds on cellular protein content of Acinetobacter junii showed that vanillin caused a significant increase (74.6%) in protein content as compared to the control. Marginal increases of 0.3, 7.9, 7.2, 10.7 and 14.5% was observed upon incubation of the culture with benzaldehyde, 4-methoxybenzaldehyde, 3,4-dimethoxybenzaldehyde, 3-methoxybenzaldehyde and phthalaldehyde, respectively. Incubation of the bacterial culture with known concentration of carbonyl compounds, benzaldehyde, 4-methoxybenzaldehyde, vanillin, 3,4-dimethoxybenzaldehyde, 3-methoxybenzaldehyde and phthalaldehyde caused significant increase in the content of cytochrome P-450. The magnitude of increase was 21.4, 33.2, 69.8, 29.5, 28.0, and 47.9% respectively as compared to the control. A significant increase in acetanilide hydroxylase activity, 50.2, 38.4, 19.5, 28.8, 80.6, and 20.0%, was also observed (Figure 1). Characterization of biotransformation products by spectroscopic methods After 48 h of incubation, the biotransformation products were extracted, purified and characterized by spectroscopic methods. The H1 NMR spectrum of the product from benzaldehyde indicated that it had been biotransformed to benzoic acid. The H1 NMR assignment of the product were as follows: 7.605 d (d, 2H, Ar– H), 7.629 d (s, 1H, Ar–H), 8.124 d (d, 2H, Ar–H), 9.418 d (s, broad 1H, COOH, D2O exchangeable) (Figure 2). The IR spectrum having a peak at 3500 cm)1 indicates a hydroxyl group and a peak at 1689.5 cm)1 was of a carbonyl group (Figure 3). The H1 NMR assignment of the product from 4methoxybenzaldehyde was as follows: 7.003 d (d, 2H, Ar–H), 7.810 d (d, 2H, Ar–H), 9.861 d (s, 1H, COOH, D2O exchangeable), 3.800 d (s, 3H, –OCH3). The IR spectral study showed a broad peak at 3355.9 cm)1, indicating the presence of a hydroxyl group. A peak at 1685.7 cm)1 indicated the presence of a carbonyl group. The product was identified as 4-methoxybenzoic acid.

459

Oxidation of carbonyl compounds by whole-cell biocatalyst 200 180 160 140 Protein content (Control =1.37 mg/g cell mass = 100 %)

% content

120 100

Cytochrome P-450 content (Control = 0.34 nmol/mg protein = 100 %)

80

Acetanilide hydroxylase activity (Control = 27.09 nmol of phydroxy acetanilide liberated/ mg protein/min = 100 %)

60 40

phthalaldehyde

3-methoxybenzaldehyde

3,4dimethoxybenzaldehyde

vanillin

4-methoxybenzaldehyde

0

benzaldehyde

20

carbonyl compounds

Figure 1. Effect of carbonyl compounds on protein and drug-metabolizing enzymes. (24 h grown culture of Acinetobacter junii was further incubated with carbonyl compounds for 48 h at 28 C. The cell mass was harvested and sonicated. Protein, cytochrome P-450 content and acetanilide hydroxylase activity were determined from cytosol).

COOH

Figure 2. H1 NMR spectrum of biotransformed product of benzaldehyde (benzoic acid).

460

K.R. Gawai et al.

Figure 3. IR spectrum of biotransformed product of benzaldehyde (benzoic acid).

The H1 NMR assignment of the biotransformed product of vanillin was as follows: 7.399 d (d, 2H, Ar– H) and 7.011 d (s, 1H, Ar–H), 9.796 d and 6.400 d (s, 1H, COOH, OH, D2O exchangeable), 3.946 d (s, 3H, –OCH3). The IR spectrum showed hydroxyl group peaks at 3440.8 and 3764.8 cm)1. A peak at 1722.3 cm)1 indicated the presence of a carbonyl group. From these data, the biotransformed product was identified as vanillic acid. The spectroscopic analysis of the biotransformation of 3,4-dimethoxybenzaldehyde showed that it had been converted to 3,4-dimethoxybenzoic acid. The H1 NMR assignment of the product was as follows: 3.800–4.000 d (s, 6H, –OCH3 · 2), 4.650 d (s, 1H, COOH, D2O exchangeable), 6.900 d (d, 2H, Ar–H), 7.300 d (s, 1H, Ar– H). The peaks at 3440.8 and 1737.7 cm)1 in IR spectrum confirmed the presence of a hydroxyl group and a carbonyl group. The H1 NMR analysis of the product from 3methoxybenzaldehyde indicated that it had been oxidized to 3-methoxybenzoic acid. The H1 NMR assignment of the product was as follows: 7.000–7.700 d (m, 4H, Ar–H), 4.000 d (s, 3H, –OCH3), 9.933 d (s, 1H, COOH, D2O exchangeable). The IR spectral peak at 3500 cm)1 indicated the presence of a hydroxyl group and the peak at 1693.4 cm)1 showed the presence of a carbonyl group. The spectral analysis of the phthalaldehyde oxidation product indicated that this compound had been biotransformed to phthalic acid. The H1 NMR data were as follows: 6.947–7.857 d (m, 4H, Ar–H) and 8.222 d (s, 1H, COOH, D2O exchangeable). The IR spectral studies showed a clear peak of a carbonyl group at 1687 cm)1. Biological synthesis of aromatic compounds possessing unique regio-or stereo-specific features has been shown to be a realistic alternative to traditional chemical methods (Kieslich 1991; Miller & Peretti 2002). Biotransformation by whole cells involves oxygenases that incorporate molecular oxygen directly into the aromatic ring with

high stereo- and regio-specificity; a reaction for which there is no traditional chemical equivalent. In the present studies, all the carbonyl compounds were biotransformed to their corresponding acids within 48 h of incubation with A. junii. These oxidation reactions were demonstrated by H1 NMR and IR studies of the biotransformed product, indicating the involvement of bacterial monooxygenase systems. This is supported by the significant increase in the cytochrome P-450 content. The activity of acetanilide hydroxylase is an oxidative type of reaction, which is an activity of cytochrome P-450 monooxygenases. These carbonyl compounds are inducing hydroxylase activity, which confirms its involvement in oxidation of these aldehydes. The increase in cytochrome P-450 content is due to the inductive effects of these carbonyl compounds on its synthesis (Czekaj & Nowaczyk-Dura 1996, 1999). The increase in the activity of acetanilide hydroxylase is attributed to the induction of a specific isoenzyme of cytochrome P-450 (Naessens & Vandamme 2003). Thus, the present study shows that there is induction of drugmetabolizing enzymes required for the biotransformation of carbonyl compounds by A. junii. In other microorganisms the oxidation products normally inhibit these enzymes, which limits their use as biocatalyst. Moreover, it was observed that monooxygenation reaction by A. junii was not altered by various substituents in the carbonyl compounds. All carbonyl compounds were oxidized to acids without inhibiting the drug-metabolizing enzymes. Our results indicate for the first time the presence of mixed function oxidase systems in A. junii and its ability to biotransform carbonyl compounds.

Acknowledgements The authors would like to acknowledge the assistance provided by Smt. J.P. Choudhary and Mr. A.P. Gadgil.

Oxidation of carbonyl compounds by whole-cell biocatalyst References Barbieri, C., Bossi, L., D’Arrigo, P., Fantoni, G. & Pedrocchi, S.S. 2001 Bioreduction of aromatic ketones: preparation of chiral benzyl alcohols in both enantiomeric forms. Journal of Molecular Catalysis B: Enzymatic 11, 415–421. Bramucci, M.G. & Nagarajan, V. 2000 Industrial wastewater biorectors: sources of novel microorganisms for biotechnology. Trends in Biotechnology 18, 501–505. Coon, M.J. 2003 Multiple oxidants and multiple mechanism in cytochrome P-450 catalysis. Biochemical and Biophysical Research Communications 312, 163–168. Czekaj, P. & Nowaczyk-Dura, G. 1996 Effects of different synthetic steroids combinations on the activity of mixed function oxidase system and on the morphology of rat liver. Experimental and Toxicologic Pathology 48, 82–87. Czekaj, P. & Nowaczyk-Dura, G. 1999 Inhibiting effects of ethinylestradiol/levonorgestrol combination on microsomal enzymatic activities in rat and kidney. European Journal of Drug Metabolism and Pharmacokinetics 24, 243–248. Desouky, A. 2003 Acinetobacter: environmental and biotechnological applications. African Journal of Biotechnology 2, 71–74. Guengerich, F.P. 1991 Reactions and significance of cytochrome P-450 enzymes. Journal of Biological Chemistry 266, 10019–10022. Guengerich, F.P. 2002 Cytochrome P-450 enzymes in the generation of commercial products. Nature Reviews/Drug Discovery 1, 359– 366. Handelsman, J.O. & Lawrence, P.W. 2002 Microbial diversity – sustaining the earth and industry. Current Opinion in Microbiology 5, 237–239. Karra-Chaabouni, M., Pulvin, S., Meziani, A., Thomas, D., Touraud, D. & Kunz, W. 2003 Biooxidation of n-hexanol by alcohol oxidase and catalase in biphasic and micellar systems without solvent. Biotechnology and Bioengineering 81, 29–32. Kieslich, K. 1991 Biotransformations of industrial use. Acta Biotechnologica 11, 559–570. Lee, K.K.B., Poppenborg, L.H. & Stuckey, D.C. 1998 Terpene ester production in a solvent phase using a reverse micelle-encapsulated lipase. Enzyme and Microbial Technology 23, 253–260.

461 Linko. Y-Y., La¨msa¨, M., Wu, X., Uosukainen, E. & Seppa¨la¨, J. 1998 Biodegradable products by lipase biocatalysis. Journal of Biotechnology 66, 41–50. Maier, T., Hans-Heinrich, F., Asperger, O. & Ulrich, H. 2001 Molecular characterization of 56-Kda CYP153 from Acinetobacter sp. EB104. Biochemical and Biophysical Research Communications 286, 652–658. Miles, C.S., Ost, T.W., Noble, M.A., Munro, A.W. & Chapman, S.K. 2000 Protein engineering of cytochrome P-450. Biochimica et Biophysica Acta: Protein structure and Molecular Enzymology 1543, 383–407. Miller Jr. Edward, S. & Peretti, S.W. 2002 Toluene bioconversion to p-hydroxybenzoate by fed-batch cultures of recombinant Pseudomonas putida. Biotechnology and Bioengineering 77, 340–351. Naessens, M. & Vandamme, E.J. 2003 Multiple forms of microbial enzymes. Biotechnology Letters 25, 1119–1124. Noworyta, A. & Trusek-Holownia, A. 2004 Modeling of enzymatic conversion in the catalytic gel layer located on a membrane surface. Desalination 162, 327–334. Omura, T. & Sato, R. 1964 The carbon monoxide-binding pigment of liver microsomes. II. Solubilisation, purification and properties. Journal of Biological Chemistry 239, 2379–2385. Pachlatko, P.J. 1999 Industrial biocatalysis. Chimia 53, 577. Sariaslani, S.F. 1991 Microbial cytochromes P-450 and xenobiotic metabolism. Advances in Applied Microbiology 36, 133–177. Schenkman, J.B., Remmer, H. & Estabrook, R.W. 1967 Spectral studies of drug interaction with hepatic microsomal cytochrome P450. Molecular Pharmacology 3, 113–123. Shimada, Y., Watanabe, Y., Sugihana A. & Tominaga Y. 2002 Enzymatic alcoholysis for biodiesel fuel production and application of the reaction to oil processing. Journal of Molecular Catalysis B: Enzymatic 17, 133–142. Weisburger, J.H & Goodall, C.M. 1968 Stearic inhibition of enzyme reaction. Lack of enzyme hydrolysis of 2,4,6-trimethylacetanilide. Life Sciences 7, 263–267. Zigova´, J., Sˇvitel, J. & Sˇturdı´ k, E. 2000 Possibilities of butyric acid production by butanol oxidation with Gluconobacter oxydans coupled with extraction. Chemical and Biochemical Engineering Quarterly 14, 95–100.

Springer 2005


Regulation of synthesis of endo-xylanase and b-xylosidase in Cellulomonas flavigena: a kinetic study M. Ibrahim Rajoka National Institute for Biotechnology & Genetic Engineering, P.O. Box 577, Faisalabad, Pakistan Fax: +92-(41)-651472, E-mail: [email protected] Keywords:

Carbohydrates, Cellulomonas, induction, lignocellulose, production, regulation, xylanases

Summary Regulation of xylanase, and b-xylosidase synthesis in Cellulomonas flavigena was studied by culturing non-induced cells on mono-, oligo-, and poly-saccharides. The concomitant formation of these enzymes occurred on polysaccharides having structural resemblances with lignocellulosics, namely, cellulose, cellodextrin and xylan. Among disaccharides, cellobiose was the best inducer for their synthesis. Increased levels of enzymes were synthesized by the organism even under repressed conditions. Cell-free supernatants of the organism exhibited greater endo-xylanase than cell-associated b-xylosidase activity. Among inexpensive materials produced on saline lands, the salt tolerant grass Leptochloa fusca supported maximum xylanolytic activities followed by Sesbania aculeate (dhancha). The former could be effectively used for bulk production of xylanolytic enzymes by this organism.

Nomenclature rate of cell mass formation (g cells l)1 h)1) rate of substrate consumption (g substrate l)1 h)1) YX/S cell yield coefficient (g cells g substrate)1) qs specific rate of substrate consumption (g substrate g cells)1 h)1) lmax maximum specific growth rate (h)1) QP rate of enzyme formation (IU l)1 h)1) qP specific rate of enzyme formation (IU g cells)1 h)1) YP/X specific yield of enzyme (IU g cells)1) QEP rate of extracellular protein formation (mg l)1 h)1) QIP rate of intracellular protein formation (mg l)1 h)1) CMC carboxymethylcellulose S. starch soluble starch

Qx Qs

Introduction Lignocellulose, present in abundantly available renewable biomass, consists of three major structural polymers, namely cellulose (a homopolymer of b-D -glucosyl residues), hemicellulose (a group of heteropolymers that include xylans, arabinans, mannans, galactans), and lignin (a complex polyphenolic polymer). Lignocellulose

can be hydrolysed by cellulases, xylanases, arabinases, mannanases and galactanases (Rickard et al. 1981; Thomson 1993) and is a good inducer of these enzymes. Xylanases and cellulases are currently being applied in nutritional improvement of lignocellulosic feedstock for animal feed and food applications, the detergent industry, alcoholic fermentation, and wastewater treatment (Li & Ljungdahl 1994). Cellulase-free xylanases have an important role in reducing consumption of chlorine and chlorine dioxide in the paper and pulp industry (Thomson 1993; Viikari et al. 1994; Nascimento et al. 2002). Bulk production of xylanases from microorganisms is a prerequisite for their use in industrial processes. Gram-positive bacteria are effective secretors and provide promising, industrially relevant alternatives to fungal systems because of high productivity and stability of enzymes (Lopez et al. 1998; Nascimento et al. 2002). Cellulomonas flavigena supports high endo-xylanase productivity (Vega-Estrada et al. 2002) and may foster the development of an efficacious and economical enzyme system for commercial applications. The production of enzymes is influenced by a number of factors, including the growth rate of the organism on suitable substrates, uptake of the substrate, volumetric and specific substrate consumption rates, the induction of the enzyme by a suitable substrate and catabolite repression (Li & Ljungdahl 1994; Ruijter & Visser 1997; de Groot et al. 2003). Preliminary molecular studies

464

M.I. Rajoka

Table 1. Comparative fermentation kinetic parameters of C. flavigena for growth and substrate utilization following growth on different substrates in Dubos salts medium (pH 7.3) at 30 C in shake-flask cultures. Carbon source

Qx (g l)1 h)1)

l

Arabinose Fructose Galactose Glucose Xylose Cellobiose Lactose Maltose Sucrose Dextrin S. starch* CMC Cellulose Xylan

0.21a 0.24a 0.21a 0.24a 0.25a 0.23a 0.11b 0.12b 0.13b 0.14b 0.14b 0.15b 0.21b 0.36b

0.28a 0.17d 0.19c 0.23b 0 .14e 0.19c 0.12ef 0.13e 0.14e 0.12ef 0.11f 0.09g 0.11f 0.12ef

max

(h)1 )

qs (g g)1 h)1)

QIP (mg l)1 h)1)

QEP(mg l)1 h)1)

0.56a 0.35d 0.46b 0. 48b 0.28e 0.39c 0.25efg 0.27ef 0.27ef 0.24efg 0.23fg 0.21g 0.24efg 0.25efg

14.1j 13.5k 16.1f 17.2d 18.5b 18.1c 151h 14.5l 15.5g 16.5e 15.5g 14.5l 15.6g 19.5a

13.8e 12.5i 13.2h 14.7d 13.5f 15.3c 13.3g 12.1k 12.4j 12.5i 13.5f 11.5l 15.5b 16.6a

Each value is a mean of three replicates. Standard deviation among replicates varied between 3–4.5% of average values and has not been presented. Values followed by different letters differ significantly at P £ 0.05.

have indicated that induction of cellulase and xylanase genes is delayed at the level of transcription (Ruijter & Visser 1997; Perez-Gonzalez et al. 1998). Cellobiose, and xylobiose, the primary products of lignocellulose hydrolysis, are believed to be strong inducers of the cellulase/hemicellulase complex as glucose and xylose are liberated slowly (Hrmova et al. 1991) and may not support the formation of Crea A which inhibits transcription (Ruijter & Visser 1997). Information is available about the molecular mechanisms on regulation of xylanases in fungi (Ruijter & Visser 1997; de Vries et al. 1999; de Groot et al. 2003) and bacteria (Spiridonov & Wilson 2000; Bohm & Boos 2004). Saline sodic soils in Pakistan have been effectively utilized to raise salt tolerant grasses, such as Leptochloa fusca (locally called kallar grass), Sesbania aculeata (dhancha), and Panicum maximum. The use of perennial biomass produced on saline lands (Rajoka & Malik 1997) for production of xylanolytic enzymes may enhance the economic efficiency of the biomass production. Kallar grass can yield up to 50 metric ton dry biomass per ha per year (Rajoka & Malik 1997) and could be used for bulk production of xylanases and cellulases. In the present investigation, regulation of the synthesis of xylanolytic enzymes was studied using mono- and di-saccharides, and lignocellulosic substrates with reference to xylan, to establish a relationship of substrate consumption and production of endo-b-xylanase (EC 3.2.1.8) and b-xylosidase (EC 3.2.1.37) by using non-induced cultures of C. flavigena and to select the best carbon source for their production with the kinetics of their regulation.

Materials and methods Sigmacell-100 (Avicel), carboxymethylcellulose sodium salt (CMC), cellulose, p-nitrophenyl b-D -xylopyranoside (p-NPX), xylose, glucose, galactose, sucrose, fructose, maltose, lactose, oat spelt xylan and cellobiose were

from Sigma Chemical Co, St. Louis, MO, USA. All other chemicals were of analytical grade. Leptochloa fusca (kallar grass), Panicum maximum and Sesbania aculeata (dhancha) were collected from the Biosaline Research Substation of the Nuclear Institute for Agriculture and Biology (NIAB), Faisalabad, Pakistan. The dried powder of lignocellulosic biomass was steam alkali-treated as described earlier (Latif et al. 1988). Micro-organism The strain of Cellulomonas flavigena NIAB 441 was obtained from the NIAB culture collection and was maintained on Dubos salt-Avicel plates and slants as described previously (Rajoka & Malik 1997). Enzyme production The ability of the organism to utilize mono- and disaccharides, lignocellulosic substrates and cellulose (Table 1) with reference to xylan was examined in basal Dubos salts medium containing 0.2% yeast extract as described earlier (Rajoka & Malik 1997). Carbon sources were added individually to batches of basal medium to give a carbohydrate level of 10 g l)1. Monomeric and dimeric saccharides were added to the autoclaved medium after filter sterilization. All media were adjusted to pH 7.3 with 1 M NaOH or 1 M HCL and were dispensed in 180 ml aliquots into 1-l Erlenmeyer flasks in triplicate. The time course of production of endo-xylanase and b-xylosidase in shake-flask batch cultures of above media was followed at 30 C on a gyratory shaking incubator at 150 rev/min. The amount of growth was measured gravimetrically as dry cell mass. The enzyme activity present in the cell free supernatant (endo-xylanase) or cell extract (b-xylosidase) was assayed periodically as the induction or repression indicator. When the organism was grown on insoluble substrates, the fermentation broth was centrifuged (4000 x g, 15 min) to remove

Induction of xylanases in a Cellulomonas sp. particulate material. The substrate was washed twice with saline and dried to assay unutilized substrate in the culture broth. Clear supernatant from culture broth (insoluble substrate free) was obtained by centrifugation (15,000 x g, 30 min at 4 C). The cell pellet was used to extract cellular fractions using an ultrasonicator as described previously (Rickard et al. 1981). An aliquot of 100 ml (after a low-speed centrifugation step) was also centrifuged (15,000 x g, 30 min). The cell free supernatant was preserved for enzyme assays and the cell pellet was washed twice with saline, suspended in 10 ml distilled water and dried at 70 C to constant mass.

465 phase. Intracellular (QIP) or extracellular protein (QEP) productivity (mg protein l)1 h)1) was determined from a plot of intracellular or extracellular protein (mg l)1) vs. time (h). Statistical analysis Treatment effects were compared by the protected least significant difference method. Significance of difference has been presented as ANOVA –2 in the form of probability (P) values using MStatC software version 3.1 (MStat Director, Crop and Soil Science Department, Michigan State University, Michigan, USA).

Enzyme assays Endo 1,4-b-D -xylanase activity was assayed according to Bailey et al. (1992) by incubating the diluted enzyme solution at 40 C for 5 min using 1% (w/v) crystalline oat spelt xylan in 50 mM sodium acetate buffer (pH 7.0). The reducing sugars were assayed by adding 3 ml of 3, 5-dinitrosalicylic acid reagent, boiling for 5 min, cooling, and measuring the absorbance at 540 nm (Miller 1959) against xylose as standard. One IU was defined as the amount of enzyme releasing 1 lmol reducing sugar ml)1 min)1 under the assay conditions. b-Xylosidase was assayed using 1 mM p-nitrophenylb-D -xylopyranoside as substrate in 50 mM sodium acetate buffer, pH 7.0. One millilitre of the properly diluted enzyme sample was incubated with 1 ml substrate solution at 40 C for 10 min. The reaction was stopped by adding 1 M sodium carbonate (2 ml). The liberated p-nitrophenol was measured at 400 nm with a spectrophotometer. The units are international units and were defined as described previously (Rajoka et al. 1997). Protein determination The proteins were determined by the Lowry method using bovine serum albumin as the standard. Saccharides determination Glucose was periodically measured by commercial glucose kit. Polysaccharides were determined as described by Miller (1959). Cellulose and hemicellulose were determined as described previously (Latif et al. 1988). Determination of kinetic parameters Kinetic parameters for batch fermentation process (Rajoka & Malik 1997) were determined as described previously (Lawford & Rouseau 1993). Volumetric rate of substrate utilization (QS) , cell mass formation (QX) and enzyme production (QP), were maximum slope values of substrate (g l)1), cell mass (g l)1) and enzyme ((IU l)1) vs. time of fermentation (h). Specific product formation rate (qP) was multiple of lmax and specific product yield (YP/X). Maximum specific growth (lmax) was calculated from the growth curve in the exponential

Results and discussion Extensive screening of potential xylanase inducers (Table 1) showed that when non-induced cultures of Cellulomonas flavigena were grown on monosaccharides, the strain had a shorter lag period and higher maximum specific growth rate than on disaccharides and polysaccharides. All monomeric saccharides induced the cells to produce endo-xylanase and b-xylosidase significantly (P £ 0.05) lower than those cells induced with xylose. All saccharides induced b-xylosidase to a measurable level, otherwise, (in some cases) only a low level of endo-xylanase or b-xylosidase (Table 2) was produced. This activity represents the basal level necessary for cellular metabolism. The cultures were grown in time course studies to determine the minimum time for induction, other kinetic parameters and biosynthesis of enzyme and cell mass; optimum time was 56–72 h while the lag phase was 4 h before the xylanase activities increased appreciably. The organism grown in Dubos salt medium for different time intervals was processed for substrate, cell mass and assays of endo-xylanases and b-xylosidase (Tables 1–3). The enzyme was produced using 2% saccharides present in the substrate or equivalent saccharides as described in Materials and Methods. Enzyme production, cell mass biosynthesis and substrate utilization kinetics of representative substrates namely cellulose (a), cellobiose (b), xylose (c) and xylan (d) under the conditions of shakeflask cultures are shown in Figure 1. Maximum cell mass was supported by xylan. a-Cellulose as well as xylan were also easily degraded and supported higher intracellular (QIP) and extracellular (QEP) protein productivities (Table 1) and they were significantly (P £ 0.05) higher than from those on other carbon sources (Table 1). In general, monosaccharides were strong repressors while disaccharides and polysaccharides acted as inducers. It has been observed by other workers (Li & Lujngdhl 1994) that during growth on monosaccharides, a very low amount of mRNA for enzyme is produced. Other workers have found that CreA modulates the expression of xylanases on xylose or glucose in Aspergillus niger (de Vries et al. 1999). The efficacy of inducers can be determined by both their

466

M.I. Rajoka

Table 2. Production of endo-xylanase and b-xylosidase by C. flavigena measured as specific product yield (YP/X, IU g cells)1), and enzyme productivity, Qp (IU l)1 h)1) following growth on different substrates in Dubos culture medium at 30 C. Growth substrate

Arabinose Fructose Galactose Glucose Xylose Cellobiose Lactose Maltose Sucrose Dextrin S. starch* CMC -cellulose Xylan

Parameters for xylanase

Parameters for b-xylosidase

QP(IU l)1 h)1)

YP/X(IU g cells)1)

Titre(IU l)1)

QP(IU l)1 h)1)

YP/X(IU g cells)1)

Titre(IU l)1)

13d 6d 4d 1d 67c 90b 12d 12d 2.3d 97b 65c 70c 108b 440a

61fg 24g 4g 1g 268e 391d 105f 101f 18g 693b 464c 467c 514c 1222a

1250f 1250f 1250f 400f 6667de 7500cd 1250f 1250f 250f 9750b 6000e 8133c 9333b 33125a

2.8fg 2.65f 0.49f 0.4g 3.10fg 5.21ef 3.21fg 2.10g 1.55g 8.57d 7.12de 12.3c 26.6b 63.0o

13.38h 11.0h 2.3.3i 1.60i 13.5gh 29.65g 22.20fg 17.50gh 11.92h 61.21d 50.86e 82.00c 126.7b 175.00a

275ef 250ef 38gh 25h 213efg 363e 263ef 188efgh 125fgh 650d 575d 1063c 2138b 4025a

Each value is a mean of three replicates. Standard deviation among replicates varied between 5–7.5% of average values and has not been presented because of their very low values. Values followed by different letters differ significantly at P £ 0.05. Table 3. Production of endo-xylanase and b-xylosidase by C. flavigena measured as specific product yield (YP/X, IU g cells)1), and enzyme productivity, Qp (IUl)1h)1) following growth on different substrates in Dubos culture medium at 30 C. Growth substrate

Parameters for xylanase

Parameters for b-xylosidase

)1

)1 )1

YP/X (IU g cells ) QP(IUl h ) Dhancha straw 1371 ± 140c Kallar grass straw 1496 ± 154b P. maximum 824 ± 63d Xylan 2131 ± 215a

356 378 206 440

± ± ± ±

17c 18b 11d 22a

)1

Titre(IUl )

YP/X(IU g cells)1)

21300c 28300b 12800d 33130d

73 112 59 175

± ± ± ±

80c 13b 4d 18a

QP(IUl)1h)1)

Titre(IUl)1)

13 ± 0.7c 19 ± 1b 9.0 ± 1d 31 ± 2.5a

2679c 3576b 2357d 4025d

Values are means of three sets of replicates. Values with different letters differ significantly at P £ 0.05. The effect of treatments on all kinetic parameters is highly significant as determined by DMRT using Duncan multiple range test in MstatC software.

actual concentration inside the cell and their binding affinity to regulatory macromolecules (Perez-Gonzalez 1998; La Grange et al. 2000, 2001; de Groot et al. 2003; Bohm & Boos 2004). Specific enzyme yield (YP/X) was 268 and 391 IU g cells)1 on xylose and cellobiose respectively, and only 1.0 IU g cells )1 (as basal enzyme activity) on glucose (non-inducer). The induction ratio, defined as the ratio of activity in the presence of inducers to basal activity, was 4 to 1222. The higher the ratio, better was the carbon source to support enhanced endoxylanase production. Best yield of b-xylosidase (Table 2) was obtained when xylose was used as monomeric sugar in the Dubos medium. Among disaccharides, cellobiose was the best inducer of b-xylosidase. Among polymeric substances, xylan was the best substrate followed by cellulose. These results are of considerable significance for the further development of suitable large-scale production process based on selection of inducers for optimal production of xylanase and b-xylosidase by C. flavigena. Production of xylanase in different media containing various insoluble substrates The use of commercial xylan as feedstock is uneconomical for large-scale production of endo-xylanase and

b-xylosidase, therefore, several renewable substrates raised on saline land (Table 3) were included in these studies. The potential of the C. flavigena strain to produce xylanolytic enzymes and cell mass in shaken batch culture was tested by growing non-induced cell on Dubos-culture media containing lignocellulosic substrates, with reference to xylan (Table 3). Maximum cell mass formation (Table 4) rates on complex polysaccharides indicate the potential of the organism to degrade complex substrates. C. flavigena exhibited 1.76- and 1.64fold greater Qp following growth on kallar grass medium than that on dhancha or P. maximum medium. Maximum YP/X, or QP of endo-xylanase (Table 3) was several-fold improved over those from some other bacterial cultures (Okeke & Paterson 1992) and fungal strains (Milagres et al. 1993; Duenas et al. 1995; Kalogeris et al. 2003; Kang et al. 2004), fungal mutant strain NTG-19 of Fusarium oxysporum mutant (296.7 IU l)1 h)1) (Singh et al. 1995) and compared favourably with values from Cellulomonas CS1-1 and its mutant derivatives (Sinner & Preslmayer 1992), a hyperxylanaseproducing mutant Trichoderma reesei QM 9414 (436 IU l)1 h)1), Penicillium janthinellum (467.7 IU l)1 h)1) grown on xylan (Milagres et al. 1993), and A. nidulan recombinants harbouring xylanase genes from A. niger (LaGrange et al. 2001). The possibility of using

Induction of xylanases in a Cellulomonas sp.

467

Figure 1. Kinetics of endo-xylanase and b-xylosidase production in shake flask fermentation of four representative substrates namely (a) cellulose, (b) cellobiose, (c) xylose, and (d) xylan (each 1%) using Dubos optimized medium. The initial pH of the medium was 7.3, inoculum size 10%, and temperature 30 C: o = xylanase, D= b-xylosidase activity IU per 5 ml, = cell mass (g p)1 l) and = [S] substrate (g p)1 l). Error bars represent standard deviation among three replicates.

Table 4. Fermentation kinetic parameters of C. flavigena for substrate utilization and growth following growth on different substrates in Dubos salts medium (pH 7.3) at 30 C in shake-flask cultures. C.source

Qx(g l

Cellobiose Dhancha K. grass P. maximum Xylan

0.231a 0.147c 0.147c 0.143d 0.178b

)1

h)1)

R.S*(mg l)1 )

qS(g g

45d 82b 78c 95a 36e

0.39a 0.25c 0.27b 0.27b 0.12e

)1 )1

h )

QIP(mg l 125b 103e 116c 109d 143a

)1

h)1)

QEP(mg l

)1

h)1)

112d 132g 130c 109e 156a

Each value is a mean of three replicates. Standard deviation among replicates varied between 3–4.5% of mean values. Values followed by different letters differ significantly at P £ 0.05. *R.S. stands for reducing sugars in the fermentation medium.

locally available substrates (Table 3) for enzyme production was promising in that kallar grass and dhancha medium induced the cells to yield xylanase to a level of 0.7th and 0.64th of that induced by xylan.

Production of b-xylosidase from different media Studies performed to measure the potential of C. flavigena to produce b-xylosidase during growth on culture media containing different substrates (Table 4) indicated that xylan was a significantly (P £ 0.05) better carbon source, followed by kallar grass. During growth on xylan, the specific product yield (YP/X) and volumetric productivity are significantly higher than those of

Cellulomonas CS1-17 (Rickard et al. 1981), Bacillus stearothermophilus (Nanmori et al. 1990), fungal strains (Milagres et al.1993; Kang et al. 2004) and were comparable with several Saccharomyces cerevisiae recombinants harbouring heterologous genes of b-xylosidase from Aspergillus niger (La Grange et al. 2000, 2001), A. nidulans and its recombinants harbouring bxl D gene (Perez-Gonzalez et al. 1998). During growth of the organisms on different cellulosic and ligocellulosic substrates, reducing sugars accumulated slowly in the growth medium as unmetabolized substances (Table 4) and induced (probably due to inhibition of CreA protein production; Ruijter &Visser 1997) both endo-xylanase and b-xylosidase, but expression depended inversely on their concentration.

468

M.I. Rajoka the regulatory effect of global nitrogen metabolism regulator, AreA (Lockington et al. 2004) on NO 3 or NHþ ions in the growth medium. 4 Effect of pH and temperature The optimum pH for the production of both endoxylanase and b-xylosidase was 7.3 (Figure 2) and was the third factor which regulated the product formation and confirmed the work of Orejas et al. (1999). Maximum volumetric productivity (QP) of endo-xylanase and bxylosidase occurred at fermentation temperature of 30 C (Figure 3). The optimum temperature was in good agreement with the reported values for Cellulomonas spp. (Rajoka et al. 1997; Rickard et al. 1981).

Figure 2. Effect of pH of the fermentation medium on maximum volumetric productivity of endo-xylanase (o) and b-xylosidase (D) during growth of the organism on xylan (1%). The organism was grown using Dubos optimized medium. The initial pH of the medium was varied while fermentation temperature was regulated at 30 C.

Figure 3. Effect of temperature on maximum volumetric productivity of endo-xylanase (o) and b-xylosidase (D) during growth of the organism on xylan (1%) medium (pH 7.3). The organism was grown in optimized Dubos salt medium (initial pH 7.3) at different temperatures.

Conclusion Xylan was the best carbon source followed by kallar grass but xylan is an expensive substrate, therefore, kallar grass could be used for commercial production of endo-xylanase and b-xylosidase. The highest enzyme production level occurred at 30 C, and pH 7.3. The maximum volumetric productivities of xylanolytic enzymes were significantly higher than the values reported by some other workers. These values suggest that this organism can serve as a good source of xylanases, particularly when cultured on inexpensive substrates. We have recently isolated a deoxyglucoseand rifampicin-resistant mutant of C. biazotea (Rajoka et al. 1998) which hyper-produced xylanases. This organism is amenable to mutagenesis as well. Highmolecular weight oligomers that accumulate as products of metabolic activity (Huang & Chou 1990) or hemicellulose hydrolysate of lignocellulosic biomass that accumulate as products of pretreatment act as inducers probably by interfering with the CreA-DNA interaction as reported earlier (Ruijter & Visser 1997; de Vries et al. 1999; Bohm & Boos 2004). It is concluded that this organism can be exploited for bulk production of xylanases as reported by other workers (Vega-Estrada et al. 2002).

Effect of nitrogen sources on production of xylanases Acknowledgements In C. flavigena, the effect of nitrogen sources was tested by replacing NaNO3 in the medium with other compounds while maintaining equimolar amount of nitrogen at 0.246 g l)1. The cultures were grown for 72 h, harvested and processed for enzyme assays. Readily available nitrogen sources including NH4Cl, (NH4)2 SO4, NH4H2PO4 were not good sources as they lowered the terminal pH. Slowly available sources namely corn steep liquor and urea supported lower synthesis of both xylanases, though the terminal pH was neutral. NaNO3, KNO3 and NH4NO3 were the best nitrogen sources, because the terminal pH was 7.5–7.8. Thus in the absence of pH regulation, NaNO3 and KNO3 were the best nitrogen sources. This may have occurred due to

This work was supported by the Pakistan Atomic Energy Commission. Some chemicals were purchased from funds allocated by the United States Agency for International Development, Washington D.C., USA under PSTC Proposal 6.163. Mr G. Rasul is thanked for assistance in computer graphics. The technical assistance of R. Shahid is gratefully appreciated. References Aiba, S., Humphrey, A.E. & Millis, N.F. 1973 Biochemical Engineering, 2nd Edn. New York: Academic Press. pp. 92–127. ISBN : 0-12-045052-6.

Induction of xylanases in a Cellulomonas sp. Bailey, M.J., Biely, P. & Poutanen, K. 1992 Inter-laboratory testing of methods for assay of xylanase activity. Journal of Biotechnology 23, 257–270. Bailey, M.J. & Viikari, L. 1993 Production of xylanases by Aspergillus fumigatus and Aspergillus oryzae on xylan based media. World Journal of Microbiology and Biotechnology 9, 840–845. Bohm, A. & Boos, W. 2004 Gene regulation in prokaryotes by sub cellular relocalization of transcription factors. Current Opinion in Microbiology 7, 151–156. de Groot, M.J., van de Vondervoort, P.J., de Vries, R.P., van Kuyk, P.A., Ruijter, G.J. & Visser, J. 2003 Isolation and characterization of two specific regulatory Aspergillus niger mutants shows antagonistic regulation of arabinan and xylan metabolism. Microbiology 149, 1183–1191. de Vries, R.P., Visser, J. & de Graaff, L.H. 1999 CreA modulates the XlnR-induced expression on xylose of Aspergillus niger genes involved in xylan degradation. Research in Microbiology 150, 281–285. Duenas, R., Tengerdy, R.P. & Gutierrez-Corea, M. 1995 Cellulase production by mixed fungi in solid-substrate fermentation of bagasse. World Journal of Microbiology and Biotechnology 11, 333–337. Hrmova, M., Petrakova, E. & Biely, P. 1991 Induction of celluloseand xylan-degrading enzyme systems in Aspergillus terreus by homo- and hetero-disaccharides composed of glucose and xylose. Journal of General Microbiology 137, 541–547. Huang, S.Y., & Chou, M. S. 1990 Kinetic model for microbial uptake of insoluble solid state substrate. Biotechnology and Bioengineering 35, 541–547. Kalogeris, E., Iniotaki, F., Topakas, E., Christakopoulos, P., Kekos, D. & Macris, B.J. 2003 Performance of an intermittent agitation rotating drum type bioreactor for solid state fermentation of wheat straw. Bioresource Technology 86, 207–213. Kang, S.W., Park, Y.S., Lee, J.S., Hong, H.I. & Kim, S.W. 2004 Production of cellulases and hemicellulases by Aspergillus niger KK2 from lignocellulosic biomass. Bioresource Technology 91, 153–156. La Grange, D.C., Pretorius, I.S., Claeyssens, M. & van Zyl, W.H. 2001 Degradation of xylan to D-xylose by recombinant Saccharomyces cerevisiae co-expressing the Aspergillus niger beta-xylosidase (xlnD) and the Trichnoderma reesei xylanase ii (xyn2) genes. Applied and Environmental Microbiology 67, 5512–5519. Latif, F., Puls, J. & Malik, K.A. (1988) Effect of alkali pretreatment on the enzymatic hydrolysis of plants grown in saline lands. Biomass 17, 105–114. Lawford, H.G. & Rousseau, J.D. (1993) Mannose fermentation by ethanologenic recombinants of Escherichia coli. Biotechnology Letters 15, 615–620. Li, X.-L. & Ljungdahl, L.G. (1994) Cloning, sequencing, and regulation of a xylanase gene from the fungus Aureobasidium pullulans Y-2311-1. Applied and Environmental Microbiology 60, 3160–3166.

469 Lopez, C., Blanko, A. & Pastor, F.I.J. 1998 Xylanase production by a new alkali-tolerant isolate of Bacillus. Biotechnology Letters 20, 243–246. Milagres, A.M.F., Lacis, L.S. & Prade, R.A. 1993 Characterization of xylanase production by a local isolate of Penicillium janthinellum. Enzyme and Microbial Technology 15, 248–253. Miller, G.L. 1959 Use of dinitrosalicylic acid (DNS) for determination of reducing sugars. Analytical Chemistry 31, 426–428. Nanmori, T., Watanabe, T., Shinke, R., Kohno, A. & Kawamura, Y. 1990 Purification and properties of thermostable xylanase and b-xylosidase produced by a newly isolated Bacillus stearothermophillus strain. Journal of Bacteriology 172 , 6669–6672. Nascimento, R.P., Coelho, R.R., Marques, S., Alves, L., Girio, F.M., Bon, E.P.S. & Amaral-Collaco, M.T. 2002 Production and partial characterization of xylanase from Streptomyces sp. strain AMT-3 isolated from Brazilian cerrado soil. Enzyme and Microbial Technology 31, 549–555. Okeke, B.C. & Paterson, A. 1992 Simultaneous production and induction of cellulolytic and xylanolytic enzymes in a Streptomyces sp. World Journal of Microbiology and Biotechnology 8, 483–487. Orejas, M., MacCabe, AP., Perez-Gonzalez, J.A., Kumar, S. & Ramon, D. 1999 Carbon catabolite repression of the Aspergillus nidulans xlnA gene. Molecular Microbiology 31, 177–184. Perez-Gonazalez, J.A., van Peij, N.N., Bezoen, A., MacCabe, A.P., Ramon, D. & de Graff, L.H., 1998 Molecular cloning and transcriptional regulation of the Aspergillus nidulans xynD gene encoding a beta-xylosidase. Applied and Environmental Microbiology 64, 1412–1419. Rajoka, M.I. & Malik, K.A. 1997 Cellulase production by Cellulomonas biazotea cultured in media containing different cellulosic substrates. Bioresource Technology 59, 21–27. Rajoka, M.I., Bashir, A., Hussain, M.-R.A. & Malik, K.A. 1998 Mutagenesis of Cellulomonas biazotea for improved production of cellulases. Folia Microbiologica 43, 15–22. Rickard, P.A.D., Ide, J.A. & Rajoka, M.I. 1981 Glycosidases of Cellulomonas. Biotechnology Letters 3, 487–492. Ruijter, G.J. & Visser, J. 1997 Carbon repression in aspergilli. FEMS Microbiology Letters 151, 103–114. Sinner, M. & Preslmayer, W. 1992 Chlorine is out, bring in enzymes. PPI September 1992, 87–89. Spiridonov, V.A. & Wilson, D.B. 2000 A CelR mutation affecting transcription of cellulase genes in Thermobifida fusca. Journal of Bacteriology 182, 252–257. Thomson, J.A. 1993 Molecular biology of xylan degradation. FEMS Microbiology Reviews 104, 65–82. Vega-Estrada, J., Flores-Cotera, L.B., Santiago, A. & Magana-Plaza, I. 2002 Draw-fill batch culture mode for the production of xylanases by Cellulomonas flavigena on sugar cane bagasse. Applied Microbiology and Biotechnology 58, 435–438. Viikari, I., Kantelinen, A., Sundquist, J. & Linko, M. 1994 Xylanases in bleaching: from an idea to the industry. FEMS Microbiology Reviews 13, 335–350.


Springer 2005

Improved productivity of b-fructofuranosidase by a derepressed mutant of Aspergillus niger from conventional and non-conventional substrates M.I. Rajoka* and Amber Yasmeen National Institute for Biotechnology and Genetic Engineering, P.O. Box 577, Jhang Road, Faisalabad, Pakistan *Author for correspondence: Tel.: +92-41-651475/550815, E-mail: [email protected] Keywords: Aspergillus niger, derepressed mutant, enzyme, b-fructofuranosidase, kinetics, productivity

Summary Wild-type cultures of Aspergillus niger produced a basal level of b-fructofuranosidase on glucose of 1 IU l)1 h)1. In contrast, a catabolite-derepressed mutant strain of the same organism produced a markedly higher level (25 IU l)1 h)1) of this enzyme when grown on the same carbon source. Wheat bran induced both the wild type (252 IU l)1 h)1) and the mutant strain (516 IU l)1 h)1) to produce 252- to 516-fold higher levels of this enzyme than was observed with the wild-type grown on glucose and was the best carbon source. When corn steep liquor served as a nitrogen source, the wild-type organism showed a higher activity of enzyme on monosaccharides and disaccharides comparable to that produced by corncobs in the basal medium and that mutant was a potentially improved (>2-fold) organism for the production of b-fructofuranosidase on all carbon sources. Enhanced substrate consumption and product formation kinetic parameters suggest that the mutant organism may be exploited for bulk production of this useful enzyme.

Nomenclature specific rate of growth (h)1) rate of cell mass formation (g cells l)1 h)1) rate of substrate consumption (g substrate l)1 h)1) YX/S cell yield coefficient (g cells g)1 substrate) QP rate of enzyme formation (IU l)1 h)1) YP/X specific yield of enzyme (IU g)1 cells) YP/S product yield of enzyme (IU g)1 cells) CMC carboxymethylcellulose l QX QS

Introduction b-Fructofuranosidase or invertase (EC 3.2.1.26) catalyses the conversion of sucrose into fructose and glucose by recognizing the fructose moiety of sucrose. It is being extensively applied in the confectionery, food and pharmaceutical industries (Hayashi et al. 1992). Several cultures possess the ability to produce intracellular/ extracellular or mainly extracellular invertase (Hayashi et al. 1992; Roberfroid 1993; Muramatsu & Nakakuki 1995; Euzenat et al. 1997; Yun 1998). For industrial production of b-fructofuranosidase, it is imperative to screen organisms for invertase activity higher than those reported. For this purpose it is also necessary to find cheaper inducers among the nonconventional substrates that potential producer

organisms can consume for growth, and to optimize cultural conditions for growth and enzyme production. Sucrose is the best inducer for invertase biosynthesis (Hayashi et al. 1992) but its production from agricultural and forest residues, municipal solid wastes, energy crops, or other forms of lignocellulosic biomass could improve the economics of b-fructofuranosidase (Ffase) production. The production of enzymes is influenced by induction and catabolite repression (de Groot et al. 2003). Carbon catabolite repression alters transcription and is regulated by the CreA protein, a transcriptional repressor of glucose-repressible genes involved in metabolic processes other than those involving glucose (de Vries et al. 1999). Cellobiose, and xylobiose, the primary products of lignocellulose (LC) hydrolysis, are believed to be strong inducers of the hydrolases as glucose and xylose are liberated slowly (Hrmova et al. 1991) and may not support the formation of CreA (de Vries et al. 1999). Information is available about the molecular mechanisms of regulation of hydrolases (xylanases) in fungi (de Vries et al. 1999; de Groot et al. 2003) and bacteria (Bohm & Boos 2004). Aspergillus niger produces extracellular b-fructofuran osidase in both submerged and solid state fermentation (Yanai et al. 2001). It has been shown to undergo catabolite repression by monomeric carbohydrates (Hanif et al. 2004). Increases in Ffase expression and redirection of transport system in this organism will

472 enhance substrate utilization and product formation. Sucrose utilization requires a SUC locus and transcription of the structural genes for permeases which are induced by sucrose and catabolite-repressed by glucose (Rincon et al. 2001). 2-Deoxy-D-glucose (DG), a toxic glucose analogue, has frequently been employed to isolate glucose-deregulated mutants (Rajoka et al. 1998; Haq et al. 2001). In this work we report the isolation of a derepressed and aspartate-requiring mutant of this organism in which two-fold higher levels of Ffase were achieved and to establish the optimal culture conditions. This mutant, deregulated for Ffase is not subject to recombinant DNA technology regulations, has been stable for the last three years and ferments carbon sources faster than the wild type.

Materials and methods Organism Aspergillus niger NIAB 280 was maintained in our culture collection and was used throughout these studies. The strain was maintained on potato-dextrose agar plates and slants as described earlier (Siddiqui et al. 1997). Chemicals and growth media All chemicals were purchased from Sigma Chemical Co., Missouri, USA. Aspergillus niger was grown in glucosesalt medium supplemented with 0.2% yeast extract (Siddiqui et al. 1997) containing acid-washed glass beads. The latter were added to achieve uniform turbidity. The initial pH of the medium was adjusted to 6.5 with 1 M HCl. For other growth studies, the seed culture developed on glucose was used as inoculum and washed twice with sterile saline before use. This inoculum was used to study the influence of other carbon sources, (mentioned in the text and in tables) on invertase synthesis. Substrates and their preparation All lignocellulosic substrates were obtained from local sources. Their dry powder was alkali treated as described earlier (Rajoka et al. 1998). The treated biomass of rice husk and corn cobs had 84 ± 1.2 and 81 ± 1.5% total saccharides respectively, determined using standard methods (Latif et al. 1994). Isolation of mutants A. niger cells were cultured in Vogel-yeast extract-glucose culture medium at 30 C for 20 h, centrifuged (15,000 · g, 15 min), and suspended in 50 ml of biological saline containing 0.01% yeast extract. The cells of 3.0 attenuance (at 610 nm) were dispensed equally in 30 ml McCartney vials. The cells were exposed to different doses of

M.I. Rajoka and A. Yasmeen c-rays in a Co-60 irradiator. The exposure of cell suspension (2 · 109 cells per ml) to c-irradiation of 1200 Gy gave approximately a 3 log reduction in colony-forming units. The irradiated cells were allowed to express in the presence of 150 lg aspartate (asp) ml)1 + 0.6% deoxyglucose (DG) medium to isolate asp) and simultaneously derepressed mutants as described earlier (Haq et al. 2001). The serial dilution of expressed cells were plated on DYE-sucrose-DG-asp-oxgal (added to restrict growth) selection plates to give approximately 30 colonies per plate. Overall 3000 different colonies were screened for mutant selection. The selected colonies were subsequently replica-plated on sucrose + DG (0.6% w/v) + asp agar plates. The colonies were individually flooded with glucose oxidase reagent and colonies surrounded by a pink halo were picked and screened by measuring the diameter of pink halo around each colony. One mutant strain produced substantially higher Ffase and was designated A. niger M125. The enzyme secretion was tested in the presence of increasing concentrations (2, 4, 5, 6, 8, 10% w/v) of glycerol. Batch-culture studies The ability of the organism to utilize rice husk, corn cobs, wheat bran, rice bran, monosaccharides and disaccharides for improved production of Ffase with reference to sucrose was examined in basal Vogel salts’ medium containing 0.2% yeast extract and 0.2% (v/v) Tween 80 as described earlier (Hanif et al. 2004). Carbon sources were added individually to batches of basal medium to give a saccharide level of 20 g)1 (found to be optimum). All media were adjusted to pH 6.5 with 1 M NaOH or 1 M HCl and were dispensed in 50 ml aliquots into 250-ml Erlenmeyer flasks in triplicate. The time course (Figure 1) of Ffase production in shake-flask batch cultures was carried out at 30 C in a gyratory shaker (150 rev min)1). Sample flasks in triplicate were withdrawn after predetermined time intervals (h) and processed. The amount of growth, reducing sugars released from polysaccharides, protein production and extracellular enzyme activities were assayed. When the test organism was grown on insoluble substrates, the culture medium after growth was passed through two layers of cheese cloth to remove substrate. The residue was shaken vigorously with chilled water containing 1% (v/v) Tween 80 for 30 min at 4 C. The washed substrate was oven-dried to constant weight for further processing. Clear supernatant was obtained by centrifugation (15,000 g, 15 min) of the above filtrate. The cell-free supernatant was preserved for enzyme assays and cell pellets were washed twice with saline, suspended in 10 ml distilled water and dried at 70 C to constant weight. Enzyme assays To 1 ml of 0.16 M sucrose and 1 ml McIlvaine buffer (0.15 M, pH 5.5) mixture, 100 ll of appropriately

473

b-fructofuranosidase from different substrates

Figure 1. b-Fructofuranosidase (Ffase) (o), and cell mass (4) production kinetics of Aspergillus niger M125 in fermentation of cellobiose (a) sucrose, (b) a-cellulose, (c) and wheat bran in shake-flask cultures (150 rev min)1) in Vogel’s medium (initial pH 6.5, temperature 30 C) containing above substrates (?). Error bars show standard deviation among three replicates.

diluted invertase solution was added. The reaction mixture was agitated at 50 C for 30 min in a shaking water bath. The 50 ll reaction mixture was added to 950 ll distilled water and boiled for 10 min to inactivate the enzyme. The amount of glucose formed was determined using glucose oxidase kit and reducing sugars were assayed after Miller (1959) using 3,5-dinitrosalicylic acid. One unit of enzyme activity is defined as the amount of enzyme which releases 1 lmol invert sugar per min. Saccharide determination In these tests, reducing sugars were estimated colorimetrically with 3,5-dinitrosalicylic acid after Miller (1959) using glucose as standard. Glucose was determined using Human (Germany) glucose kit following instructions of the suppliers. Protein determination Protein was determined by the Lowry method using bovine serum albumin as the standard. The protein content in the substrate and the spent dry matter was determined by multiplying the nitrogen content determined by Kjeldahl’s method by 6.25.

Effect of varying pH and temperature on enzyme production The effect of initial pH of the fermentation medium on enzyme production parameters was studied in shake flasks by varying the pH (5.0–9.0) and maintaining optimum temperature and other growth-supporting conditions. For studying the effect of temperature, the experiments were repeated in shake flasks (250 ml each) and incubated in an orbital shaker (150 rev min)1) at either 20 to 38 C for up to a period of 96 h. The enzyme preparations were analysed for enzyme activities as described earlier. Determination of kinetic parameters Dry cell mass (g l)1) of A. niger, after growth on different carbon sources, in time course study, was determined on triplicate samples and each sample was analysed twice. Enzyme activities (IU ml)1) were determined as mentioned earlier in this section. The maximum volumetric substrate uptake rate (QS ), cell mass formation rate (QX ) and enzyme production rate (QP ), and other kinetic parameters were estimated as described previously (Aiba et al. 1973) as maximum slope values of curves between substrate, cell mass and product in the fermentation mash versus time of

474

M.I. Rajoka and A. Yasmeen

fermentation (h). Product yield coefficient (YP/S, product formed per g substrate consumed) was calculated by application of YP=S ¼ dP =dS .while specific product yield was calculated using YP=X ¼ dP =dX .

Results and discussion Improvement in enzyme secretion by c-ray mutagenesis was sought as described in Materials and methods. Eight mutant colonies with well-developed zones of pink colour on sucrose-agar plates were identified. Semiquantitative plate studies revealed that one derivative capable of producing the largest amount of invertase could be isolated and designated. A. niger M125 for enzyme production studies in vitro. The organism was recovered from the replica plate and its Ffase activities were monitored in plate tests in the presence of increasing concentrations of glycerol. It was found that the secretion of this enzyme was least affected by the presence of up to 5% glycerol in the medium. Different carbon sources (Tables 1 and 2) were employed to study their effect on growth and production of extracellular Ffase from Aspergillus niger and its mutant in a time course study. The representative kinetics of product formation by the mutant culture from cellobiose (a), sucrose (b), a-cellulose (c) and wheat bran (d) (Figure 1) indicated that the activity in the case of the mutant derivative reached maximum values after 80–96 h of fermentation in the log phase. This figure revealed that production of Ffase was greatest on wheat bran. These curves also indicated that production of Ffase was apparently growth-associated. True time of induction could not be confirmed as the amount of enzyme formed up to 2 h of inoculation in the lag phase was below the accuracy limit of enzyme assays. There were distinct variations in the values of l, QS, YX/S and QX of the parental (Hanif et al. 2004) and mutant (Table 1) cultures

on different carbon sources (Table 1) and even larger variation of Ffase synthesis (Table 2) was noted. Those substrates which were consumed faster (high QS ) were the repressors. These studies indicated that glucose supported only a basal level of Ffase biosynthesis in the wild-type cells, while mutant cells were improved for product formation over the wild-type and that reported by Ricon et al. (2001). Arabinose, fructose and xylose supported 18- to 26-fold more synthesis of Ffase (than that on glucose), comparable with that achieved on CMC and that mutant was improved up to >2-fold with respect to synthesizing the enzyme. Normally, carbon sources which feed quickly into early steps of metabolic pathways cause catabolic repression, due to formation of the CreA protein (Bohm & Boos 2004) and this is in good agreement with the work reported by other workers (de Groot et al. 2003). In fact, the efficacy of inducers can be determined by both their actual concentration inside the cell and their binding affinity to regulatory macromolecules (de Groot et al. 2003; Bohm & Boos 2004) to synthesize more enzyme. The use of commercial sucrose as a substrate is uneconomical for large-scale production of Ffase, therefore, several renewable substrates (at 2% carbohydrate level) were included in these studies. Out of all carbon sources employed, wheat bran (2%) w/v) gave optimal productivity in the time course study (performed up to 120 h) at 30 C. It is important that for production of Ffase, wheat bran was superior to purified substrate (sucrose) which is prohibitively expensive, whereas a renewable substrate obtained from flour mills would be more economical for large scale enzyme production. Among a-cellulose, rice husks, rice polishings, and corncobs, the last one was the best stimulator of Ffase, followed by rice husk. Lignocellulosic substrates are utilized quite slowly, and glucose and xylose do not accumulate to a level high enough to repress the Ffase mRNA synthesis or formation of CreA protein as

Table 1. Comparative fermentation kinetic parameters of A. niger and its mutant derivative M125 for growth and substrate utilization on different substrates in submerged fermentation. Carbon source

Qx (l)1 h)1)

Yx/S (g gl)1)

QS (l)1 h)1)

RS*

(h)1)

Arabinose Fructose Galactose Glucose Xylose Lactose Maltose Sucrose Cellodextrin CMC 8-Cellulose Corn cobs Rice husk Rice polishing Wheat bran

0.270 0.390 0.155 0.420 0.290 0.109 0.159 0.323 0.360 0.109 0.188 0.216 0.210 0.348 1.498

0.51 0.49 0.50 0.50 0.49 0.52 0.52 0.53 0.54 0.50 0.62 0.56 0.54 0.58 0.66

0.435 0.452 0.460 0.512 0.407 0.290 0.439 0.676 0.540 0.156 0.368 0.412 0.451 0.354 0.680

0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.8 1.2 0.9 0.5 0.6 0.5 0.4

0.235 0.284 0.205 0.301 0.233 0.246 0.241 0.236 0.148 0.173 0.217 0.190 0.150 0.195 0.198

Each value is a mean of three replicates. Standard deviation among replicates varied between 5–7.5% of mean values and has not been presented. RS – reducing sugars in the fermentation mash.

475

b-fructofuranosidase from different substrates Table 2. Kinetic parameters of A. niger (P) and its mutant derivative M125 (M) for b-fructo-furanosidase (Ffase) formation parameters following growth on different substrates in submerged fermentation. Carbon source Arabinose P M Fructose P M Galactose P M Glucose P M Xylose P M Cellobiose P M Lactose P M Maltose P M Sucrose P M Cellodextrin P M CMC P M 8-cellulose P M Corn cobs P M Rice husk P M Rice polishing P M Wheat bran P M

QP YP/S YP/X (IU l)1 h)1) (IU g substrate)1) (IU g cells)1)

20 45

100 211

201 423

33 68

170 380

340 760

26 55

114 255

228 510

1 25

2 72

4 150

18 40

132 285

264 572

65 140

212 431

424 863

33 69

180 362

360 725

45 95

190 382

381 764

88 180

420 851

841 1702

97 200

255 626

510 1252

41 90

174 330

348 660

110 230

312 623

624 1246

212 429

325 656

651 1212

154 309

300 675

600 1350

147 300

300 615

600 1230

252 516

675 1355

1350 2800

their inductive effect which depended on substrate consumption parameters. Among insoluble substrates, wheat bran which supplied a lower amount of reducing sugars was comparatively the best source. The specific yield of Ffase by A. niger and its mutant is several-fold higher than the values reported by other workers on Aspergillus spp. and their mutants or recombinants (Yanai et al. 2001; Ashokkumar & Gunasekaran 2002; Montiel-Gonzalez et al. 2002). Addition of glucose to the basal medium containing wheat bran caused substantial catabolite repression in the wild-type cultures and reduced QP to 153 IU l)1h)1 compared with 251 IU l)1h)1 in its absence. There was an increase in the enzyme productivity (694 IU l)1h)1) even when glucose was being released from the substrate in the presence of exogenously added glucose in mutated cultures (Figure 2). This occurred because in the derepressed mutant, glucose might not trigger the formation of CreA protein to cause catabolite repression as has been observed in the case of cellulases produced by a mutant derivative of Cellulomonas biazotea (Rajoka et al. 1998). The possibility of using locally available substrates (Table 2) for enzyme production was promising in that induction on corn cobs, rice husks, rice polishings and wheat bran medium yielded Ffase to a level greater than 1.67–2.86-fold of that induced by sucrose. It was noteworthy that Ffase was also produced by cultures during growth on pure cellulosic substrates. This may be due to slow release of glucose, permitting poor binding of glucose to regulatory macromolecules and allowing increased synthesis of Ffase (de Groot et al. 2003). Alternatively, a common mechanism of induction for cellulases (Hanif et al. 2004) and Ffase may also induce Ffase but its production from cellobiose, maltose and lactose (Table 2) indicated that it was produced constitutively as well. Effect of nitrogen sources

QP – Ffase formation rate (maximum slope of Ffase (IU l)1 ) vs. time of fermentation, YP/S and YP/X were calculated as described in Materials and methods. Each value is a mean of three replicates. Standard deviation among replicates varied between 7.5\ and 10.0 % of mean values and has not been presented.

reported for the expression of xylanases on xylose or glucose in Aspgergillus spp. (de Vries et al. 1999). Carbohydrates present in the fermentation mash (Table 1) at the end of fermentation were different, therefore, all substrates varied with respect to inductive effect (Table 2). Those substrates which were rapidly consumed served as repressors but varied with respect to

Among the various nitrogen sources (ammonium nitrate, ammonium sulphate, sodium glutamate, sodium nitrate, urea, and corn steep liquor) added at equimolar concentration to medium containing wheat bran (2% w/v) by replacing nitrogen sources in the basal medium, corn steep liquor (containing 50% protein on dry weight basis) favoured maximum b-Ffase (315 and 671 IU l)1 h)1 in wild and mutant cultures respectively) production, followed by sodium glutamate, and ammonium sulphate, while sodium nitrate and ammonium nitrate were the poorest sources of nitrogen in the absence of pH control. Pandey et al. (1994) found that corn steep liquor increased the glucoamylase production while urea (0.25% w/v) favoured maximum pectinase production in Streptomyces sp. RCK-SC (Kuhad et al. 2004). When cultures were grown in the presence of corn steep liquor, even monosaccharides induced cells to produce elevated levels (Table 3) comparable to that on corncobs (Table 2). The molecular mechanism of this unusual

476

M.I. Rajoka and A. Yasmeen

Figure 2. Effect of addition of glucose to the wheat bran-Vogel’s medium (initial pH 6.5) on volumetric rate (Qp) (IU per l per h) of b-Ffase formation during growth of Aspergillus niger (), and its mutant M 125 () at 30 C in shake flask culture studies.

phenomenon is not known (and needs further study) but was distinctly different from previous findings. This may have occurred due to the regulation of the global nitrogen metabolism regulator, AreA (Lockington et al. 2004) in corn steep liquor or ammonium sulphate in the culture medium. Effect of pH and temperature on enzyme production The influence of initial pH of the culture media on Ffase production was studied in the range of pH 3.5–9.0. Maximum Ffase production occurred at pH 5.5–6.5 (Figure 3); after pH 6.5, Ffase production slowly declined until it became zero at pH 9.5. These studies indicated that in the absence of pH control, an initial pH of 6.5 may be regarded as optimal for Ffase production. The growth of the cultures namely A. niger and its mutant derivative A. niger M125 is strongly affected by temperature. The enzyme activity at 45 C was very low and the optimum temperature for biosynthesis of Ffase activity and cell mass formation was 30 C (Figure 4). The enzyme activities of A. niger M125 were higher than

those of its parent at all temperatures, thus showing that the enzyme production process by the mutant is more resistant to high temperature than that by its wild parent. Alteration in cell wall synthesis, protein synthesis or cell membrane permeability is a common mechanism of resistance to analogues (Rincon et al. 2001). Such permeability changes, may sometimes lead to increased production, presumably through increased rate of product export from the cell. It is conceivable that like the parental strain, the mutant derivative can effectively utilize cellulosic and lignocellulosic substrates, continue to grow, and secrete b-fructofuranosidase in the medium. These results are in good agreement with the work reported by Allen & Roche (1989) but need further studies for their confirmation.

Conclusion Gamma ray-induced mutation has given a stable and viable mutant for hyperproduction of Ffase; the

477

b-fructofuranosidase from different substrates Table 3. Kinetic parameters of A. niger (P) and its mutant derivative M125 (M) for product formation parameters following growth on different substrates added to Vogel’s medium (pH 6.5) containing corn steep liquor as a nitrogen source. Carbon source Arabinose P M Fructose P M Galactose P M Glucose P M Xylose P M Cellobiose P M Lactose P M Maltose P M Sucrose P M Cellodextrin P M CMC P M 8?-cellulose P M

QP (IU l)1 h)1)

YP/S (IU g substrate)1)

YP/X (IU g cells)1)

174 360

321 644

640 1300

200 412

332 663

760 1540

195 400

325 654

652 1321

112 230

224 451

490 990

167 341

295 600

592 1202

215 445

356 720

714 1450

210 441

335 680

680 1400

206 415

325 652

651 1300

245 500

420 851

841 1702

197 400

255 626

510 1252

141 290

174 330

348 660

223 452

312 623

624 1246

Figure 3. Effect of initial pHo of fermentation medium on volumetric (Qp) (IU l)1 h)1)) of Ffase during growth of Aspergillus niger (), and its mutant M125 () on wheat bran in Vogel’s medium at 30 C. All other variables were kept constant but initial pH of Vogel’s medium was varied.

QP – Ffase formation rate (maximum slope of Ffase (IU l)1) versus time of fermentation, YP/S – and YP/X were calculated as described in Materials and methods. Each value is a mean of three independent readings. Standard deviation among replicates varied between 5 – and 10% of mean values and has not been presented.

productivity is >2.0-fold improved over the wild-type parental strain. This enhancement may have occurred as a result of either an increase in gene copy number or an improvement in gene expression or both. The mechanism underlying this hypersecretion is of paramount significance and needs further study. The mutant of A. niger has the obvious advantage of hyperproduction of Ffase and may serve as a starting strain for further genetic improvement. High-molecular weight oligomers that accumulate as products of metabolic activity (Table 1) act as inducers, probably by interfering with the CreA-DNA interaction as reported earlier (de Vries et al. 1999; Bohm & Boos 2004). It is concluded that this organism may be exploited for bulk production of (Ffase) invertase

Figure 4. Effect of temperature on volumetric (Qp) productivity of Ffase) during growth of A. niger (continuous line), and its mutant M125 (broken line) on wheat bran in Vogel’s medium (initial pH 6.5) at different temperatures. All other variables were kept constant while fermentation temperature was varied.

using inexpensive agro-industrial substrates abundantly available in many countries.

Acknowledgements This work was supported by the Pakistan Atomic Energy Commission. Some chemicals were purchased from funds allocated by United States Agency for International Development, Washington, D.C, USA under PSTC Proposal 6.163. The technical assistance of R. Shahid is gratefully appreciated.

478 References Aiba, S., Humphrey, A.E. & Millis, N.F. 1973 Biochemical Engineering, 2nd edn. New York: Academic Press. pp. 92 – 127. ISBN 0-12045052-6. Allen, A.L. & Roche, C.D. (1989). Effects of strain and fermentation conditions on production of cellulases by Trichoderma reesei. Biotechnology and Bioengineering 33, 650–656. Ashokkumar B. & Gunasekaran P. 2002 Beta-fructofuranosidase production by 2-deoxyglucose resistant mutants of Aspergillus niger in submerged and solid-state fermentation. Indian Journal of Experimental Biology 9, 1032–1037. Bohm, A. & Boos, W. 2004 Gene regulation in prokaryotes by sub cellular relocalization of transcription factors. Current Opinion in Microbiology 7, 151–156. de Groot, M. J., van de Vondervoort, P. J., de Vries, R. P., vanKuyk, P. A., Ruijter, G. J. & Visser, J. 2003 Isolation and characterization of two specific regulatory Aspergillus niger mutants show antagonistic regulation of arabinan and xylan metabolism. Microbiology 149, 1183–1191. de Vries, R.P., Visser, J. & de Graaff , L.H. 1999 CreA modulates the XlnR-induced expression on xylose of Aspergillus niger genes involved in xylan degradation. Research in Microbiology 150, 281–285. Euzenat, O., Guibert, A. & Combes, D. 1997 Production of fructooligosaccharides by levansucrase from Bacillus subtilis C4. Process Biochemistry 32, 237–243. Hanif, A., Yasmeen, A. & Rajoka, M.I. 2004 Induction, production, repression, and de-repression of exoglucanase synthesis in Aspergillus niger. Bioresource Technology 94, 311–319. Haq, I., Khurshid, S., Ali, S., Ashraf, A., Qadeer, M.A. & Rajoka, M.I. 2001 Mutation of Aspergillus niger for hyper-production of citric acid following fermentation of blackstrap molasses. World Journal of Microbiology and Biotechnology 17, 35–37. Hayashi, A., Matsuzaki, K., Takasaki, Y., Ueno, H. & Imada, K. 1992 Production of b-fructofuranosidase by Aspergillus japonicus. World Journal of Microbiology and Biotechnology 8, 155–159. Hrmova, M., Petrakova, E. & Biely, P. 1991 Induction of celluloseand xylan-degrading enzyme systems in Aspergillus terreus by homo- and hetero-disaccharides composed of glucose and xylose. Journal of General Microbiology 137, 541–547. Kuhad, R.C., Kapoor, M. & Rustagi, R. 2004 Enhanced production of an alkaline pectinase from Streptomyces sp. RCK-SC by whole-cell immobilization and solid-state cultivation. World Journal of Microbiology and Biotechnology 20, 35–37.

M.I. Rajoka and A. Yasmeen Latif, F., Rajoka, M.I & Malik, K.A. 1994 Saccharification of Leptochloa fusca (kallar grass straw) by thermostable cellulases. Bioresouce Technology 50, 107–111. Lockington, R.A., Rodbourn, L., Barnett, S., Carter, C.J. & Kelly, J.M. 2002 Regulation by carbon and nitrogen sources of a family of cellulases in Aspergillus nidulans. Fungal Genetics and Biology 37, 190–196. Miller, G.L. 1959 Use of dinitrosalisylic acid (DNS) for determination of reducing sugars. Analytical Chemistry 31, 426–428. Montiel-Gonalez, A.M., Fernandez, F.J., Viniegra-Gonalez, G. & Loera, O. 2002 Invertase production on solid-state fermentation by Aspergillus niger strains improved by parasexual recombination. Applied Biochemistry and Biotechnology 102–103, 63–70. Muramatsu, M. & Nakakuki, T. 1995 Enzymatic synthesis of novel fructosyl and oligofructosyl trehaloses by Aspergillus sydowi bfructofuranosidase. Bioscience Biotechnology and Biochemistry 59, 208–212. Pandey, A., Askakumary, L., Selvakumar, P. & Vijayalaksmi, K. S. 1994 Influence of water activity on growth and activity of Aspergillus niger for glycoamylase production in solid state fermentation. World Journal of Microbiology and Biotechnology 10, 485–486. Rajoka, M.I., Bashir, A., Hussain, M.R.A., Ghauri, M.T. & Malik, K.A. 1998 Mutagenesis of Cellulomonas biazotea for improved production of cellulases. Folia Microbiologica 43, 15–22. Roberfroid, M. 1993 Dietary fiber, inulin, and oligofructose. A review comparing their physiological effects. CRC Critical Reviews in Food Science and Nutrition 33, 103–148. Rincon, A.M., Codon, A.C., Castrejon, F. & Benitez, T. 2001 Improved properties of baker’s yeast mutant resistant to 2deoxy-D-glucose. Applied and Environmental Microbiology 67, 4279–4285. Siddiqui, K. S. Azhar, M. J., Rashid, M. H. & Rajoka, M. I. 1997 Activity and thermostability of carboxymethyl celluslase from Aspergillus niger is strongly influenced by noncovalently attached polysaccharides. World Journal of Microbiology and Biotechnology 12, 213–216. Tomomatau, H. 1994 Health effects of oligosaccharides. Food Technology 48, 61–65. Yanai, K., Nakane, A., Hirayama, M. 2001 Molecular cloning and characterization of the fructooligosaccharide-producing beta-fructofuranosidase gene from Aspergillus niger ATCC 20611. Bioscience Biotechnology and Biochemistry 4, 766–773. Yun, J.W. 1996 Fructooligosaccharides – occurence, preparation, and application. Enzyme and Microbial Technology 19, 107–117.

Ó Springer 2005


Antimicrobial study of pyrazine, pyrazole and imidazole carboxylic acids and their hydrazinium salts T. Premkumar and S. Govindarajan* Department of Chemistry, Bharathiar University, Coimbatore 641 046, India *Author for correspondence: Tel.: +91-422-2422222(344), Fax: +91-422-2422387, E-mail: [email protected] Keywords: Hydrazinium salts, carboxylic acids, antibacterial activity

Summary Some new hydrazinium salts of 2-pyrazinecarboxylate, 2,3-pyrazinedicarboxylate, 3,5-pyrazoledicarboxylate and 4,5-imidazoledicarboxylate have been prepared. The in vitro antibacterial screening of the free acids and their hydrazinium salts has been carried out against Escherichia coli, Salmonella typhii and Vibrio cholerae. The antibacterial activities of the prepared hydrazinium salts show more promising activity than the corresponding free acids and the standard positive control antibiotic, Co-trimoxazole.

Introduction

Activity testing

Dibasic acids are known to form N2H5HA, (N2H5)2A and N2H5HA.H2A types of salts (H2A ¼ dibasic acid) with hydrazine. The preparation of hydrazinium salts has become a subject of recent interest due to their wide use as additives in propellants, explosives, and as drugs to treat cancer and Hodgkin’s disease (Schmidt 1984). The preparation and thermal behaviour of some of these salts have recently been reported from our laboratory with a few aliphatic (Yasodhai & Govindarajan 1999) and aromatic ( Kuppusamy et al. 1995) carboxylic acids. However, the antibacterial activity of hydrazinium salts has not been studied to date. It was, therefore, considered interesting to prepare the hydrazinium salts of 2-pyrazinecarboxylic and 2,3-pyrazine-, 3,5-pyrazole- and 4,5-imidazoledicarboxylic acids (Figure 1) and study their antibacterial activity.

The antibacterial activity of the compounds was determined by the disc diffusion method (Cruickshank 1968). The bacteria were cultured in nutrient agar medium and used as inoculum for the study. Bacterial cells were swabbed onto nutrient agar medium (prepared from NaCl 5.0 g, peptone 5.0 g, beef extract powder 3.0 g, yeast extract powder 3.0 gagar 20.0 g in 1000 ml distilled H2O; pH ¼ 7.5 ± 0.2) in Petri dishes.The test solutions were prepared in distilled water to a final concentrations of 1%, 2% and 4% and then applied to filter paper discs (Whatmann No. 4, 5 mm dia).These discs were placed on the already seeded plates and incubated at 35 ± 2 ° C for 24 h. The zone of inhibition around the discs were measured after 24 h. Co-trimoxazole was used as a standard positive control.

Hydrazinium salts Materials and methods Microorganisms Three pathogenic microorganisms were used to test the biological potential of the free carboxylic acids and their hydrazinium salts. They were (i) Escherichia coli, (ii) Salmonella typhi and (iii) Vibrio cholerae, obtained from the stock cultures of the Microbiology Laboratory of the Department of Environmental Sciences, Bharathiar University, Coimbatore, India.

The monohydrazinium salts such as N2H5pyzCOO, N2 H5pyzCOOÆH2O, N2H5Himdc, N2H5HimdcÆH2O, N2H5 Hpyz(COO)2 and N2H5 Hpz(COO), and dihydrazinium salts, namely, (N2H5)2pyz(COO)2, (N2H5)2pyz(COO)2Æ H2O and (N2H5 )2pz(COO)2 and also the other kind of acidic salts such as (N2H5)Hpyz(COO)2ÆH2 pyz(COO)2, (N2H5)Hpz(COO)2ÆH2pz(COO)2 and (N2H5)Hpz (COO)2Æ(H2pz(COO)2)3 have been prepared by neutralization of aqueous hydrazine hydrate with the respective acids in the appropriate molar ratios (Premkumar 2002; Premkumar & Govindarajan 2003).

480

T. Premkumar and S. Govindarajan Results

OH

N

N

O

O

N

O

N

OH

OH

2-pyrazinecarboxylic acid

2,3-pyrazinedicarboxylic acid (H2pyz(COO)2)

(HpyzCOO) HO

Conclusions

OH

O

N

O

N H

O

It is worthwhile noting that the antibacterial activity increases as the number of hydrazine moieties increases. Thus it is evident that the dihydrazinium salts showed a greater area of inhibition than those of monohydrazinium salts and free acids.

N HN HO

OH

O

3,5-pyrazoledicarboxylic acid

4,5-imidazoledicarboxylic acid

(H2pz(COO)2)

Acknowledgements

(H2imdc)

Figure 1. The structures of 2-pyrazinecarboxylic and 2,3-pyrazine-, 3,5-pyrazole- and 4,5-imidazoledicarboxylic acids.

Table 1. Antibacterial activity (the test solution was prepared in distilled water). Compound

These are reported in Table 1. Antibacterial studies of the simple hydrazinium salts have not previously been carried out. The results suggest that the antibacterial activity of the prepared hydrazinium salts shows more promising effects than the acid and the standard antibiotic, Co-trimoxazole.

Diameter of inhibition zone (mm) E.coli

S.typhii

V.Cholerae

T. Premkumar thanks the Council of Scientific and Industrial Research, New Delhi, for the award of a Senior Research Fellowship. Also, the authors wish to thank Professor P. Lakshmanaperumalsamy and his research student Mr. P.M. Ayyasamy, Department of Environmental Sciences, Bharathiar University, Coimbatore, India for providing facilities to carry out the bacterial study. References

1% 2% 4% 1% 2% 4% 1% 2% 4% Hpyz(COO) N2H5pyz(COO) N2H5pyz(COO) Æ H2O H2pyz(COO)2 N2H5Hpyz(COO)2 (N2H5)2pyz(COO)2 (N2H5)2pyz(COO)2 Æ H2O N2H5Hpyz(COO)2 Æ H2pyz(COO)2 H2pz(COO)2 Æ H2O N2H5Hpz(COO)2 (N2H5)2pz(COO)2 N2H5Hpz(COO)2 Æ H2pz(COO)2 N2H5Hpz(COO)2 Æ (H2pz(COO)2)3 H2imdca N2H5Himdc N2H5Himdc Æ H2O Co-trimoxazole

– 9 8 – 9 10 10 10 – – 9 – 6 – 6 6 6

9 10 9 9 11 13 13 11 6 8 16 8 8 – 8 8 7

11 12 12 11 15 28 29 13 8 11 25 10 10 – 11 11 10

– 7 7 9 – 9 9 9 – 6 10 6 – – 6 6 6

– 8 7 9 10 16 17 10 7 9 16 8 8 – 9 8 9

9 11 10 12 21 37 36 14 9 12 34 12 8 – 12 11 11

Diameter of zone of inhibition is a mean of triplicates. a Insoluble. –: no activity.

6 9 8 9 9 10 11 11 – 6 10 7 7 – – – 7

8 11 10 11 13 14 13 11 6 8 17 7 9 – 11 11 8

10 24 19 14 32 35 34 15 7 10 32 11 10 – 12 12 10

Cruickshank, R. 1968 Medical Microbiology: A Guide to Diagnosis and Control of Infection, 11th edn. Edinburgh and London: E & S Livingstone Ltd. Kuppusamy, K., Sivasankar, B.N. & Govindarajan, S. 1995 Preparation, characterization and thermal properties of some new hydrazinium carboxylates, Thermochimica Acta 259, 251–262. Premkumar, T. 2002 Synthesis and structural, spectroscopic, and thermal characterization of pyrazine, pyrazole and imidazole carboxylates of metal with hydrazine, PhD thesis, Bharathiar University, Coimbatore, India. Premkumar, T. & Govindarajan, S. 2003 Preparation, spectral and thermal studies of pyrazinecarboxylic acids and their hydrazinium salts. Proceedings of the Indian Academy of Sciences (ChemicalSciences) 115, 103–111. Schmidt, E.W. 1984 Hydrazine and its Derivatives: Preparation, Properties and Applications. New York: Wiley Interscience, ISBN 0471891703. Yasodhai, S. & Govindarajan, S. 1999 Preparation and thermal behaviour of some hydrazinium dicarboxylates. Thermochimica Acta, 338, 113–123.

Ó Springer 2005


Decolorization of azo dyes using Basidiomycete strain PV 002 Pradeep Verma*, and Datta Madamwar Post Graduate Department of Biosciences, Sardar Patel University, Vallabh Vidyanagar, 388 120, Gujarat, India *Author for correspondence: E-mail: [email protected] Present address: Center for Environmental Research Leipzig-Halle, Theodor Lieser Strasse. 4, 06120 Halle, Germany Keywords: Azo dyes, basidiomycete, decolorization, laccase, ligninolytic enzyme, manganese peroxidase

Summary Basidiomycete PV 002, a recently isolated white-rot strain from decomposed neem waste displayed high extracellular peroxidase and rapidly decolorized azo dyes. In this study, the optimal culture conditions for efficient production of ligninolytic enzymes were determined with respect to carbon and nitrogen. An additional objective was to determine the efficiency of PV 002 to degrade the azo dyes. White-rot strain PV 002 efficiently decolorized Ranocid Fast Blue (96%) and Acid Black 210 (70%) on day 5 and 9 respectively under static conditions. The degradation of azo dyes under different conditions was strongly correlated with the ligninolytic activity. The optimum growth temperature of strain PV 002 was 26 °C and pH 7.0.

Introduction Azo dyes constitute the largest chemical class of dyes used regularly for textile dyeing color photography, paper printing and other industrial applications and about 50% of the industrial colorants produced in the world are azo dyes. Industrial effluents often contain residual dye, which affects water quality and may become a threat to public health (Capalash & Sharma 1992). Certain azo dyes or their metabolites (e.g. aromatic amines such as benzidine) may be highly toxic and potentially carcinogenic (Rodriguez et al. 1999; Verma et al. 2003). The physicochemical methods available for the treatment of synthetic dyestuffs such as flocculation, sorption, electrochemical and oxidative degradation (Legrini et al. 1993; Arslan & Balcioglu 1999) are highly expensive and limited in their application. Decolorization of synthetic dyes using different microorganisms appears to be a highly attractive option, a less expensive and more environmentally friendly alternative to chemical decomposition (Moreira et al. 2000). The characteristic chemical structures of azo dyes (the linkage and aromatic sulphonic groups) make them recalcitrant to biological breakdown (Wang & Yu 1998). The white-rot fungi are the most extensive degraders of organopollutants such as polycyclic aromatic hydrocarbons (PAHs) and synthetic dyes. This capacity is due to the extracellular system of ligninolytic enzymes including laccase, lignin peroxidase (LiP), manganese

peroxidase (MnP), and H2O2-generating oxidases. Due to the non-specific character of the radical-mediated reactions of ligninolytic enzymes, a wide variety of recalcitrant compounds is susceptible to attack by these extracellular enzymes (Vyas & Molitoris 1995; Baldrian 2004). So far, most of studies have been carried out with well known white-rot fungi e.g., Phanerochaete chrysosporium, Trametes versicolor and Pleurotus ostreatus (Paszczynski & Crawford 2000; Verma & Madamwar 2002). Since each species differs in the composition of its ligninolytic machinery (Hatakka 1994), it is useful to study the production of enzymes in species with different ecological habitats. Therefore in the present investigation, screening for new potential fungal cultures led to the isolation of a Basidiomycete strain PV 002 that efficiently transformed selected azo dyes.

Materials and methods Chemicals All chemicals used were of analytical grade. Bushnell and Haas (BH) medium was obtained from Hi Media, India. 2, 20 -Azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS) and veratryl alcohol were obtained from Sigma, USA. o-Dianisidine was purchased from Chitti Chem, Baroda, India. Azo dyes, Ranocid Fast Blue (RFB) and Acid Black 210 (AB 210) were obtained from local industries. Trival names are used for convenience.

482 Screening Samples were collected from various sources including decaying wood, decomposed neem waste and various contaminated sites surrounding textile factories. Selective screening procedures were used. Various dilutions were made and spread on 1% (w/v) BH medium agar plates containing neem hull waste. The purity of each culture was confirmed by colony, spore and cellular morphology. The strains were grown on malt extract glucose medium (MEG) containing agar plates at 26 °C and stored at 4 °C. The culture was sub-cultured once in two months. Decolorization of azo dyes on solid media Decolorization of RFB and AB 210 was examined on agar plates containing dye (200 mg/l) in BH medium supplemented with 1.0 g yeast extract/l and 5.0 g glucose/l. The plates were inoculated with 5 5 mm pieces of agar from a 15-day-pregrown culture of the isolated basidiomycete and incubated at 26 ± 1 °C. Decolorization of azo dyes and enzyme activity assays The BH medium was used for dye decolorization and enzyme production. The flasks containing BH medium (50 ml containing 100 mg RFB/l [100 ppm] and 50 mg AB 210/l [50 ppm] final concentration) at pH 7.0 were sterilized by autoclaving. Inoculation was done with a 15-days-pregrown culture of PV 002 (5 5 mm) and flasks were incubated at 26 ± 1 °C under static or shaking (80 strokes/cm.min) conditions. Adsorption of the dye to the mycelial biomass was analyzed using mycelial biomass washed in distilled water. The concentration was determined at the absorbance maximum (kmax) of each dye. Uninoculated controls were also kept at the same temperature. Laccase activity was determined by oxidation of odianisidine (Palmieri et al. 1993), MnP activity was determined according to Katagiri et al. (1995), LiP activity was assayed according to Tien & Kirk (1988) using veratryl alcohol as a substrate. Aryl alcohol oxidase activity was determined using veratryl alcohol as a substrate without addition of H2O2 (Guillen et al. 1994). At regular intervals, 3 ml samples were withdrawn from the flasks and centrifuged at 6000 g for 20 min and the supernatant was analyzed for remaining dye content and enzyme activities. The decolorization was measured as the decrease in absorbance maxima (kmax) of RFB (536 nm) and AB 210 (604 nm) using a UV-visible spectrophotometer (Hewlett-Packard 8452). Uninoculated dye-containing media served as controls. All experiments were performed in triplicate. Effect of carbon, nitrogen, temperature and pH The effect of pH on the decolorization and enzyme activities was studied. The pH was adjusted with 1 M

P. Verma and D. Madamwar NaOH or HCl in the range 3.0–8.0. The effect of temperature was studied by incubation at 26, 37 and 45 °C. The effect of various carbon and nitrogen sources on enzyme production was also studied. The concentration of glucose varied from (0.1, 0.5, 1.0, 5.0 g/l) to determine the effect on enzyme activity. Chromatographic separation of the transformed dye products by HPTLC The transformation products were examined by high performance thin layer chromatography (HPTLC), on precoated Silica gel 60 F 254 (2020) plated (E Merck KagaA Germany). About 10 ll samples were applied bandwise with a Linomat IV Camag sampler, band length 8 mm, track distance 10 mm, distance from the side 20 mm, distance from lower edge 10 mm, delivery speed 15s/ll, temperature 25 °C. The plate was developed in a presaturated (15 min) twin chamber containing solvents of ammonia: propanol (1:2 v/v) for RFB and isoamyl alcohol-ethanol-water-ammonia (3.5: 5.0: 1.5: 0.2 by vol) for AB 210 and the running distance was 80 mm for the separation of transformation products. Spots were visualized under UV (254 nm) and visible light (540 nm).

Results and discussion Among the 20 fungal isolates, 14 showed ligninolytic and cellulolytic activities. Seven fungal isolates were Aspergillus species, three isolates were Trichoderma species and four isolates were Basidiomycetes. Further studies were carried out with Basidiomycete strain PV 002 because of its rapid decolorization of the selected azo dyes. RFB and AB 210 were selected for decolorization studies because of their wide use in textile industries as well as their known structure (Verma & Madamwar 2003). Basidiomycete strain PV 002 completely decolorized RFB and AB 210 agar plates on days 12 and 17 respectively. Dye decolorization and enzyme production by Basidiomycete starin PV 002 In the absence of dye, strain PV 002 showed highest production of laccase and MnP 4.7 and 28.5 U/ml on days 4 and 7 respectively. In the presence of RFB, peak laccase and MnP activities were reached (3.2 and 24.4 U/ml) on days 3 and 5 of respectively. In the presence of AB 210, peak laccase and MnP activities were reached (1.9 and 19.4 U/ml) on days 4 and 5 respectively (Figure 1). More than 95% of RFB and 70% of AB 210 decolorization was obtained on days 5 and 9 respectively under static conditions. Adsorption of dyes to mycelial biomass was not observed in the present study. No LiP or veratryl alcohol oxidase activity was detected in the culture supernatant. The differences in decolorization can be attributed to AB 210 being a

483

Dye decolorization by Basidiomycete PV 002 100

75

75

20

50 10

Decolorization (%)

100

Decolorization (%)

Enzyme Activity (U/ml)

30

50

25 25

0 0

2

4

6

8

10

0 12

0 3

Days

3,5

4

4,5

5

5,5

6

6,5

7

7,5

8

pH

triazo dye while RFB is a diazo dye and the structure of AB 210 is more complex than RFB. It has been reported that the effectiveness of decolorization depends on the structure and complexity of each dye and relatively small structural differences can markedly affect decolorization. These differences are presumably due, at least in part, to electron distribution and charge density, although steric factors may also contribute (Kim et al. 1995).

Figure 2. Effect of initial medium pH on decolorization of RFB (100 ppm) and AB 210 (50 ppm) by Basidiomycete strain PV 002 on days 5 and 9 respectively. (-j-) RFB (-(-) AB 210.

100

Decolorization (%)

Figure 1. Decolorization and enzyme production by Basidiomycete strain PV 002 in presence of RFB (100 ppm) and AB 210 (50 ppm). (-j-) % decolorization of RFB, (-(-) decolorization of AB 210, (--) laccase activity in RFB, (-d-) laccase activity in AB 210, (-4-) MnP activity in RFB, (-m- ) MnP activity in AB 210.

75

50

25

Effect of agitation, pH and temperature on decolorization Using agitation instead of static culture only 45% of RFB and 35% of AB 210 decolorization was achieved. The optimum pH for strain PV 002 was 7.0, and RFB and AB 210 were rapidly decolorized at this pH. However, lower decolorization and enzyme activities were detected at pH 3.0. Media with initial pH values ranging from pH 5.0–7.0 showed efficient decolorization (Figure 2). In the temperature range tested, 26 °C was optimum for decolorization and enzyme production. No decolorization and enzyme activities were detected after growth at 45 °C (data not shown). Effect of carbon, nitrogen source and dye concentration In the presence of glucose, peak laccase (3.2 U/ml) and MnP (24.4 U/ml) activities were reached on days 3 and 5 respectively and highest decolorization of RFB (100 ppm) and AB 210 (50 ppm) was observed on days 5 and 9 respectively (Figure 3). In the presence of fructose, only 1.2 and 5.6 U/ml laccase and MnP activities were obtained respectively and more than 60% decolorization was observed. At the same time, in the presence of other carbon sources such as sucrose or maltose, decolorization was not significant. This result confirms that glucose may be a suitable carbon source for dye decolorization. The low laccase and MnP

0 Maltose

Glucose

Sucrose

Fructose

Carbon sources Figure 3. Effect of various carbon sources on decolorization of RFB (100 ppm) and AB 210 (50 ppm) by Basidiomycete strain PV 002 on days 5 and 9 respectively. (-j-) RFB (-(-) AB 210.

production with other carbon sources might be attributed to catabolite repression (Wood 1980; Sandhu & Arora 1985). High enzyme activity was detected at all glucose concentrations examined (Figure 4). This indicates that the isolated fungus shows the enzyme activity expressed under primary growth. After the depletion of glucose, the enzyme activities became steady up to day five and then decreased rapidly. In most white-rot fungi, Lip and MnP production is induced under carbon-limiting conditions (Leatham 1986). By contrast, our isolated strain PV 002 shows higher enzyme production in carbon-rich conditions. Thus, the physiology of our isolated strain is quite different from that of the better-studied P. chrysosporium. In P. chrysosporium, nutrient supplementation typically represses enzyme production (Leatham 1986). Under conditions of nutrient depletion, only a low biomass yield is possible and also the ligninolytic enzymes can only be produced in small quantities. Thus, our strain provides an

484

P. Verma and D. Madamwar Transformation studies by HPTLC

Enzyme Activity (U/ml)

60

45

30

15

0 0,1

1,1

2,1 3,1 4,1 Glucose Concentration (g/L)

5,1

Figure 4. Effect of glucose concentration on enzyme activity by Basidiomycete strain PV 002 on days 4 and 7 respectively. (-d-) Laccase, (--) MnP.

attractive alternative given that cultivation in carbon-rich medium results in no observed repression of enzyme production, but rather in increased level of extracellular ligninolytic enzyme production. The effect of a variety of inorganic and organic nitrogen sources at 0.1 g/l on decolorization and enzyme activity was examined (Figure 5). The highest decolorization of RFB and AB 210 was obtained in the presence of yeast extract, however, 85 and 73% of RFB and AB 210 decolorization were obtained on day five respectively in the presence of peptone. 80 and 65% decolorization of RFB and AB 210 were observed on day nine when NH4Cl was used as inorganic nitrogen source. The Basidiomycete strain PV 002 decolorized more than 75% of RFB at 250 ppm on day five while only 57% decolorization of AB 210 was obtained at 150 ppm on day nine. However, during further increase in concentration, no significant decolorization was obtained.

100

Decolorization (%)

80

60

40

20

0 Amm. Sulphate Amm.Chloride

Amm.Nitrate

Yeast Ext.

Peptone

Nitrogen Sources

Figure 5. Effect of various nitrogen sources on decolorization of RFB (100 ppm) and AB 210 (50 ppm) by Basidiomycete strain PV 002. (-j-) RFB (-(-) AB 210.

After transformation of RFB (Rf ¼ 0.71), four metabolites (Rf ¼ 0.12, 0.45, 0.57, and 0.68) were detected. With AB 210 (Rf ¼ 0.85), metabolites Rf ¼ 0.39, 0.59, 0.64 and 0.77 were detected. One metabolite of RFB transformation might be metanilic acid with Rf ¼ 0.68. This was further supported by the presence of a peak in the UV region. RFB is a coupled dye composed of metanilic acid, sulphanilic acid and N-phenyl peri acid (Verma & Madamwar 2002). The Basidiomycete strain PV 002 efficiently transformed azo dyes. The dye decolorization was very fast compared with well-known selected white-rot fungi. Since nutrient limitation is not required for ligninolytic activity in Basidiomycete strain PV 002, further studies should attempt to increase degradation of the other recalcitrant compounds (e.g. PAH) by cheap organicrich supplements, which are known to stimulate peroxidase production. Such a biological process could be adopted as a cost-effective, safer and efficient approach for decolorization of effluents. Further work needs to be performed using this fungal system with the objective of reducing cost of the process significantly.

Acknowledgement The work was supported by Department of Biotechnology, New Delhi, India.

References Arslan, I. & Balcioglu, I.A. 1999 Degradation of commercial reactive dyestuffs by heterogeneous and homogeneous advanced oxidation process: a comparative study. Dyes and Pigment 43, 95–108. Baldrian, P. 2004 Purification and characterization of laccase from white-rot fungus Daedalea quercina and decolorization of synthetic dyes by the enzymes. Applied Microbiology and Biotechnology 63, 560–563. Capalash, N. & Sharma, P. 1992 Biodegradation of textile azo dyes by Phanerochaete chrysosporium. World Journal of Microbiology and Biotechnology 8, 309–312. Guillen, F., Martinez, A.T., Martinez, M.J. & Evans, C.S. 1994 Hydrogen peroxide-producing system of Pleurous eryngii involving the extracellular enzyme. aryl-alcohol oxidase. Applied Microbiology and Biotechnology 41, 465–470. Hatakka, A. 1994 Lignin modifying enzymes from selected white-rot fungi: production and role of lignin degradation. FEMS Microbiology Reviews 13, 125–135. Katagiri, N., Tsutsumi, Y. & Nishida, T. 1995 Correlation of brightening with cumulative enzyme activity related to lignin biodegradation during biobleaching of kraft pulp by white-rot fungi in the solid-state fermentation system. Applied and Environmental Microbiology 61, 617–627. Kim, S.J., Ishikawa K., Hirai, M. & Shoda, M. 1995 Characteristics of a newly isolated fungus, Geotrichum candidum December 1 which decolorizes various dyes. Journal of Fermentation and Bioengineering 79, 601–607. Leatham, G.F. 1986 The ligninolytic activities of Lentinus edodes and Phanerochate chrysosporium. Applied Microbiology and Biotechnology 24, 51–58.

Dye decolorization by Basidiomycete PV 002 Legrini, O., Oliveros, E. & Braun, A.M. 1993 Photochemical processes for water treatment. Chemical Reviews 93, 671–698. Moreira, M.T., Mielgo, I. & Feijoo Lena, J.M. 2000 Evaluation of different fungal strains in decolorization of synthetic dyes. Biotechnology Letters 22,1499–1503. Palmieri, G., Giardina, P., Marzullo, L., Desiderio, B., Nitti, G., Cannio, R. & Sannia, G. 1993 Stability and activity of a phenol oxidase from the ligninolytic fungus Pleurotus ostreatus. Applied Microbiology and Biotechnology 39, 632–636. Paszczynski, A. & Crawford, R.L. 2000 Recent advances in the use of fungi in environmental remediation and biotechnology. Soil Biochemistry 10, 379–422. Rodriguez, E., Pickard, M.A. & Duhalt, R.V. 1999 Industrial dye decolorization by laccases from lignolytic fungi. Current Microbiology 38, 27–32. Sandhu, D.K. & Arora, D.S. 1985 Laccase production by Polyporus sanguineus under different nutritional and environmental conditions. Experientia 41, 355–356. Tien, M. & Kirk, T.K. 1988 Lignin peroxidase of Phanerochaete chrysosporium. Methods in Enzymology 161, 238–243.

485 Verma, P. & Madamwar, D. 2002 Decolourisation of synthetic dyes by lignin peroxidase of Phanerochaete chrysosporium. Folia Microbiologica 47, 283–286. Verma, P. & Madamwar, D. 2003 Decolorization of synthetic dyes by a newly isolated strain of Serratia marcescens. World Journal of Microbiology and Biotechnology 19, 615–618. Verma, P., Baldrian, P. & Nerud, F. 2003 Decolorization of structurally different synthetic dyes using cobalt(II)/ascorbic acid/hydrogen peroxide system. Chemosphere 50, 975–979. Vyas, B.R. & Molitoris, H.P. 1995 Involvement of an extracellular H2O2-dependent lignolytic activity of the white-rot fungus, Pleurotus ostreatus in the decolorization of Remazol Brilliant Blue R. Applied and Environmental Microbiology 61, 3919–3927. Wang, Y. & Yu, J. 1998 Adsorption and degradation of synthetic dyes on the mycelium of Trametes versicolor. Water Science and Technology 38, 233–238. Wood, D.A. 1980 Production, purification and properties of extracellular laccase of Agaricus bisporus. Journal of General Microbiology 117, 327–338.

Ó Springer 2005


Effect of cultivation conditions on invertase production by hyperproducing Saccharomyces cerevisiae isolates Ikram-ul-Haq, Mirza Ahsen Baig* and Sikander Ali Biotechnology Research Centre, Botany Department, Government College University, Lahore, Pakistan *Author for correspondence: Tel: +92-42-9211634, Fax: +92-42-7243198, E-mail: [email protected] Keywords: Fermentation kinetics, invertase, nutrient media, process development, Saccharomyces cerevisiae, urea

Summary Invertase (b-D -fructofuranoside fructohydrolase, EC 3.2.1.26) finds major uses in confectionery and in the production of invert syrup. In the present study, we report on invertase production by wild cultures of Saccharomyces cerevisiae. The yeast strains were isolated from dates available in a local market. Five hyperproducing yeast strains (>100- fold higher invertase activity) were kinetically analysed for invertase production. Saccharomyces cerevisiae strain GCA-II was found to be a better invertase-yielding strain than all the other isolates. The values of Qp and Yp/s for GCA-II were economical as compared to other Saccharomyces cultures. The effect of sucrose concentration, rate of invertase synthesis, initial pH of fermentation medium and different organic nitrogen sources on the production of invertase under submerged culture conditions was investigated. Optimum concentrations of sucrose, urea and pH were 3, 0.2 (w/v), and 6 respectively. The increase in the enzyme yield obtained after optimization of the cultural conditions was 47.7%.

Introduction Invertases (b-fructofuranosidases) are enzymes that catalyse hydrolysis of terminal non-reducing b-D -fructofuranoside residues in b-D -fructofuranosides. Invertases are intracellular as well as extracellular (Nakano et al. 2000). The enzyme has wide range of commercial applications e.g., the production of confectionery with liquid or soft centre. It also aids fermentation of cane molasses into ethanol. Microbial invertase activity is used for the manufacture of calf feed and food for honeybees (Weber & Roitsch 2000; Sanchez et al. 2001). Many organisms such as Neurospora crassa, Candida utilis, Fusarium oxysporium, Phytophthora meganosperma, Aspergillus niger, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Schwanniomyces occidentalis produce invertase (Silveira et al. 2000). Saccharomyces cerevisiae is the organism of choice for invertase production because of its characteristic high sucrose-fermenting ability. An appropriate incubation period is of critical importance for invertase synthesis, as longer incubation can cause feedback repression of the enzyme (Vrabel et al. 1997; Gomez et al. 2000). In this manuscript, we report the isolation of Saccharomyces cerevisiae for the production of invertase and kinetic analysis of shake flask fermentation. Five strains of Saccharomyces cerevisiae were isolated from dates (Phoenix dactylifera) and tested

for invertase activity. The effect of sucrose concentration, incubation period, initial pH and different nitrogen sources was studied.

Materials and methods Organism and culture maintenance The strains of Saccharomyces cerevisiae were isolated from dates (fruit of the date palm, Phoenix dactylifera), cultured and maintained on the medium containing (g/l) sucrose 20.0; agar 20.0; peptone 5.0 and yeast extract 3.0 at pH 6.0 (Dworschack & Wickerham 1960). The cultures were stored at 4 °C. Vegetative inoculum Cell suspension was prepared from 2 to 3-days-old slant cultures of Saccharomyces cerevisiae. Twenty-five ml of seed medium was transferred to each 250 ml Erlenmeyer flask. The medium consisted of (g/l) sucrose 30.0; peptone 5.0 and yeast extract 3.0 at pH 6, unless stated otherwise. The flasks were cotton plugged and autoclaved at 103.5 Pa pressure (121 °C) for 15 min and cooled at room temperature. One ml of inoculum was transferred to each flask under sterile conditions. Flasks

488

Ikram-ul-Haq et al.

were then incubated in a rotary incubator shaker (SANYO Gallenkamp PLC, UK) at 30 °C for 24 h. Agitation rate was kept at 200 rev/min.

unit was defined as the amount of enzyme, which hydrolysed 1 lmol of sucrose per min at 20 °C, at pH 4.5’.

Fermentation technique

Kinetic parametric studies and statistical analysis

Production of invertase was carried out by the shake flask technique using 250 ml Erlenmeyer flasks. The same medium composition was used for vegetative inoculum preparation and for fermentation. Twentyfive millilitre of fermentation medium was transferred to each Erlenmeyer flask. The cotton-plugged flasks were autoclaved at 103.5 Pa pressure for 15 min and cooled at room temperature. One millilitre of vegetative inoculum was aseptically transferred to each flask; dry cell mass content of vegetative inoculum was 0.45 g/l. Flasks were then incubated in a rotary incubator shaker (SANYO Gallenkamp PLC, UK) at 30 °C for 48 h. The agitation rate was kept at 200 rev/min.

Kinetic parameters for batch fermentation process were determined after Pirt (1975). Treatment effects were compared after Snedecor & Cochran (1980). Significance has been presented as Duncan’s multiple ranges in the form of probability P values.

Analytical methods Dry cell mass Dry cell mass of yeast was determined by centrifugation of fermented broth in centrifuge at 3000 g for 15 min using weighed centrifuge tubes. The cells were washed thrice with distilled water and the tubes were oven dried at 105 °C for 2 h in an oven (Model: 1442A, Memmert, Germany). Sugar estimation Sucrose was hydrolysed by addition of 100 IU invertase in 10 ml of fermentation medium following incubation at 55 °C for 15 min. Sugar was then estimated by DNS method (Tasun et al. 1970) Transmittance was measured at 546 nm using spectrophotometer. Invertase activity Enzyme activity was determined according to the method of Sumner & Howell (1935). ‘One invertase

Results and discussion Isolation and screening of organism Five cultures of Saccharomyces cerevisiae (GCA-I, GCA-II, GCA-III, GCA-IV and GCA-V) were isolated from five different samples of dates (Pakistani, Iranian and Arabian types obtained from different areas of Lahore). Isolates were identified on the basis of characteristic features (Alexopoulos et al. 1995). The strains were screened for the production of invertase. Enzyme production ranged from 42.02 to 59.61 U/mg dry cell weight. Yeast strain GCA-II gave maximum production. This strain showed a low specific growth rate, but, a remarkable specific product rate was noted (Table 1) and was selected for the subsequent kinetic studies. Sucrose concentration The effect of sucrose concentration (20.0–40.0 g/l) on invertase production by Saccharomyces cerevisiae GCAII was studied (Figure 1). Maximum enzyme activity was obtained at a sucrose concentration of 30.0 g/l. Sucrose concentrations of more than 30.0 g/l caused an increase in sugar consumption and dry cell mass, however, there was no increase in invertase production. The reason was generation of a high concentration of inverted sugar in

Table 1. Kinetics of Saccharomyces cerevisiae strains for invertase biosynthesis. Kinetic parameters

Yeast strain GCA-I

Substrate consumption parameters 0.097 ± 0.003 Yx/s(g cells/g) Qs (g/l h) 0.268 ± 0.001 qs (g/g cells h) 1.21 ± 0.04 lmax(h)1) 0.036 ± 0.001 Enzyme formation parameters Qp (U/l h) 1583.0 ± 50 Yp/s(U/g) 5189.1 ± 4.2 Yp/x(U/mg cells) 60.6 ± 2.0 qp (U/mg cells h) 6.26 ± 0.2

GCA-II

GCA-III

0.052 0.411 2.42 0.021

± ± ± ±

0.002 0.012 0.07 0.001

2274.5 5514.0 106.7 13.34

± ± ± ±

70 5.2 0. 3 0. 4

GCA-IV

0.056 0.318 1.37 0.021

± ± ± ±

0.002 0.003 0.04 0.001

2010.1 4632.2 92.2 11.34

± ± ± ±

40 5.1 0.3 0.3

GCA-V

0.068 0.305 1.30 0.032

± ± ± ±

0.002 0.002 0.04 0.001

1728.2 4766.6 82.9 9.73

± ± ± ±

20 6.0 0.2 0.3

0.077 0.412 1.70 0.048

± ± ± ±

0.003 0.002 0.005 0.002

2047.1 4981.8 64.8 6.55

± ± ± ±

30 4.1 0.2 0.2

Kinetic parameters: Qp = U of invertase produced/l h, Yp/s = U of invertase produced/g substrate consumed, Yp/s = U of invertase produced/mg cells formed, qp = U of invertase produced/mg cells h, Yx/s = g cells/g substrate utilized, Qs = g substrate consumed/l h, qs = g substrate consumed/g cells h, Qx = g cells formed/l h. All the rates were calculated over intervals of 8 h and the maximum values are shown here, ± indicates standard deviation among three parallel replicates.

489

Kinetics of invertase production 80 70

25

Invertase Activity (U/ml).

60 20

50 40

15

30

10

20 5

10 0

Sugar consumption, Dry cell mass (g/l).

30

0 20

25 30 35 Sucrose Concentration (g/l) Invertase activity

Dry Cell Mass

40

Sugar Consumption

Figure 1. Effect of sucrose concentration on the production of invertase (incubation period 48 h, temperature 30 °C, initial pH 6.0, agitation rate 200 rev/min).

the medium resulting in glucose-induced repression of invertase (Elorza et al. 1977; Vitolo et al. 1995). At concentrations of sucrose less than 30.0 g/l, enzyme production was less than optimum. As sucrose was the carbon source in the medium, lower concentrations limited the proper growth of yeast, resulting in a lower yield of invertase (Myers et al. 1997). Rate of invertase production In batchwise fermentation, enzyme production started after a lag phase of 8 h and reached maximum at the onset of the stationary phase. Afterwards, enzyme activity declined due to a decrease in nutrient availability in the medium, or carbon catabolite repression, as the expression of invertase in Saccharomyces was checked by the presence of monosaccharides like glucose and fructose (Herwig et al. 2001). Thus proper incuba-

tion time was very important and critical for maximal enzyme production. Figure 2 shows the rate of invertase production by Saccharomyces cerevisiae GCA-II. Total incubation time was 72 h. Enzyme activity was estimated for different time intervals (8–72 h). Maximum invertase production was observed at 48 h of incubation. At 48 h incubation time, specific growth and product rates also supported the observed results indicating higher enzyme yield. Further increase in incubation period did not enhance invertase production. It might be due to a decrease in the amount of available nitrogen in the fermentation medium, the age of organism, the addition of inhibitors produced by yeast itself and the protease production characteristic of decline phase. Other workers have reported invertase production by Saccharomyces cerevisiae in similar culture medium incubated for 24–48 h (Dworschack & Wickerham 1960).

80

Invertase activity (U/ml).

70

25

60 20

50 40

15

30

10

20 5

10 0 0

8

16

24

32

40

48

56

64

Sugar consumption, Dry cell mass (g/l).

30

0 72

Time (h) Invertase activity

Dry cell mass

Sugar consumption

Figure 2. Rate of invertase production by Saccharomyces cerevisiae (sucrose concentration 20.0 g/l, incubation period 48 h, temperature 30 °C, initial pH 6.0, agitation rate 200 rev/min).

490

Ikram-ul-Haq et al.

Invertase activity (U/ml)

70

25

60 20

50

15

40 30

10

20 5

10

Dry cell mass, Sugar consumption (g/l)

30

80

0

0 5

5.5

6

6.5

7

Initial pH Invertase activity

Dry cell mass

Sugar consumption

Figure 3. Effect of initial pH on invertase production from Saccharomyces cerevisiae GCA-II (sucrose concentration 20.0 g/l, incubation period 48 h, temperature 30 °C, initial pH 6.0, agitation rate 200 rev/min).

Initial pH The effect of initial pH on invertase production by Saccharomyces cerevisiae GCA-II is shown in Figure 3. Maximum production of invertase was obtained when the initial pH of the fermentation medium was 6.0. Similarly, dry cell mass and sugar consumption were maximal at pH 6.0 i.e., 1.05 and 25.53 g/l, respectively. The final pH of the medium was 6.7. Many workers have reported similar results (Vitolo et al. 1995; Herwig et al. 2001, Belcarz et al. 2002). Higher growth rate was observed at pH 5.5, however maximum product rate was noted at initial pH 6. This means that although growth was more favoured at pH 5.5, as far as invertase production was concerned, pH 6 was best. It was noted that during submerged fermentation of S. cerevisiae, the final pH of the reaction mixture was

higher than the initial pH; and that the extent of the increase in pH was proportional to the invertase activity.

Organic nitrogen sources Nitrogen sources and their concentrations have a major effect on enzyme yield because sucrose metabolism shows a specific physiological response to the presence of nitrogen source (Silveira et al. 2000). The effect of different organic nitrogen sources (nutrient broth, peptone + yeast extract (control), urea + yeast extract and yeast extract only) on the production of invertase by Saccharomyces cerevisiae was studied (Figure 4). Application of an appropriate nitrogen source was very important for optimal production of

80


70

25

60 20

50 40

15

30

10

20 5

10 0

Dry cell mass, Sugar consumption (g/l).

30

0 control

Nutrient broth

Urea +yeast extract

Yeast extract

Nitrogen Sources (5g/l) Invertase activity

Dry Cell Mass

Sugar Consumption

Figure 4. Effect of organic nitrogen sources on the production of invertase (sucrose concentration 20.0 g/l, incubation period 48 h, temperature 30 °C, initial pH 6.0, agitation rate 200 rev/min).

491

Kinetics of invertase production


25

140 120

20

100 80

15

60

10

40 5

20 0

0 Control

0.1

0.2

0.3

0.4

Sugar consumption, Dry cell mass (g/l) Final pH

30

160

0.5

Urea Concentration (g/l) Invertase activity

Sugar Consumption

Dry Cell Mass

Final pH

Figure 5. Effect of urea concentration on the production of invertase (sucrose concentration 20.0 g/l, incubation period 48 h, temperature 30 °C, initial pH 6.0, agitation rate 200 rev/min).

5

0.07

4.5

0.06

3.5

0.05

3

0.04

2.5 2

0.03

1.5

0.02

Yx/s (g cells/g).

Qp (U/mlh).

4

1 0.01

0.5 0

0 Control

0.1

0.2

0.3

0.4

0.5

Urea concentration (g/l) Qp

Yx/s

Figure 6. Effect of urea concentration on the Qp (U of invertase produced/ml h) and Yx/s (g cells/g sugar consumed) (sucrose concentration 20.0 g/l, incubation period 48 h, temperature 30 °C, initial pH 6.0, agitation rate 200 rev/min).

invertase. In the following study, considerable invertase activity and dry cell mass was obtained when peptone + yeast extract was used as nitrogen source. Least dry cell mass was obtained when urea was used in the medium (0.77 g/l) however enzyme production was maximum. The reason for the high enzyme yield might be the positive influence of urease and invertase on each other’s secretion into the culture medium (Egorov et al. 2000). The effect of urea concentration in the fermentation medium on the production of invertase by Saccharomyces cerevisiae GCA-II was studied (Figure 5). Maximum enzyme activity (88.03 U/ml) was observed at urea concentration of 0.2 g/l. Sugar consumption and dry cell mass were 24.72 and 1.02 g/l, respectively. Lower urea concentration was not enough to induce urease in amounts sufficient to promote invertase production, and it did not fulfil the nitrogen require-

ment of the yeast, thus yielding less enzyme. Concentrations of urea higher than the optimum also produced less invertase, as it affected denaturation of yeast cell membranes (Pitombo et al. 1994; Lopes & Sola-Penna 2001), this was also supported by the Qp and Yx/s values (Figure 6), indicating reduction in cell mass with an increase in urea concentration. Other workers have reported maximum invertase activity of wild and mutant yeasts and fungi in the range of 0.10– 55.0 U/ml, which is at least 40% less than our strain (Dworschack & Wickerham 1960; Metzenberg et al. 1962; Hill & Sussman 1964; Hang et al. 1973; Mormeneo & Sentandreu 1982; Maheshwari et al. 1983; Carlson et al. 1984; Neigeborn & Carlson 1984; Sarokin & Carlson 1985; Perlman et al. 1986; Rouwenhorst et al. 1991; Myers et al. 1997; Basha. & Palanivelu 1998; Chaudhuri et al. 1999; Ashokkumar & Gunasekaran 2002; Montiel-Gonzalez et al. 2002).

492 Conclusion Invertase is an industrially important enzyme and its demand is increasing in line with the growing global markets for processed food, especially the confectionery industry. The use of invertase is somewhat limited due to its high price, thus optimization of the production process is very important so as to make it more economical and feasible. The present study contributed toward the optimization of nutritional parameters and cultural conditions. Important findings included optimization of incubation period, pH, sucrose concentration and use of urea as additional nitrogen source. It was noted that addition of 0.2 g/l of urea in the culture medium resulted in a highly significant increase in invertase production. This sharp increase might be attributed to the possibility that urease and invertase positively influence each other’s secretion into the culture medium, and urea facilitates release of periplasmic invertase by making yeast cell membranes more permeable. The value of product yield coefficient was very high i.e., 9253 U/g.

References Ashokkumar, B. & Gunasekaran, P. 2002 Beta-fructofuranosidase production by 2-deoxyglucose resistant mutants of Aspergillus niger in submerged and solid-state fermentation. Indian Journal of Experimental Biology 40, 1032–1037. Alexopoulos, C.J. Mims, C.W. & Blackwell M. 1995 Introductory Mycology 4th edn. New York: John Wiley and Sons. ISBN 0471522295. Basha, S.Y. & Palanivelu, P. 1998 Enhancement in activity of an invertase from the thermophilic fungus Thermomyces lanuginosus by exogenous proteins. World Journal of Microbiology and Biotechnology 14, 603–605. Belcarz, A., Ginalska, G., Lobarsewski, J. & Penel C. 2002 The novel non-glycosylated invertase from Candida utilis (the properties and the conditions of production and purification). Biochimica et Biophysica Acta 1594, 40–53. Carlson, M., Osmond, B.C., Neigeborn, L. & Botstein, D. 1984 A suppressor of Snf1 mutations causes constitutive high-level invertase synthesis in yeast. Genetics 107, 19–32. Chaudhuri, A., Bharadwaj, G. & Maheshwari, R. 1999 An unusual pattern of invertase activity development in the thermophilic fungus Thermomyces lanuginosus. FEMS Microbiology Letters 177, 39–45. Dworschack, R.G. & Wickerham, L.J. 1960 Extracellular invertase by sucrose-fermenting yeasts. U.S. Patent 2953500. Egorov, S.N., Semenova, I.N. & Maksimov, V.N. 2000 Mutual effect of invertase and acid phosphatase from the yeast Saccharomyces cerevisiae on their secretion into culture media. Mikrobiologiia 69, 34–37. Elorza, M., Villanuena, R. & Sentandreu, R. 1977 The mechanism of catabolite inhibition of invertase by glucose in Saccharomyces cerevisiae. Biochimica et Biophysica Acta 475, 103–112. Gomez, S.J.R., Augur, C. & Viniegra-Gozalez, G. 2000 Invertase production by Aspergillus niger in submerged and solid-state fermentation. Biotechnology Letters 22, 1255–1258. Hang, Y.D. Spliitstoesser, D.F. & Landschoot, R.L. 1973. Production of yeast invertase from Sauerkraut waste. Applied Microbiology 25, 501–502. Herwig, C. Doerries, C. Marison, I. & Stockar, U. 2001 Quantitative analysis of the regulation scheme of invertase expression in

Ikram-ul-Haq et al. Saccharomyces cerevisiae. Biotechnology and Bioengineering 76, 247–58. Hill, E.P. & Sussman, A.S. 1964 Development of trehalase and invertase activity in Neurospora. Journal of Bacteriology 88, 1556–1566. Lopes, D.H.J. & Sola-Penna, M. 2001 Urea increases tolerance of yeast inorganic pyrophosphatase activity to ethanol: the other side of urea interaction with proteins. Archives of Biochemistry and Biophysics 394, 61–66. Maheshwari, R., Balasubramanyam, P.V. & Palanivelu, P. 1983 Distinctive behaviour of invertase in a thermophilic fungus, Thermomyces lanuginosus. Archives of Microbiology 134, 255–260. Metzenberg, R.L. 1962 A gene affecting the repression of invertase and trehalase in Neurospora. Archives of Biochemistry and Biophysics 96, 468–474. Montiel-Gonzalez, A.M., Fernandez, F.J., Viniegra-Gonzalez, G.& Loera, O. 2002 Invertase production on solid-state fermentation by Aspergillus niger strains improved by parasexual recombination. Applied Biochemistry and Biotechnology 102–103, 63–70. Mormeneo, S. & Sentandreu, R. 1982 Regulation of invertase synthesis by glucose in Saccharomyces cerevisiae. Journal of Bacteriology 152, 14–18. Myers, D.K., Lawlor, D.T. & Attfield, P.V. 1997 Influence of invertase activity and glycerol synthesis and retention on fermentation of media with a high sugar concentration by Saccharomyces cerevisiae. Applied and Environmental Microbiology 63, 145–150. Nakano, H., Murakami, H., Shizuma, M., Kiso, T., deAraujo T.L. & Kitahata, S. 2000 Transfructosylation of thiol group by betafructofuranosidases. Bioscience and Biotechnology 64, 1472–1476. Neigeborn, L. & Carlson, M. 1984 genes affecting the regulation of suc2 gene expression by glucose repression in Saccharomyces cerevisiae. Genetics 108, 845–858. Perlman, D., Raney, P. & Halvorson, H.O. 1986 Mutations affecting the signal sequence alter synthesis and secretion of yeast invertase (signal peptide/recombinant DNA/protein secretion/proteolytic processing). Proceedings of the National Academy of Sciences USA 83, 5033–5037. Pirt, S.J. 1975 Principles of Microbe and Cell Cultivation. pp. 115–117. London, UK: Blackwell Scientific. ISBN 0-63208150-3. Pitombo, R.N.M., Spring, C., Passos, R.F., Tonato, M. & Vitole, M. 1994 Effect of moisture content on invertase activity of freeze-dried Saccharomyces cerevisiae. Cytobiology 31, 383–392. Rouwenhorst, R.J., Van Der Baan, A.A., Scheffers, W.A. & Van Dijken, J.P. 1991 Production and localization of b-fructosidase in asynchronous and synchronous chemostat cultures of yeasts. Applied and Environmental Microbiology 57, 557–562. Sanchez, M.P., Huidobro, J.F., Mato, I., Munigategui, S. & Sancho, M.T. 2001 Evolution of invertase activity in honey over two years. Journal of Agricultural and Food Chemistry 49, 416–422. Sarokin, L. & Carlson, M. 1985 Upstream region of the suc2 gene confers regulated expression to a heterologous gene in Saccharomyces cerevisiae. Molecular and Cellular Biology 5, 2521–2526. Silveira, M.C., Oliveira, E.M., Carvajal, E. & Bon, E.P. 2000 Nitrogen regulation of Saccharomyces cerevisiae invertase. Role of the URE2 gene. Applied Biochemistry and Biotechnology 84–86, 247–254. Snedecor, G.W. & Cochran, W.G. 1980 Statistical Methods, 7th edn. pp. 32–43. USA: Iowa State University., USA. ISBN 0-81381560-6. Sumner, J.B. & Howell, S.F. 1935 A method for determination of saccharase activity. Journal of Biological Chemistry 108, 51–54. Tasun, K., Chose, P. & Ghen, K. 1970 Sugar determination of DNS method. Biotechnology and Bioengineering 12, 921. Vitolo, M., Duranti, M.A. & Pellegrim, M.B. 1995 Effect of pH, aeration and sucrose feeding on invertase activity of intact Saccharomyces cerevisiae cells grown in sugarcane black strap molasses. Journal of Industrial Microbiology 15, 75–79. Vrabel, P., Polakovic, M., Stefuca, V. & Bales, V. 1997 Analysis of mechanisms and kinetics of thermal inactivation of enzymes: evaluation of multi temperature data applied to inactivation of yeast invertase. Enzyme and Microbial Technology 20, 348–354. Weber, H. & Roitsch, T. 2000 Invertases and life beyond sucrose cleavage. Trends in Plant Sciences 5, 47–48.

Springer 2005


Antibiotic resistance and survival of faecal coliforms in activated sludge system in a semi-arid region (Beni Mellal, Morocco) S. Fars1, K. Oufdou2,*, A. Nejmeddine3, L. Hassani2, A. Ait Melloul2, K. Bousselhaj1, O. Amahmid4, K. Bouhoum4, H. Lakmichi2 and N. Mezrioui2 1 Re´gie Autonome de Distribution d’Eau et d’Electricite´ du Tadla (R.A.D.E.E.T.), B.P. 174, Beńi Mellal, Morocco 2 Laboratoire de Microbiologie, De´partement de Biologie, Faculte´ des Sciences-Semlalia, Universite´ Cadi Ayyad, B.P. 2390 Marrakech 40000, Morocco 3 Laboratoire d’Analyses et d’Ecotoxicologie, De´partement de Biologie, Faculte´ des Sciences-Semlalia, Universite´ Cadi Ayyad, B.P. 2390 Marrakech 40000, Morocco 4 Laboratoire de Parasitologie, De´partement de Biologie, Faculte´ des Sciences-Semlalia, Universite´ Cadi Ayyad, B.P. 2390 Marrakech, 40000 Morocco *Author for correspondence: Tel.: + 212-4443-4649, Fax: 212-4443-7412, E-mail: [email protected] Keywords: Activated sludge, antibiotic resistance, drying bed, faecal coliforms, survival, wastewater

Summary The activated sludge process is one of the biological treatment methods used in many countries to reduce the high levels of organic and mineral pollutants and pathogenic micro-organisms present in wastewater. The present work was undertaken to study the dynamic and antibiotic-resistance of faecal coliforms (FC) in the activated sludge system of Beni Mellal. This work has also as objective the study of the survival of FC, protozoan cysts, helminth eggs and FC antibiotic resistance in the sludge dehydrated in drying beds in order to know if the agricultural usage of sludge presents any problems to public health. The activated sludge treatment of Beni Mellal resulted in an average reduction of FC and faecal streptococci of 90.75 and 91.06%, respectively. The overall resistance (resistance to at least one antibiotic) of 111 FC strains isolated from the system was 72.07%. This treatment system did not increase the incidence of FC antibiotic resistance in treated wastewaters. The antibiotic resistance of FC was found to be similar in both raw (71.05%) and treated sewage (77.77%). High levels of antibiotic resistance were towards streptomycin (54.05%), ampicillin (42.34%), amoxicillin (42.34%) and amoxicillin–clavulanic acid (31.53%). The treatment of sludge in drying beds appeared to be efficient in eliminating pathogenic micro-organisms: FC, protozoan cysts and helminth eggs. Moreover, the FC antibiotic resistance did not change over time in sludgedrying bed. According to the standard norms, agricultural utilization of this sludge cannot be excluded. However, it is important to study in the receptor environment the survival and the behaviour of antibiotic-resistant FC present in sludge and water.

Introduction The use of untreated wastewater for agricultural purposes involves serious health problems due to high levels of organic pollutants (e.g. detergents, pesticides), mineral pollutants (e.g. heavy metals), pathogenic bacteria and other micro-organisms. Several treatment methods are employed to reduce the organic and the bacterial load of wastewater. The activated sludge process is one of the biological treatment systems used in many countries where the amounts of sewage generated are increasing. The activated sludge plant of Beni Mellal (Morocco) has been underway since 1998. It may simultaneously solve the environmental and sanitary problems (protection of the Oum Rbia river). It can also be economically

beneficial if the effluent is re-used for irrigation purposes such as occurs in Beni Mellal. At the present time, the available data regarding bacterial dynamics, especially bacteria of faecal origin: faecal coliforms and faecal streptococci in activated sludge treatment plants are very scarce. Therefore, it is important to determine the effectiveness of this treatment method in semi-arid Mediterranean climates similar to Beni Mellal area. The incidence of antibiotic-resistant bacteria in aquatic environments has increased in the last decades as a consequence of the large-scale use of antibiotics (Walker & Vennes 1985). Antibiotic-resistant bacteria may be found in all aquatic ecosystems and under a variety of environmental conditions. Antibiotic resistance has been reported in organisms from surface water and sediments (Saya et al. 1987; Susan et al. 1988), in

494 lakes (Jones et al. 1986), in rivers and coastal areas (Al-Jebouri & Al-Meshhadani 1985; Pathak et al. 1993a), in drinking water (Bedard et al. 1982; Pathak et al. 1993b), in sewage-polluted seawater (Baya et al. 1986) and in domestic sewage (Hassani et al. 1992; Mezrioui & Oufdou 1996; Oufdou et al. 1999). The occurrence of multiply antibiotic-resistant faecal coliforms has been demonstrated in many studies (Walter & Vennes 1985; Pathak et al. 1993a; Oufdou et al. 1999) and is an important potential health problem. Antibiotic resistance in organisms which are not considered primary pathogens is also important because of the ability of these organisms to transmit resistance to other organisms mainly through R-plasmids (Niemi et al. 1983; Breittmayer & Gauthier 1990). Several workers have suggested that the faecal coliforms (FC), which are generally more antibiotic-resistant than other coliforms, may have a survival advantage in natural and treated wastewaters (Mezrioui & Baleux 1994). The aim of the present investigation is to study the dynamic and antibiotic-resistance of FC during treatment by the activated sludge system of Beni Mellal in order to discuss impacts of antibiotic resistance in the area of the public health. To ascertain whether agricultural valorization of sludge presents some problems to public health, this work has also as objective the study of the survival of FC, protozoan cysts, helminth eggs and the antibiotic resistance of FC in the sludge dehydrated in drying beds.

Material and methods Study site The activated sludge plant of Beni Mellal (32 210 N, 6 230 W, Morocco) covers 7 ha and receives sewage of essentially domestic origin. The wastewater daily discharged is 11,000 m3 per day. It serves a population of about 150,000 habitants. Retention time in the ecosystem is approximately 56 h. The superficial area of water in the system is 9700 m2. This system contains basins of pre-treatment and biological treatment. The purpose of the pre-treatment is to remove large objects, sand and oil. The pre-treated wastewater is divided up into two aeration tanks. The aeration is made with 10 turbines in each basin. After aeration, two settling basins allow sludge sedimentation. The treatment of sludge is made in thickening tanks which assure the concentration of sludge. The concentrated sludge is then pumped to the sludge-drying beds. There are 58 drying beds in which the sludge is sun-dried. The filtered water is taken to the head of the station. The wastewater treated by the system is discharged into the Oum Rbia river. Dynamics of faecal coliforms and faecal streptococci The temporal evolution of FC and faecal streptococci (FS) were studied over 14 months (May 2001–June

S. Fars et al. 2002) in the activated sludge plant of Beni Mellal. Samples were collected once a month from the inflow and the outflow of the system. To count FC and FS, 0.1 ml of the sample or of its appropriate dilutions was seeded respectively on TTC (2,3,5-triphenyl-tetrazolium chloride)-Tergitol 7 agar (Pasteur Institute Production) incubated at 44.5 C for 24 h and on bile-esculine agar incubated at 37 C for 24 h. The enumeration of these bacteria was done by indirect count of colony-forming units (c.f.u.). Determination of antibiotic resistance profiles One hundred and eleven FC strains were sampled during the period of study from the inflow, the outflow and the sludge of the system. These strains were stored before antibiotic resistance characterization in preserving medium agar (Pasteur Institute Production). FC strains were tested for their resistance to 15 antibiotics currently used for the treatment of human infections. The antibiotics tested (concentrations given in lg/ml) were: ampicillin (Amp: 20), amoxicillin (Amx: 20), amoxicillin–Clavulanic acid (Amx-Clav: 40), streptomycin (Str: 20), kanamycin (Km: 20), gentamycin (Gm: 10), chloramphenicol (Chl: 30), tetracycline (TC: 10), nalidixic acid (Na: 50), cephalothin (Cfl: 30), cefamandole (Cfm: 30), cefotaxim (Cfx: 30), trimethoprim (Tpm: 5), sulphamethoxazole (Smx: 100) and trimethoprim–Sulphamethoxazole (Tpm-Smx: 1.25/ 23.75). The resistance to antibiotics was determined by multipoint inoculation on Mueller–Hinton agar (BioMe´rieux) containing the appropriate antibiotic (Calomiris et al. 1984; Hassani et al. 1992; Oufdou et al. 1999). The plates were incubated at 37 C for 24 h. A strain was considered resistant to an antibiotic if its growth on the medium containing the antibiotic was similar to that observed on a control plate. The control plate was the Mueller–Hinton agar without antibiotic. Comparison was made between percentages of FC antibiotic resistance at the inflow, the outflow and the sludge of the system. This comparison was performed using the test of two proportions or frequencies described by Schwartz (1963). This test shows whether a difference between two frequencies: f1 observed on n1 samples and f2 observed on n2 samples, is significant. It will determine: f1 f2 t ¼ pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi f ð1 f Þð1=n1 þ 1=n2 Þ

with

f ¼

n1 f1 þ n2 f2 n1 þ n2

if jtj < 1:96: the difference between f1 and f2 was not significant (P > 0.05). if jtj 1:96: the difference was significant (P £ 0.05). Among the 111 FC strains, 38 FC strains were isolated from the inflow, 36 strains from the outflow and 37 strains were isolated from the sludge of the system. According to Bianchi & Bianchi (1982), samples of 30 colonies were statistically significant to have a

495

Antibiotic resistance of FC in activated sludge good idea of the qualitative composition of bacteria in the medium.

7

Survival of pathogens and FC antibiotic resistance in sludge-drying bed

5

Results Dynamics of FC and FS The evolution of FC and FS at the inflow and the outflow of the activated sludge is illustrated in Figure 1. Temporal densities of these bacteria were relatively stable. High numbers of FC and FS were noted at the inflow point with respective numbers of 3.84 · 105 and 2.44 · 104 c.f.u./ml, while at the outflow point, the

log10 c.f.u./ml

4 3 2

Inflow Outflow

1 0 May 01

July

Sept

Nov

Months

Janv 02

March

May

March

May

6

FS 5

log10 c.f.u./ml

The sludge treated and concentrated in thickening tanks is spread on the drying beds. In order to study the survival of FC in the drying beds, we followed their temporal evolution in sludge over a 2-month period. The sampling was done at 0, 2, 4, 8, 14, 20, 26, 32, 38, 45 and 60 days. Three repetitions were realized for each sample which was done from the surface to the bottom of the sludge. The bed of sludge in the drying beds was 20 cm deep. We also followed the temporal evolution of protozoan cysts, helminth eggs and physico-chemical parameters (water-content of sludge, ambient temperature, evaporation and content of heavy metals). The count of protozoan cysts and helminth eggs was realized by the technique of Bailenger (1962). Microscopic observation was done in a Thoma counting cell (Polylabo, 99530) at 400· magnification for protozoan cysts and in a Mac Master counting cell (Polylabo, 99520) at 100· magnification for helminth eggs. The water-content of sludge samples was determined according to the method described by the norm A.F.N.O.R. ISO 11465 (A.F.N.O.R. 1999). Ambient temperature and evaporation values were given by the meteorological station of ‘Hydraulic basin Oum Rbia Agency of Beni Mellal’. The temporal evolution of heavy metals was evaluated according to the following method: In brief, 500 mg of sludge were placed in a muffle oven at 450 C for 2 h. The sample was suspended in 10 ml of hydrofluoric acid (HF: 50%) in a Teflon beaker and dried on a sand bath. The dissolution of the residue was obtained by 2.5 ml of nitric acid (HNO3) and 6.5 ml of hydrochloric acid (HCl) for 2 h while it was hot. The final solution was adjusted to 10 ml by double-distilled water. Heavy metal content was determined by a flame atomic absorption spectrophotometer (Unicam 929 A.A.S.). The antibiotic resistance of FC in sludge-drying beds was also studied. A comparison was made between the antibiotic resistance of FC strains isolated at T0 (initial time) and those surviving after 2 months of exposure of sludge in the drying beds.

FC 6

4 3 2

Inflow Outflow

1 0 May 01

July

Sept

Nov

Months

Janv 02

Figure 1. Temporal evolution of FC and FS at the inflow and the outflow of the activated sludge.

observed numbers were respectively 3.55 · 104 and 2.18 · 103 c.f.u./ml. These numbers were significantly lower (P < 0.05; Wilcoxon signed rank non-parametric test) compared to those noted in the inflow (Figure 1). The activated sludge rate efficiency in eliminating these bacteria was respectively of 90.75 and 91.06% during the period of study. Antibiotic resistance of FC In order to evaluate the risk associated with antibiotic resistance, 111 strains of FC were isolated over time at the inflow, the outflow and the sludge of the system. The susceptibility patterns of FC strains to the 15 antibiotics tested are shown in Table 1. The overall resistance (resistance to at least one antibiotic) of FC strains was 72.07%. The monoresistance (resistance to one antibiotic) of FC strains was 18.91%, whereas the multi-resistance (resistance to at least two antibiotics) was 53.15%. The multi-resistance was significantly higher (P < 0.05; the test of two proportions, Schwartz 1963) than that of mono-resistance. The highest levels of antibiotic resistance were obtained for streptomycin (54.05%), ampicillin (42.34%), amoxicillin (42.34%) and amoxicillin– clavulanic acid (31.53%). The resistance rates to sulphamethoxazole, tetracycline, trimethoprim and trimethoprim–sulphamethoxazole were relatively lower

496

S. Fars et al.

Table 1. Antibiotic resistance among faecal coliforms strains isolated from the inflow, the outflow and the sludge of the system.

No. of strains examined No. of resistant strains (%) to One antibiotic (mono-resistance) Two antibiotics Three antibiotics Four antibiotics Five antibiotics Six antibiotics Seven antibiotics Eight antibiotics Nine antibiotics Multi-resistancea Overall resistanceb Percentages of strains resistant to Amp Amx Amx-Clav Str Km Gm Chl TC Na Cfl Cfm Cfx Tpm Smx Tpm-Smx

Inflow

Outflow

Sludge

Total

38

36

37

111

6 (15.79) 4 (10.52) 5 (13.15) 3 (7.89) 3 (7.89) 2 (5.26) 1 (2.63) 2 (5.26) 1 (2.63) 21 (55.26) 27 (71.05)

8 (22.22) 3 (8.33) 5 (13.88) 3 (8.33) 3 (8.33) 4 (11.11) 1 (2.77) 0 (0) 1 (2.77) 20 (55.55) 28 (77.77)

7 (18.91) 1 (2.7) 3 (8.1) 1 (2.7) 1 (2.7) 5 (13.51) 5 (13.51) 2 (5.4) 0 (0) 18 (48.64) 25 (67.56)

21 (18.91) 8 (7.2) 13 (11.71) 7 (6.3) 7 (6.3) 11 (9.9) 7 (6.3) 4 (3.6) 2 (1.8) 59 (53.15) 80 (72.07)

44.73 42.1 39.47 44.73 5.26 0 5.26 21.05 0 5.26 13.15 0 7.89 23.68 10.52

41.66 41.66 41.66 58.33 0 0 5.55 13.88 0 8.33 2.77 0 16.77 27.77 8.33

40.54 43.24 13.51 59.45 2.7 0 8.1 29.72 2.7 2.7 8.1 0 24.32 35.13 21.62

42.34 42.34 31.53 54.05 2.7 0 6.3 21.62 0.9 5.4 8.1 0 16.21 28.82 13.51

a

Multi-resistance: resistance to at least two antibiotics. Overall resistance: resistance to at least one antibiotic. Amp – ampicillin, Amx – amoxicillin, Amx-Clav – amoxicillin-Clavulanic acid, Str – streptomycin, Km – kanamycin, Gm – gentamycin, Chl – chloramphenicol, TC – tetracycline, Na – nalidixic acid, Cfl – cephalothin, Cfm – cefamandole, Cfx – cefotaxim, Tpm – trimethoprim, Smx – sulphamethoxazole, Tpm-Smx – trimethoprim-sulphamethoxazole. b

and reached 28.82, 21.62, 16.21 and 13.51%, respectively (Table 1). The resistance to kanamycin, chloramphenicol, nalidixic acid, cephalothin, cefamandole did not exceed 10%, whereas none of the strains examined was found to be resistant to gentamycin and cefotaxim. Mono-resistance occurred to streptomycin, tetracycline, sulphamethoxazole and cephalothin. The maximal mono-resistance was to streptomycin (15 from 21 strains resistant to one antibiotic: 71.42%). The dominant multi-resistance profiles noted were to three antibiotics (13 from 59 strains resistant to at least two antibiotics: 22.03%) and to six antibiotics (18.64%). The maximal multi-resistance was to nine antibiotics with two profiles: Amp, Amx, Amx-Clav, Str, Cfl, Cfm, TC, Tmp, Smx-Tpm and Amp, Amx, Amx-Clav, Str, Chl, TC, Smx, Tmp, Smx-Tpm. There was no significant difference (P > 0.05) between the level of antibiotic resistance of FC strains present in the raw (71.05%) and those present in the treated effluents (77.77%). Similarly, the FC antibiotic resistance in the sludge (67.56%) was not significantly different than those noted in the inflow and the outflow of the system (Table 1). The results of this investigation indicate that approximately 53.15% of FC found in raw, treated sewage and

sludge are multi-resistant to antibiotics commonly used for the treatment of bacterial infections in man and animals. Survival of pathogens and FC antibiotic resistance in sludge-drying bed In the sludge-drying bed, the survival of FC decreased significantly over time (Figure 2). Densities of FC strains were significantly higher (P < 0.05) at initial time (3.9 · 105 c.f.u./ml) compared to their densities noted after 2 months (only 30 c.f.u./ml). The elimination rate of these bacteria is more than 99.99% equivalent to 4.114 logarithmic units. Protozoan cysts and helminth eggs were also eliminated in the sludge-drying bed. At initial time (T0) protozoan cysts and helminth eggs were detected in sludge. The concentrations of protozoan cysts were of 76 cysts/g dry weight (d.w.) for Entamoeba histolytica, 150 cysts/g d.w. for Giardia and 310 cysts/g for Entamoeba coli, whereas the concentrations of helminth eggs were of 6.8 eggs/g d.w. for Ascaris and 16.7 eggs/ g d.w. for Trichuris (Table 2). After 4 days, the concentrations of protozoan cysts and helminth eggs decreased rapidly (Table 2). After

497

Antibiotic resistance of FC in activated sludge

Table 2. Survival of protozoan cysts and helminth’s eggs in the sludgedrying bed.

6

log10 c.f.u./ml

5

Protozoan (cysts/g)

4

T0 (0) 4 8 14

3

Ent. his. 76 32.6 – –

Giardi 150 64.3 – –

Helminths (eggs/g) Ent. Coli 310 205.3 – –

Ascaris 6.8 4.3 2.4 –

Trichuris 16.7 7.6 – –

2

Ent. his – Entamoeba histolytica, Ent. coli – Entamoeba coli. 1 0

2

4

8

14

20

26

32

38

45

60

Time (days)

Figure 2. Temporal evolution of FC in sludge-drying bed (confidence interval: 95%; n ¼ 3).

8 days no cysts of protozoan or eggs of Trichuris were detected in the sludge. For Ascaris, the total removal (100%) of this helminth was obtained from 14 days. It appears that high temperatures are responsible for the reduction of FC densities and the elimination of protozoan cysts and helminth eggs in the sludge-drying bed. The present experience was conducted in summer period (May–July 2001). At 26 days, the recorded ambient temperature was of 41 C and the evaporation was 7 l/m3 (Table 3). The dehydration in the drying bed appeared to be efficient to eliminate these microbial pathogens. In fact, the water-content decreased rapidly over time and it was only of 3.55% at 20 days (Table 3). The analysis of heavy metals in the sludge-drying bed revealed that the evolution of total concentration of copper, cadmium and lead remained relatively constant during the period of dehydration of sludge in the drying bed (Table 3). These heavy metals contents remain essentially under the standard norms recommended by A.F.N.O.R. 44-041 (A.F.N.O.R. 1998) (Table 4). On the other hand, the antibiotic resistance of FC strains did not significantly change over time in sludge-drying bed (Table 5). The overall resistance of FC strains isolated at T0 (initial time) (67.56%) was not significantly (P > 0.05) different than that evaluated after 2 months (72.22%) of exposure of sludge to

sunlight in the drying bed (Table 5). The mono-resistance and the multi-resistance of FC strains were not significantly different at T0 (respectively 18.91 and 48.64%) and after 2 months (respectively 25 and 47.22%). The high levels of resistance at initial time and after 2 months, were to streptomycin (respectively 59.45 and 47.22%), ampicillin (respectively 40.54 and 44.44%) and amoxicillin (respectively 43.24 and 52.77%) (Table 5). These percentages were comparable and were not significantly different (P > 0.05). Discussion The activated sludge treatment resulted in an average reduction of faecal pollution bacteria; FC and FS respectively of 90.75 and 91.06% during the period of study equivalent to 1.034 and 1.05 logarithmic unit. The superficial area of water in the system, which is 9700 m2, allowed only a weak reduction of faecal pollution bacteria (Figure 1). The effectiveness in eliminating these bacteria was somewhat comparable to that obtained by Mezrioui & Baleux (1994). These authors have shown that the percentage reduction of FC was of 91.30% in summer in the activated sludge of Montpellier (France) whereas in winter it was only 32%. The efficiency of the activated sludge plant appeared to be lower in removing pollution faecal bacteria than the other biological treatment process such as the stabilization pond system. In fact, the Marrakech stabilization ponds resulted in a 97.97% average overall reduction of FC equivalent to 1.69 logarithmic units.

Table 3. Temporal evolution of water-content, ambient temperature, evaporation and heavy metals in the sludge-drying bed. Time (days)

Water-content (%)

Temperature (C) (l/m3)

Evaporation

Copper

Cadmium (mg/kg d. w.)

Lead

T0 (0) 2 4 6 8 14 20 26 32 38 45 60

64.38 61.2 59 58.43 62.05 49.63 3.55 3.15 3.42 1.93 1.90 1.84

27 27 31 25 27 36 35 41 35 33 37 40

3.9 3.98 4 3 4 5.2 6 7 6.95 7.13 10.6 8

17.0 25.39 29.4 26.03 19.32 19.83 24.76 31.05 28.07 34.76 28.38 25.04

4.39 6.75 8.31 7.4 6.99 6.32 8.43 7.49 8.09 7.77 8.30 7.98

19.34 23.17 22.19 19.65 18.13 18.49 19.46 20.14 21.06 20.32 19.89 23.36

498

S. Fars et al.

Table 4. Concentrations of heavy metals in Beni Mellal sludge-drying bed compared to the standards norms. Heavy metals

Concentrations in Beni Mellal sludge-drying bed (mg/kg dry weight)

Standards normsa (mg/kg dry weight)

Copper Cadmium Lead

25.75 7.35 20.43

1000 20 800

a

Standards norms (A.F.N.O.R. 1998).

recommended

by

A.F.N.O.R.

44-041

The reduction of FC reached 98.95% equivalent to 2 logarithmic units in hot period (Mezrioui et al. 1995; Mezrioui & Oufdou 1996). The superficial area in this system which was only of 3800 m2, led to high reduction of FC. The aerobic lagoons of Me`ze (France) led to reduction of FC with rates of 99.99% in summer and 99.38% in winter (Mezrioui & Baleux 1994). Determination of resistance patterns to 15 antibiotics showed that among all FC strains isolated from Beni Mellal activated sludge, 72.07% were resistant to one or more antibiotics. The proportion of FC resistant to at

Table 5. Antibiotic resistance among FC strains isolated from sludgedrying bed.

No. of strains examined No. of resistant strains (%) to One antibiotic (mono-resistance) Two antibiotics Three antibiotics Four antibiotics Five antibiotics Six antibiotics Seven antibiotics Eight antibiotics Nine antibiotics Multi-resistancea Overall resistanceb Percentages of strains resistant to Amp Amx Amx-Clav Str Km Gm Chl TC Na Cfl Cfm Cfx Tpm Smx Tpm-Smx a b

Initial time (T0)

After 2 months

37

36

7 (18.91) 1 3 1 1 5 5 2 0 18 25

(2.7) (8.1) (2.7) (2.7) (13.51) (13.51) (5.4) (0) (48.64) (67.56)

40.54 43.24 13.51 59.45 2.7 0 8.1 29.72 2.7 2.7 8.1 0 24.32 35.13 21.62

9 (25) 3 5 5 1 2 0 1 1 17 26

(8.33) (13.88) (13.88) (2.77) (5.55) (0) (2.77) (2.77) (47.22) (72.22)

44.44 52.77 38.88 47.22 5.55 0 2.77 5.55 0 13.88 0 0 5.55 8.33 8.33

Multi-resistance: resistance to at least two antibiotics. Overall resistance: resistance to at least one antibiotic.

least one antibiotic ranged from 71.05% in the influent to 77.77% in treated sewage. This antibiotic resistance level was higher than that reported by Hassani et al. (1992) and Oufdou et al. (1999) in Marrakech sewage waters. Hassani et al. (1992) showed that proportions of Escherichia coli drug resistance was ranging only between 21.5 and 34.1% in waste stabilization ponds of Marrakech. Oufdou et al. (1999) have also noted that only 27.5% of FC strains were resistant to one or more antibiotics tested in Marrakech sewage water. However, the antibiotic resistance level evaluated in our study was somewhat comparable to that obtained by some studies (Goyal et al. 1979; Al-Jebouri & Al-Meshhadani 1985). Goyal & Adams (1984) have reported that 80% of FC were found to be resistant to one or more antibiotics. The percentage of multi-resistant strains (53.15%) was significantly higher than that of mono-resistant ones (18.91%). Many studies have reported an increase of multi-resistant percentages among FC strains isolated from various ecosystems (Walter & Vennes 1985; Pathak et al. 1993a; Oufdou et al. 1999). The most often encountered resistance of FC strains was towards streptomycin (54.05%), ampicillin (42.34%), amoxicillin (42.34%) and amoxicillin–clavulanic acid (31.53%). The abusive uses of these antibiotics in bacterial infections has probably led to selection of resistant isolates (Levy 1983). All FC strains analysed were susceptible to gentamycin. This antibiotic has often been described as an effective aminoglycoside towards E. coli (Al-Jebouri & Al-Meshhadani 1985; Sokari et al. 1988). The resistance level of FC to amoxicillin (42.34%) was somewhat comparable to that observed for the association amoxicillin–clavulanic acid, even though, the clavulanic acid strongly inhibits b-lactamases. The most likely explanation was that the resistance to b-lactams is not only achieved by the production of b-lactamases, but also by other ways like a reduced permeability of membranes to antibiotics as was seen in some bacteria (Urbaskova et al. 1993). The levels of antibiotic resistance of FC strains in the sludge and in wastewater before and after treatment in the activated sludge system were comparable. In view of these results, it can be concluded that the activated sludge, in which detention time was 56 h, does not promote development of antibiotic resistance in the same way as other biological treatment systems. In wastewater stabilization ponds, the percentage of antibiotic resistance at the outflow is often higher than at the inflow. Hassani et al. (1992) have reported that the sewage stabilization ponds of Marrakech resulted in a significant increase of antibiotic resistance in Escherichia coli strains. Mezrioui & Echab (1995) have also reported that this ecosystem increased significantly the incidence of antibiotic resistance in Salmonella populations from the inflow (19%) of the system to its outflow (29%). Mezrioui & Baleux (1994) have noted that the treatment of domestic sewage with activated sludge did not increase resistance to antibiotics, as

499

Antibiotic resistance of FC in activated sludge observed in aerobic lagoons of Me`ze (France) where residence was much longer (40–70 days) than during treatment with activated sludge of Montpellier (France) (5–6 h). The survival of FC in the sludge-drying bed decreased significantly during the time. The elimination rate of these bacteria after two months is more than 99.99% equivalent to 4.1 logarithmic units. The protozoan cysts and helminth eggs were completely eliminated after 14 days in the sludge-drying bed. The treatment of sludge before reuse or disposal in the drying bed by natural dehydration appeared to be efficient in removing pathogenic micro-organisms. High values of temperatures and sunlight and low watercontent could explain the significant reduction of FC densities and the elimination of protozoan cysts and helminth eggs. Troussellier et al. (1986), Mezrioui & Baleux (1992) and Mezrioui et al. (1995) have demonstrated the major effects of high temperature and sunlight on bacterial reduction. Ayres et al. (1993) have reported that high temperature affected eggs of Ascaris. The antibiotic resistance of FC strains did not significantly change over time in sludge-drying bed. The overall resistance of FC strains isolated at T0 (initial time) (67.56%) was not significantly different than that noted after 2 months (72.22%) of exposure of sludge to sunlight in drying bed. The conclusions to be drawn from this investigation are that multiply antibiotic resistance FC occur in significant numbers in both raw and treated wastewater. Even though it is better to have yielding effluents with 2.76 · 104 c.f.u./ml FC antibiotic-resistant rather than raw sewage without any treatment with 2.73 · 105 c.f.u./ml FC antibiotic-resistant, the present findings support the view that wastewater should be purified by more advanced methods prior to discharge into water destined for irrigation or recreation. Since water may play an important role in the spread of resistant bacteria, routine surveillance of sewage at periodic intervals for the detection of antibiotic-resistant bacteria is important. The treatment of sludge in drying beds appeared to be effective to eliminate pathogenic micro-organisms. Moreover, the concentrations of heavy metals; copper, cadmium and lead remain broadly under the standard norms. The agricultural valorization of this sludge cannot be excluded. However, it is important to study in the receptor environment the survival and the behaviour of antibiotic-resistant FC present in sludge and water. Acknowledgements This study was supported by the International Foundation for Science (i.f.s.) (Project No. F/2826-2). The authors are grateful to the ‘Hydraulic basin Oum Rbia Agency of Beni Mellal’ for the data given of ambient temperature and evaporation.

References A.F.N.O.R. 1998 Association française de normalisation: Installations classeés pour la protection de l’environnement, Paris. ISBN 2-12214311-8. A.F.N.O.R. 1999 Association française de normalisation: Qualite´ des sols, Paris, vol. 2, 408 pp. ISBN 2-12-213141-1. Al-Jebouri, M.M. & Al-Meshhadani, N.S. 1985 A note on antibioticresistant Escherichia coli in adult man, raw sewage and sewagepolluted river Tigris in Mosul, Nineva. Journal of Applied Bacteriology 59, 513–518. Ayres, R.M., Mara, D.D. & Silva, S.A. 1993 The accumulation, distribution and viability of human parasitic nematode eggs in the sludge of primary facultative waste stabilisation pond. Transactions of the Royal Society of Tropical Medicine and Hygiene 87, 256–258. Bailenger, J. 1962 Valeur compareé des me´thodes d’enrichissement en coprologie parasitaire. Le Pharmacien Biologiste 3, 249–259. Baya, A.M., Brayton, P.R., Brown, V.L., Grimes, D.J., RussekCohen, E. & Colwell, R.R. 1986 Coincident plasmids and antimicrobial resistance in marine bacteria isolated from polluted and unpolluted atlantic ocean samples. Applied and Environmental Microbiology 51, 1285–1292. Bedard, L., Drapeau, A.J., Kasatiya, S.S. & Plante, R. 1982 Plasmides de re´sistance aux antibiotiques chez les bacte´ries isoleés d’eaux potables. Eau de Que´bec 15, 59–66. Bianchi, M.A.G. & Bianchi, A.J.M. 1982 Statistical sampling of bacterial strains and its use in bacterial diversity measurement. Microbial Ecology 8, 61–69. Breittmayer, V.A. & Gauthier, M.J. 1990 Influence of glycine betaine on the transfer of plasmid RP4 between Escherichia coli strains in marine sediments. Letters in Applied Bacteriology 10, 65–68. Calomiris, J.J., Armstrong, J.L. & Seidler, J.C. 1984 Association of metal tolerance with multiple antibiotic resistance of bacteria isolated from drinking water. Applied and Environmental Microbiology 47, 1238–1242. Goyal, S.M. & Adams, W.N. 1984 Drug-resistant bacteria in continental shelf sediments. Applied and Environmental Microbiology 48, 861–862. Goyal, S.M., Gerba, C.P. & Melnick, J.L. 1979 Transferable drug resistance in bacteria of coastal canal water and sediment. Water Research 13, 349–356. Hassani, L., Imziln, B. & Gauthier, M.J. 1992 Antibiotic-resistant Escherichia coli from wastewater before and after treatment in stabilization ponds in the arid region of Marrakesh, Morocco. Letters in Applied Microbiology 15, 228–231. Jones, J.G., Gardener, S., Simon, B.M. & Pickup R.W. 1986 Antibiotic-resistant bacteria in Windermere and two remote upland tarns in the English Lake District. Journal of Applied Bacteriology 60, 443–453. Levy, S.B. 1983 Antibiotic resistance. Infection Control 4, 195–197. Mezrioui, N. & Baleux, B. 1992 Effets de la tempe´rature, du pH et du rayonnement solaire sur la survie de diffe´rentes bacte´ries d’inte´reˆt sanitaire dans une eau useé e´pureé par lagunage. Revue Sciences de l’Eau 5, 575–593. Mezrioui, N. & Baleux, B. 1994 Resistance patterns of E. coli strains isolated from domestic sewage before and after treatment in both aerobic lagoon and activated sludge. Water Research 28, 2399–2406. Mezrioui, N. & Echab, K. 1995 Drug resistance in Salmonella strains isolated from domestic wastewater before and after treatment in stabilization ponds in an arid region (Marrakesh, Morocco). World Journal of Microbiology and Biotechnology 11, 287–290. Mezrioui, N. & Oufdou, K. 1996 Abundance and antibiotic resistance of non-O1 Vibrio cholerae strains in domestic wastewater before and after treatment in stabilization ponds in an arid region (Marrakesh, Morocco). FEMS Microbiology Ecology 21, 277–284. Mezrioui, N., Oudra, B., Oufdou, K., Hassani, L., Loudiki, M. & Darley, J. 1994 Effect of microalgae growing on wastewater batch culture on Escherichia coli and Vibrio cholerae survival. Water Science and Technology 30, 295–302.

500 Mezrioui, N., Oufdou, K. & Baleux, B. 1995 Dynamics of non-O1 Vibrio cholerae and fecal coliforms in experimental stabilization ponds in the arid region of Marrakesh, Morocco, and the effect of pH, temperature and sunlight on their experimental survival. Canadian Journal of Microbiology 41, 489–498. Niemi, M., Sibakov, M. & Niemala, S. 1983 Antibiotic resistance among different species of fecal coliforms isolated from water samples. Applied and Environmental Microbiology 45, 79–83. Oufdou, K., Mezrioui, N., Ait Melloul, A., Barakate, M. & Ait Alla, A. 1999 Effects of sunlight and Synechocystis sp. (picocyanobacterium) on the incidence of antibiotic resistance in wastewater enteric bacteria. World Journal of Microbiology and Biotechnology 15, 553–559. Pathak, S.P., Bhattacherjee, J.W. & Ray, P.K. 1993a Seasonal variation in survival and antibiotic resistance among various bacterial populations in a tropical river. Journal of General and Applied Microbiology 39, 47–56. Pathak, S.P., Gautam, A.R., Gaur, A., Gopal, K. & Ray, P.K. 1993b Incidence of transferable antibiotic resistance among enterotoxigenic Escherichia coli in urban drinking water. Journal of Environmental Science and Health A28, 1445–1455. Saya, D.J., Ogunseitan, O., Sayler, G.S. & Miller R.V. 1987 Potential for transduction of plasmids in a natural freshwater environment:

S. Fars et al. effect of plasmid donor concentration and natural microbial community on transduction in Pseudomonas aeruginosa. Applied and Environmental Microbiology 53, 987–995. Schwartz, D. 1963 Me´thodes statistiques a` l’usage des Me´decins et des Biologistes. 3e`me e´dition. Paris: Flammarion Me´decine-Sciences. ISBN 2-257-10326-2. Sokari, T.G., Ibiebele, D.D. & Ottih, R.M. 1988 Antibiotic resistance among coliforms and Pseudomonas sp. from bodies of water around Port Harcourt, Nigeria. Journal of Applied Bacteriology 64, 335–359. Susan, B., Morchoe, O., Ogunseitan, O., Gary, S., Sayler, G.S. & Miller, R.V. 1988 Conjugal transfer of R68.45 and FP8 5 between Pseudomonas aeruginosa strains in a freshwater environment. Applied and Environmental Microbiology 54, 1923–1929. Troussellier, M., Legendre, P. & Baleux, B. 1986 Modeling of the evolution of bacterial densities in an eutrophic ecosystem (sewage lagoon). Microbial Ecology 12, 355–379. Urbaskova, P., Schindler, J., Adolva, E. & Nemec, A. 1993 Antibiotic susceptibility of mesophilic Aeromonads isolated in Czechoslovakia. Medical Microbiology Letters 2, 152–158. Walter, M.V. & Vennes, J.W. 1985 Occurence of multiple-antibioticresistant enteric bacteria in domestic sewage and oxidation lagoons. Applied and Environmental Microbiology 50, 930–933.

Ó Springer 2005


Diphenolases from Anoxybacillus kestanbolensis strains K1 and K4T Melike Yildirim1,*, Melek Col1, Ahmet Colak1, Saadettin Gu¨ner, Sabriye Du¨lger2 and Ali Osman Beldu¨z2 1 Departments of Chemistry, Karadeniz Technical University, 61080 Trabzon, Turkey 2 Department of Biology, Karadeniz Technical University. 61080 Trabzon, Turkey *Author for correspondence: E-mail: [email protected] Keywords: Anoxybacillus, catecholase, diphenolase, thermophile, thermostability

Summary Diphenolases from Anoxybacillus kestanbolensis strains K1 and K4T, highly active against 4-methylcatechol were characterized in terms of pH- and temperature-optima, pH- and temperature-stability, kinetic parameters, and inhibition/activation behaviour towards some general polyphenol oxidase (PPO) inhibitors and metal ions. The temperature-activity optima, for Anoxybacillus kestanbolensis K1 and K4T catecholases in the presence of 4-methylcatechol, were 80 and 70 °C, respectively. Although catecholase from A. kestanbolensis K4T lost no activity after a period of 1 h incubation at its optimum temperature, the enzyme from K1 was stimulated by keeping at 80 °C. Both of the enzymes possessed pH optima at 9.5, and the pH-stability profiles showed that cathecholases from both preparations retained their activities at alkaline pH values. Both A. kestanbolensis K1 and K4T catecholase activities were totally inhibited by addition of 0.01 mM sodium metabisulphite, ascorbic acid and 2+ L -cysteine. 1 mM Mn increased the activities of A. kestanbolensis K1 and K4T catecholases by 6.4- and 5.3-fold, respectively. These results indicate that both A. kestanbolensis K1 and K4T strains possess thermo- and alkalostable catecholases.

Introduction Polyphenol oxidases (PPO, EC 1.14.18.1) are a group of copper enzymes (Robb 1984) catalysing oxidation of polyphenolic compounds in the presence of molecular oxygen. They are widespread in the biosphere from mammals to bacteria (Burton 1994) and possess three different related activities. Cathechol oxidase or o-diphenol:oxygen oxidoreductase (EC 1.10.3.1); laccase or p-diphenol:oxygen oxidoreductase (EC 1.10.3.2) and cresolase or monophenol monooxygenase (EC 1.18.14.1) (Sheptovitsky & Brudving 1996). PPOs catalyse two different types of reactions involved in these three activities. The first, and only specific reaction catalysed by tyrosinase, is the hydroxylation of monophenols to o-diphenols, a reaction that is usually termed as monophenolase activity. The second (diphenolase activity) consists of the oxidation of o-diphenols to the corresponding o-quinones, which are highly reactive molecules and polymerize to brown, red or black pigments depending on the natural components present in the material (Whitaker 1972; Friedman 1997; Gilabert et al. 2001). It has been known that PPOs are essential for melanization (Mayer & Harel 1979). In mammals, melanins are mainly found in skin and hair, and they

Dr. Saadettin Gu¨ner died on 7 January 2005.

have a protective function against UV radiation. In lower organisms, melanins are also protective polymers that constitute a primary response against chemicals, free radicals, toxic metal ions, etc. (Jacobson 2000). PPO activity has also been found in plants and plays an important role in plant metabolism, including the respiration system, intermediary metabolism, regulation of the oxidation–reduction potential, antibiotic effects, and the wound-healing system (Mayer 1987). Diphenolase activities of PPO have a great importance in medical diagnosis for the determination of the hormonally active catecholamines such as adrenaline, dopamine, isoprenaline and dihydroxyphenylalanine (DOPA) (Lisdat et al. 1997; Tu et al. 2001; Oldair et al. 2003). PPOs also attract scientific interest for use in the synthesis or modifications of high-value compounds such as coumestrol, known for oestrogenic activity, and L -DOPA, used for the treatment of Parkinson’s disease (Pandey et al. 1990; Ahmed & Vulphson 1994). PPOs have also been used in the synthesis of functional polymers of phenolic compounds difficult to synthesize by conventional methods (Ikeda et al. 1996a, b; Uyama & Kobayashi 2002; Aktas & Tanyolac 2003). In this respect, a tyrosinase isolated from a thermophilic microorganism is advantageous over the mesophilic enzymes because of its thermal resistance and tolerance towards the common denaturing agents (Kong et al. 2000).

502 Very recently, some novel hot spring thermophiles; two new species (Anoxybacillus kestanbolensis and A. gonensis) and two new strains (A. pushchinoensis A8 and Saccharococcus caldoxylolyticus TK4) have been isolated from hot springs of Kestanbol and Go¨nen in Turkey and characterized based on their biochemical, chemotaxonomic and genetic properties in our laboratories (Beldu¨z et al. 2003; Du¨lger et al. 2004). The present study was aimed at screening their PPO potentials and evaluating the ability and biochemical characters of these thermophiles for oxidation of phenolic compounds.

M. Yildirim et al. strates (stock 100 mM), an equal volume of MBTH (stock 10 mM), 20 ll dimethylformamide (DMF), and the solution was diluted to 950 ll with buffer and 50 ll enzyme extract was added. The reference cuvette included all the reactants except the crude enzyme. Under the assay conditions, the oxidation of phenolic compounds in the reference mixture was negligible during the measurement time. One unit of catecholase activity was defined as 1 lmol of product formed per min. Specific activity was defined as the units of enzyme activity per mg of protein (Kong et al. 2000). Protein determination

Materials and methods Chemicals Substrates and 3-methyl-2-benzothiazolinone hydrazone (MBTH) were purchased from Sigma Chemical Co. (St. Louis, MO, USA) and the other reagents were of analytical grade and used as obtained. Culture conditions Supplemented Luria–Bertani (LB) broth was used for growth of all the thermophiles. The medium contained (g/l in distilled water) yeast extract 5.0, bactotryptone, 10.0, NaCl; 5.0, and 40 lM CuSO4, pH 7.5. Enzyme production and crude enzyme preparation The bacteria were grown in LB broth medium at 60 °C for 12 h on a shaker operating at 200 rev/min. The cells were harvested by centrifugation at 5000 rev/min for 30 min and then suspended in 50 mM Tris–HCl buffer, pH 9.0. The suspended cells were subjected to liquid nitrogen for 2 min for three times and then disrupted by lysozyme. For this purpose, a 0.5 ml lysozyme solution (10 mg/ml) was added to a 10 ml of cell suspension and left at room temperature for 30 min. The disrupted cell suspension was centrifuged at 5000 rev/min for 30 min. The supernatant was used as crude enzyme extract and stored at 4 °C until use. Screening of thermophiles for their polyphenol oxidase potentials Anoxybacillus species were screened for their PPO potentials by the method reported previously (Espin et al. 1995; Dincer et al. 2002; O¨zen et al. 2004; Colak et al. 2004) using an ATI Unicam UV2-100 double beam UV–Vis spectrophotometer (ATI Unicam, Cambridge, UK). The activity was determined by using different mono- or diphenolic compounds by measuring the increase in absorbance at 494 nm for 4-methylcatechol and 500 nm for all other substrates (Espin et al. 1995). The enzymatic assay was carried out in airsaturated solutions. The assay mixture contained sub-

Protein quantity in the enzyme extracts was determined according to the Lowry method with bovine serum albumin as standard. The values were obtained by graphic interpolation on a calibration curve at 650 nm. Characteristics of the crude enzyme Substrate specificity PPO activity was determined by using catechol, 4-methylcatechol, L -3,4-dihydroxyphenylalanine (L DOPA), 3-(3,4-dihydroxyphenyl) propionic acid (DHPPA), as diphenolic substrates and L -tyrosine as a monophenolic substrate with MBTH (Espin et al. 1995) in 50 mM phosphate buffer (pH 8.0). Effect of pH on catecholase activity and pH stability The effect of pH on the catecholase activity was determined by using 4-methylcatechol as substrate with the following buffers (50 mM) at the indicated pH. Glycine–HCl buffer, from pH 2.5 to 3.5; acetate buffer, from 4.0 to 5.5; phosphate buffer, from 6.0 to 8.0; Tris– HCl buffer, from 8.5 to 9.0; glycine–NaOH buffer, from 9.5 to 10.0. The pH stability was determined by incubating the enzyme extract in the above buffer for 48 h at 4 °C. At the end of the storage period, the activity was assayed under standard conditions: 50 mM glycine–HCl, pH 3.5 as buffer and 4-methylcatechol as substrate. Effect of temperature on catecholase activity and thermal stability Catecholase activity was assayed at various temperatures over the range of 10–90 °C, using a circulation water bath. The reaction mixture at pH 3.5 containing all the reagents except crude enzyme was incubated for 5 min at various temperatures indicated above. After the enzyme was added, the relative activity was determined spectrophotometrically at 494 nm as rapidly as possible. In order to determine the thermal stability of the enzyme, the enzyme solutions in Eppendorf tubes were incubated at their optimum temperatures for 20, 40 and 60 min, rapidly cooled in an ice bath for 5 min, and then brought to 25 °C. After the mixture reached to room temperature, the enzyme activity was assayed under the assay conditions. The percentage residual catecholase

Diphenolases from Anoxybacillus kestanbolensis activity was calculated by comparison with unincubated enzyme (Dincer et al. 2002; O¨zen et al. 2004). Effect of substrate concentration on catecholase activity and enzyme kinetics To study the effect of substrate concentration on the enzyme activity, a stock solution of 4-methylcatechol (100 mM) was used. The final reaction mixture contained equal volume of stock substrate solution and stock MBTH (10 mM). Twenty microlitres DMF was added and then the mixture was diluted to 950 ll with buffer at pH 3.5. The rate of catecholase reaction was measured spectrophometrically by adding 50 ll crude enzyme (Colak et al. 2004). The Michaelis–Menten constant (Km) and maximum velocity (Vmax) values were determined as the reciprocal absolute values of the intercepts on the x- and y-axes, respectively, of the linear regression curve (Lineweaver & Burk 1934). Effect of protein concentration on catecholase activity Catecholase activity, as a function of protein concentration, was determined in a protein concentration range of 0.05–0.36 mg/ml for Anoxybacillus kestanbolensis K1 and 0.03–0.50 mg/ml for A. kestanbolensis K4T using 4-methylcatechol as substrate. The activity was assayed under standard conditions using various volumes of the enzyme extracts (Colak et al. 2004). Effect of general PPO inhibitors on crude enzyme activity The following compounds were evaluated for their effectiveness as an inhibitor of catecholase activity using 4-methylcatechol as substrate: benzoic acid, sodium metabisulphite, ascorbic acid and L -cysteine. An aliquot of each inhibitor at various final concentrations was added to the standard reaction solution immediately before the addition of 50 ll enzyme extract. Relative enzymatic activity was calculated as a percentage of the activity in the absence of inhibitor. The concentration of inhibitor giving 50% inhibition (I50) was determined from plot of residual activity against inhibitor concentration (Colak et al. 2004; O¨zen et al. 2004). Effect of metal ions on catecholase activity Co2+, Ca2+, K+, Mn2+, Cu2+, Zn2+, Ni2+, Al3+, Cd2+, and Cr3+ were used to study the effect of metal ions on catecholase activity. After addition of each metal ion solution at 1 mM final concentration, the activity was assayed using 4-methylcatechol as substrate. The percentage remaining activities were expressed by comparison with standard assay mixture with no metal ion added. Native polyacrylamide gel electrophoresis Native polyacrylamide gel electrophoresis was performed on a Hoeffer SE 600 Series Electrophoresis dual slab cell unit (California, USA), using preparative 8% polyacrylamide gels (Laemmli 1970) under native

503 conditions. After electrophoresis, the gel was stained for catecholase activity in 24 mM L -DOPA.

Results and discussion The present study was aimed at screening PPO potentials (Table 1) of seven Anoxybacillus (A. kestanbolensis, A. gonensis or A. pushchinoensis) isolates and Saccharococcus caldoxylolyticus which were isolated from Hot springs of Kestanbol and Go¨nen in Turkey (Beldu¨z et al. 2003; Du¨lger et al. 2004). The screening of PPO activities in the presence of catechol has shown that the two A. kestanbolensis strains (K1 and K4T) possessed the greatest PPO activity (Table 1). Therefore, the ability and biochemical characters of these thermophiles for oxidation of phenolic compounds were investigated. The catecholases from A. kestanbolensis K1 and K4T strains were characterized on crude enzyme preparations. Native polyacrylamide gel electrophoresis on crude enzymes stained with L -DOPA from both strains indicated the presence of polyphenoloxidases having molecular weights of approximately 45 and 47 kDa, respectively. A lower molecular weight tyrosinase from Streptomyces antibioticus (Streffer et al. 2001) and a higher molecular weight tyrosinase from Thermomicrobium roseum (Kong et al. 2000) were reported. PPO with similar molecular weights were also available for plant and fungal tyrosinases (Celia et al. 1997). The catecholase enzyme activities were found to be protein concentration-dependent. For both catecholases, the plots of final protein concentration in the assay mixture versus specific catecholase activity in the presence of 4-methylcatechol as a substrate exhibited hyperbolic curves. Catecholase activities from A. kestanbolensis K1 and K4T increased until the final protein concentration at the standard assay conditions reached 0.21 and 0.19 mg/ml, respectively and remained constant after these values for each. Substrate specificity Catechol, 4-methylcatechol, L -DOPA, DHPPA as diphenolic substrates and L -tyrosine as a monophenolic

Table 1. Polyphenol oxidase potentials of the isolated thermophilic strains in the presence of catechol as a substrate. Isolate number

Strain

Specific activity (U/mg protein)

A4 A7 A9 A8 G2Ta K1 K4Ta TK4

Anoxybacillus gonensis Anoxybacillus gonensis Anoxybacillus gonensis Anoxybacillus pushchinoensis Anoxybacillus gonensis Anoxybacillus kestanbolensis Anoxybacillus kestanbolensis Saccharococcus caldoxylolyticus

0.007 ± 0.0002 No activity No activity No activity 0.03 ± 0.001 0.05 ± 0.002 0.07 ± 0.003 0.03 ± 0.003

a

Superscript T means strain-type of any species.

504

M. Yildirim et al.

Table 2. Substrate specificities of Anoxybacillus kestanbolensis K1 and K4T crude polyphenoloxidases.

A. kestanbolensis A. kestanbolensis K1 K4T Catechol 4-Methylcatechol L -DOPA DHPPA L -Tyrosine a

500 494 500 500 500

A. kestanbolensis K1 T A. kestanbolensis K4

Relative activity (%)

28 ± 0.3 100 ± 1.0 3 ± 0.1 2 ± 0.1 No activity

28 ± 0.1 100 ± 1.0 2.0 ± 0.1 1.0 ± 0.1 No activity

Espin et al. (1995).

substrate were tested for substrate specificity of the polyphenol oxidase. While catechol and 4-methylcatechol were oxidized by crude A. kestanbolensis K1 and K4T polyphenol oxidases, there was no significant oxidation of L -DOPA and DHPPA. The enzymes did not catalyse the oxidation of L -tyrosine as well (Table 2). Substrate specificities clearly show that the enzymes present in both A. kestanbolensis strains utilize only diphenols and possess catecholase activities. This is in good agreement with that monophenolase activities in microorganisms are generally very weak (Kong et al. 2000; Ali & Haq 2001). The crude enzymes showed the greatest catecholase activities towards 4-methylcatechol. The relative activities of the enzymes, based on the wavelength maximum of the product, were compared with the activities in the presence of 4-methylcatechol as 100%. Effect of pH on catecholase activity and stability The effect of pH on the catecholase activities of both enzyme preparations was determined by using 4-methylcatechol as a substrate over the pH range from 2.5 to 10.0. Both enzymes showed a pH optimum at 9.5 (Figure 1). In addition, both enzyme preparations showed a second peak of activity at pH 3.5. This might indicate different isoforms of the catecholases present in the crude enzyme preparations or proteolysed but enzymatically active catecholases having similar molecular mass (Celia et al. 1997). It has been reported that the adduct occurring during the enzymatic assay was unstable at alkaline pH values (Espin et al. 1997). A tyrosinase highly stable at neutral pH values was reported from S. antibioticus (Streffer et al. 2001) It has been reported that T. roseum contains a tyrosinase active at pH 9.5 (Kong et al. 2000). The optimum pH values for PPO also differ among plant species depending upon the substrate used for assay (Fraignier et al. 1995; Arslan et al. 1998; Yang et al. 2000; Dincer et al. 2002; O¨zen et al. 2004). The residual percentage activities of the enzymes from both A. kestanbolensis strains were determined after 48 h of incubation at various pH values ranged from 2.5 to 9.5 (Figure 2). The pH-stability profiles showed that catecholases from both preparations retained their

Relative activity (%)

Wavelength (nm)a

80 60 40 20 0 2.0

4.0

6.0 pH

8.0

10.0

Figure 1. pH-activity profiles for both Anoxybacillus kestanbolensis K1 and K4T catecholases in 50 mM glycine–HCl buffer (pH 2.5–3.5), in 50 mM acetate buffer (4.0–5.5), in 50 mM phosphate buffer (6.0– 8.0), in 50 mM Tris–HCl buffer (8.5–9.0) and in 50 mM glycine– NaOH buffer (9.5–10.0). The reaction was carried out at room temperature. Reaction mixture contained 4-methylcatechol (stock 100 mM), an equal volume of MBTH (stock 10 mM), 20 ll DMF, and the solution was diluted to 950 ll with buffer and 50 ll enzyme extract was added.

activities at alkaline pH values. Catecholase activities from A. kestanbolensis K4T seemed to be stable at pH values over 8.5 whereas the enzyme from K1 behaved differently, being stable at both pH 4.5 and 8.5 with 50 and 100% of its original activity, respectively. It has been reported that catecholase from T. roseum lost at least 50% of its original activity out of its optimum pH value (Kong et al. 2000). Effect of temperature on catecholase activity and stability Thermal activity data for both catecholase activities are presented in Figure 3. The optimum temperatures for catecholase activities of A. kestanbolensis K1 and K4T

100

Residual Activity (%)

Substrate

100

A. kestanbolensis K1 T A. kestanbolensis K4

80 60 40 20 0 2

4

6 Incubation pH

8

10

Figure 2. pH stabilities of both Anoxybacillus kestanbolensis K1 and K4T catecholases. The pH-stability was determined by incubating the enzyme extract in the different indicated buffers for 48 h at 4 °C. The activity was assayed under standard conditions; 50 mM glycine–HCl buffer, pH 3.5 and 4-methylcatechol as a substrate.

Diphenolases from Anoxybacillus kestanbolensis

505 activity for a period of 1 h incubation at its optimum temperature, the enzyme from K1 was stimulated by keeping at 80 °C. The thermostable tyrosinase from T. roseum was reported to be stable only 10 min at 70 °C (Kong et al. 2000). Therefore, both Anoxybacillus catecholases seemed to be highly thermostable at longer incubation times at 60–80 °C.

Relative Activity (%)

100

80

60

Effect of substrate concentration on catecholase activity

40 A. kestanbolensis K1 T A. kestanbolensis K4

20

0 0

20

40 60 Temperature (°C)

80

100

Figure 3. Temperature optima of both Anoxybacillus kestanbolensis K1 and K4T catecholases for 4-methylcatechol as a substrate. The reaction mixture at pH 3.5 containing all the reagents except crude enzyme was incubated for 5 min at indicated temperatures. After the enzyme was added, the relative activity was determined spectrophotometrically at 494 nm as rapidly as possible.

Substrate saturation curves in the presence of 4-methylcatechol indicated that both Anoxybacilllus catecholases follow simple Michaelis–Menten kinetics. Lineweaver–Burk plots for the kinetic analysis of the reaction rates, at a series of concentrations for 4-methylcatechol resulted in individual Vmax and Km values (Table 3). Catalytic efficiencies were very similar for both catecholases. These results indicate that both catecholases efficiently use 4-methylcatechol as substrate. A similar result was also reported for a crude tyrosinase from T. roseum. (Kong et al. 2000). Effect of inhibitors on catecholase activity

were 80 and 70 °C, respectively. It appears that the catecholase activity from A. kestanbolensis K4T is more sensitive to higher temperatures over 70 °C. The thermostable catecholases from both strains were also active at lower temperatures. A thermostable tyrosinase with an optimum temperature of 70 °C was also reported for T. roseum (Kong et al. 2000). The tyrosinase from T. roseum has been reported to loose its original acitivities rapidly at higher temperatures. Catecholases from both Anoxybacillus strains showed different thermal stability profiles (Figure 4). The enzymes were extremely stable over 1 h of incubation at their optimum temperatures. Although catecholase from A. kestanbolensis K4T retained all its original

160

Residual activity (%)

140 120 100 80

The behaviour of A. kestanbolensis K1 and K4T catecholases for four general polyphenol oxidase inhibitors was examined. Benzoic acid (0.01–5.00 mM), sodium metabisulphite (0.05–2.50 lM), ascorbic acid (0.05–10.00lM) and L -cysteine (0.05–4.00lM) were used as inhibitors. All the compounds used in this study inhibited the enzyme. Their potentials for the inhibition of A. kestanbolensis K1 and K4T catecholase activities are presented as I50 values calculated from the plots of inhibitor concentrations VS. percentage inhibition of 4methylcatechol oxidation (Table 4). Both A. kestanbolensis K1 and K4T catecholase activities were fully inhibited by addition of 0.01 mM sodium metabisulphite, ascorbic acid and L -cysteine. Inhibition assays indicate that thiol compounds, such as cysteine and metabisulphite with low I50 values, are potent inhibitors of the A. kestanbolensis K1 and K4T catecholases, consistent with the earlier reports about plant PPOs (Ding et al. 1998; Duangmal & Owusu Apenten 1999; Yang et al. 2000; Dincer et al. 2002). It has been also reported that sulphur-containing compounds such as bmercaptoethanol and diethyldithiocarbamate fully

60 A. kestanbolensis K1 T A. kestanbolensis K4

40

Table 3. Biochemical characteristics of catecholases from Anoxybacillus kestanbolensis K1 and K4T.

20 0 0

10

20 30 40 Incubation time (min)

50

60

Figure 4. Thermal stabilities of both Anoxybacillus kestanbolensis K1 and K4T catecholases. The enzyme solutions were incubated at temperatures of 80 and 70 °C, respectively for 20, 40 and 60 min, rapidly cooled in an ice-bath for 5 min and then brought to 25 °C. The percentage residual catecholase activity was calculated by comparison with unincubated enzyme.

Vmax (U/mg) Km for 4-methylcatechol (mM) Vmax/Km pH optimum Temperature optimum (°C)

A. kestanbolensis K1

A. kestanbolensis K4T

0.07 2.0

0.06 2.0

0.035 9.5 80

0.030 9.5 70

506

M. Yildirim et al.

Table 4. Inhibition of Anoxybacillus kestanbolensis K1 and K4T catecholases by general polyphenoloxidase inhibitors. Inhibitors (lM)

I50 A. kestanbolensis K1 A. kestanbolensis K4T

Benzoic acid Sodium metabisulphite Ascorbic acid L -Cysteine

600 1.63 6.40 1.35

470 0.64 1.37 3.30

inhibited T. roseum tyrosinase activity at the concentration of 1 mM (Kong et al. 2000). Effect of metal ions on catecholase activity The effect of various metal ions on the both A. kestanbolensis K1 and K4T catecholase activities is shown in Table 5. The concentrations of metal ions tested were all at 1 mM and enzyme activity was assayed under standard conditions. While Mn2+, Co2+ and Ca2+ stimulated both catecholases for 4-methylcatechol oxidation, Cu2+, Zn2+, Ni2+, Al3+, Cd2+, and Cr3+ inhibited their activities. The most dramatic effect on catecholases was seen in the presence of Mn2+. The catecholase activities increased 6.4- and 5.3-fold for A. kestanbolensis K1 and K4T enzymes, respectively, in the presence of 1 mM Mn2+. Since metal ions may have different coordination numbers, geometry in their coordination compounds, and potentials as Lewis acids, they may behave differently towards proteins as ligands. These differences may also result in metal binding to different sites, and therefore, perturb the enzyme structure in different ways (Bock et al. 1999; DiTusa et al. 2001). It could be speculated that Mn(II) may activate catecholase by binding to either an allosteric or a metal binding site on the enzyme structure. How Mn(II) interact with A. kestanbolensis catecholases and its stimulation of enzyme activity needs further investigation. It can be concluded that the crude extracts prepared from both A. kestanbolensis K1 and K4T possess

Table 5. Effect of various metal ions on both Anoxybacillus kestanbolensis K1 and K4T catecholase activities. Metal ion (1 mM)

None Co2+ Ca2+ Mn2+ Cu2 Zn2+ Ni2+ Al3+ Cd2+ Cr3+ K+

Relative activity (%) A. kestanbolensis K1

A. kestanbolensis K4T

100 153 112 641 30 22 15 26 45 35 107

100 126 103 532 27 27 13 11 36 26 92

± ± ± ± ± ± ± ± ± ± ±

2 3 2 6 2 2 1 1 1 1 2

± ± ± ± ± ± ± ± ± ± ±

2 2 3 5 2 2 1 1 1 1 2

diphenolases having greatest substrate specificity to 4-methylcatechol. These enzymes appear to share some biochemical characteristics of several plant or microorganismal PPOs in terms of substrate specificity, pH and temperature optima, stability and kinetic parameters. The catecholase activities from both strains were also very sensitive to some general PPO inhibitors especially metabisulphite and cysteine. Moreover, 1 mM Mn2+ stimulated catecholases from both strains by about 6-fold when compared to other metal ions.

Acknowledgements This work was financially supported by the KTU-BAP (Pr. Nr. 2003.111.002.3 to S.G., 1999.111.004.2 to A.O.B.) and The State Planning Organization of Turkish Government (DPT, Pr. Nr. 2001K12080010 to AOB).

References Ahmed, G. & Vulphson, E.N. 1994 Facile synthesis of L- DOPA esters by the combined use of tyrosinase and a-chymotrypsin. Biotechnology Letters 16, 367–372. Aktas, N. & Tanyolac, A. 2003 Reaction conditions for laccase catalyzed polymerization of catechol. Bioresource Technology 87, 209–214. Ali, S. & Haq, I. 2001 Studies on the microbiological transformation of L -tyrosine to L -DOPA (3,4-dihydroxyphenyl L-alanine) by mutant strains of Aspergillus oryzae. Pakistan Journal of Plant Science 6, 97–113. Arslan, O., Temur, A. & Tozlu, I. 1998 Polyphenol oxidase from Malatya apricot (Prunus armeniaca L.). Journal of Agricultural and Food Chemistry 46, 1239–1241. Beldu¨z, A.O., Du¨lger, S. & Demirbag, Z. 2003 Anoxybacillus gonensis sp. nov., a moderately thermophilic, xylose-utilizing, endosporeforming bacterium. International Journal of Systematic and Evolutionary Microbiology 53, 1315–1320. Bock, W.C., Katz, A.K., Markham, G.D. & Glusker, J.P. 1999 Manganese as a replacement for magnesium and zinc: functional comparison of the divalent ions. Journal of the American Chemical Society 121, 7360–7372. Burton, S.G. 1994 Biocatalysis with polyphenoloxidase: a review. Catalysis Today 22, 259–287. Colak, A., O¨zen, A., Dincer, B., Gu¨ner, S. & Ayaz, F.A. 2004 Diphenolases from two cultivars of cherry laurel (Laurocerasus officinalis Roem.) fruits at early stage of maturation. Food Chemistry (in press). Dincer, B., Colak, A., Aydın, N., Kadioglu, A. & Guner, S. 2002 Characterization of polyphenol oxidase from medlar fruits (Mespilus germanica L. Rosaceae). Food Chemistry 77, 1–7. Ding, C.K., Chachin, K., Ueda, Y. & Imahori, Y. 1998 Purification and properties of polyphenol oxidase from loquat fruit. Journal of Agricultural and Food Chemistry 46, 4144–4149. DiTusa, C.A., Christensen, T., McCall, K.A., Fierke, C.A. & Toone, E.J. 2001 Thermodynamics of metal ion binding.1. Metal ion binding by wild-type carbonic anhydrase. Biochemistry 40, 5338– 5344. Duangmal, K. & Owusu Apenten, R.K. 1999 A comparative study of polyphenoloxidases from taro (Colocasia esculenta) and potato (Solanum tuberosum var. Romano). Food Chemistry 64, 351–359. Du¨lger, S., Demirbag, Z. & Beldu¨z, A.O. 2004 Anoxybacillus ayderensis sp. nov. and Anoxybacillus kestanbolensis sp. nov. International Journal of Systematic and Evolutionary Microbiology (in press).

Diphenolases from Anoxybacillus kestanbolensis Espin, J.C., Morales, M., Varon, R., Tudela, J. & Garcia-Canovas, F. 1995 A continuous spectrophotometric method for determining the monophenolase and diphenolase activities of apple polyphenol oxidase. Analytical Biochemistry 43, 2807–2812. Espin, J.C., Trujano, M.F., Tudela, J. & Garcia-Canovas, F. 1997 Monophenolase activity of polyphenol oxidase from Haas avocado. Journal of Agricultural and Food Chemistry 45, 1091–1096. Fraignier, M.P., Marques, L., Fleuriert, A. & Macheix, J.J. 1995 Biochemical and immunochemical characteristics of polyphenol oxidases from different fruits of prunus. Journal of Agricultural and Food Chemistry 43, 2375–2380. Friedman, M. 1997 Chemistry, biochemistry, and dietary role of potato polyphenols. Journal of Agricultural and Food Chemistry 45, 1523–1540. Gilabert, M.P., Morte, A., Honrubia, M. & Carmona, F.G. 2001 Monophenolase activity of latent Terfezia claveryi tyrosinase: characterization and histochemical localization. Physiologia Plantarum 113, 203–209. Ikeda, R., Sugihara, J. Uyama H. & Kobayashi S. 1996a Enzymatic oxidative polymerization of 2,6-dimethylphenol. Macromolecules 29, 8702–8705. Ikeda, R., Uyama, H. & Kobayashi, S. 1996b Novel synthetic pathway to a poly(phenylene oxide). Laccase-catalyzed oxidative polymerization of syringic acid. Macromolecules 29, 3053–3054. Jacobson, E.S. 2000 Pathogenic roles of fungal melanins. Clinical Microbiology Reviews 13, 708–717. Kong, K.H., Hong, M.P., Choi, S.S., Kim, Y.T. & Cho, S.H. 2000 Purification and characterization of a highly stable tyrosinase from Thermomicrobium roseum. Biotechnology and Applied Biochemistry 31, 113–118. Laemmli, U.K. 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680– 685. Leite, O.D., Lupetti, K.O., Filho, O.F., Vieira, I.C. & Barbosa, A.M. 2003 Synergic effect studies of the bi-enzymatic system laccaseperoxidase in a voltammetric biosensor for catecholamines. Talanta 59, 889–896. Lineweaver, H. & Burk, D. 1934 The determination of enzyme dissociation constant. Journal of the American Chemical Society 56, 658–661.

507 Lisdat, F., Wollenberger, U., Makower, A., Ho¨rtnagl, H., Pfeiffer, D. & Scheller, F.W. 1997 Catecholamine detection using enzymatic amplification. Biosensors and Bioelectronics 12, 1199–1211. Mayer, A.M. & Harel, E. 1979 Polyphenoloxidase in plants. Phytochemistry 18, 193–215. Mayer, A.M. 1987 Polyphenol oxidase in plants-recent progress.2. Phytochemistry 26, 11–20. O¨zen, A., Colak, A., Dincer B. & Gu¨ner, S. 2004 A diphenolase from persimmon fruits (Diospyros kaki L., Ebenaceae). Food Chemistry 85, 431–437. Pandey, G., Muralikrishna, C. & Bhalerao, U.T. 1990 Mushroom tyrosinase catalyzed coupling of hindered phenols-a novelapproach for the synthesis of diphenoquionones and bisphenols. Tetrahedron Letters 31, 3771–3774. Robb, D.A. 1984 Tyrosinase. In Copper Proteins and Copper Enzymes, ed. Lontie, R., vol. 2. Boca Raton, FL: CRC Press. ISBN 0-84936471-X. Sheptovitsky, Y.G. & Brudving, G.W. 1996 Isolation and characterization of spinach photosystem II membrane-associated catalase and polyphenol oxidase. Biochemistry 35, 16255–16263. Streffer, K., Vijgenboom, E., Tepper, A.W.J.W., Makower, A., Scheller, F.W., Canters, G.W. & Wollenberger, U. 2001 Determination of phenolic compounds using recombinant tyrosinase from Streptomyces antibioticus. Analytica Chimica Acta 427, 201–210. Tu, Y.-F., Fu, Z.-Q. & Chen, H.Y. 2001 The fabrication and optimization of the disposable amperometric biosensor. Sensors and Activators B 80, 101–105. Uyama H. & Kobayashi S. 2002 Enzyme-catalyzed polymerization to functional polymers. Journal of Molecular Catalysis B: Enzymatic 19, 20, 117–127. Van Gelder, C.W.G., Flurkey, W.H. & Wichers, H.J. 1997 Sequence and structural features of plant and fungal tyrosinases. Phytochemistry 45, 1309–1323. Whitaker, J.R. 1972 Polyphenol oxidase. In Principles of Enzymology for the Food Sciences, ed. Fennema, O.R. New York, USA: Marcel Dekker, Inc. ISBN 0-824-71780-5 Yang, C.-P., Fujita, S., Ashrafuzzaman, M.D, Nakamura, N. & Hayashi, N. 2000 Purification and characterization of polyphenol oxidase from banana (Musa sapientum L.) pulp. Journal of Agricultural and Food Chemistry 48, 2732–2735.

World Journal of Microbiology & Biotechnology (2005) 21:509–514 DOI 10.1007/s11274-004-2393-z

Ó Springer 2005

Utilization of vegetable oil in the production of clavulanic acid by Streptomyces clavuligerus ATCC 27064 G.L. Maranesi, A. Baptista-Neto, C.O. Hokka and A.C. Badino* Department of Chemical Engineering, Universidade Federal de Saõ Carlos, Cx. Postal 676, CEP 13565-905 Saõ Carlos SP, Brazil *Author for Correspondence: Tel.: +55-16-3351-8001, Fax: +55-16-3351-8266, E-mail:[email protected] Keywords: Beta-lactamase inhibitor, clavulanic acid, lipid as substrate, soybean oil, Streptomyces clavuligerus, vegetable oil

Summary Production of clavulanic acid (CA) by Streptomyces clavuligerus ATCC 27064 in shake-flask culture (28 °C, 250 rev min)1) was evaluated, with media containing different types and concentrations of edible vegetable oil. Firstly, four media based on those reported in the literature were examined. The medium containing soybean oil and starch as carbon and energy source gave the best production results. This medium, with the starch replaced by glycerol, and with various soybean oil concentrations (16, 23 and 30 g l)1) was utilized to further investigate CA production. Medium containing 23 g l)1 led to the highest CA productivity (722 mg l)1 in 120 h) and that one containing 30 g l)1 gave the highest CA titre (753 mg l)1 in 130 h). Also, substitution of corn and sunflower edible oils furnished similarly good results in terms of CA titre and productivity. It can be concluded that easily available vegetable oil is a very promising substrate for CA production, since it is converted slowly to glycerol and fatty acids, which are the main carbon and energy source for the microorganism.

Introduction The use of antibiotics to control infectious diseases is greatly hindered by bacterial resistance. One of the most important resistance mechanisms exhibited by a variety of Gram-positive and Gram-negative bacteria is their ability to produce beta-lactamases, which inactivate penicillins and cephalosporins by hydrolysing their beta-lactam ring. Clavulanic acid, (CA), is a betalactam antibiotic with a low antibacterial activity; it is, however, a potent inhibitor of the beta-lactamases produced by many pathogenic microorganisms resistant to beta-lactam antibiotics (Butterworth 1984). The combination of CA with amoxicillin is the most successful example of the use of a beta-lactam antibiotic sensitive to beta-lactamase together with an inhibitor of these enzymes (Mayer & Deckwer 1996). CA is produced industrially by strains of Streptomyces clavuligerus (Butterworth 1984) in medium containing soybean flour as nitrogen source and soluble starch together with glycerol as carbon and energy sources. S. clavuligerus was first named and described as a new species by Higgens & Kastner (1971) from a Streptomycetes strain isolated from South American soil. These authors performed physiological tests and investigated carbonutilization patterns and found that, among the 13

carbon sources tested, including glucose, sucrose and fructose, only one, maltose, showed positive utilization. Brown et al. (1976) reported the isolation of CA, and Reading & Cole (1977) described the conditions for the cultivation of the organism and detection and isolation of this novel beta-lactamase inhibitor. Since then much research has been published dealing with the biosynthetic pathway, molecular genetics, regulation and physiology of CA production by S. clavuligerus. Aharonowitz & Demain (1978) found glycerol to be a substrate for growth and antibiotic production. They studied the effect of increasing glycerol concentration and observed that glycerol was the factor limiting growth in a medium containing L -asparagine as nitrogen source. Based in this work, Garcia-Dominguez et al. (1989) suggested that S. clavuligerus cells are unable to carry out active transport of glucose. Glycerol has been extensively utilized as the carbon source in this process with CA titres up to 3.25 g l)1 being reported (Mayer & Deckwer 1996; Gouveia et al. 1999; Kim et al. 2001; Chen et al. 2002; Roubos et al. 2002). The role of glycerol as a CA precursor and an inhibitor of CA production rate has been speculated upon (Romero et al. 1984; Chen et al. 2002). According to the review work of Liras & Rodriguez-Garcia (2000), the pathway of CA biosynthesis is now partially understood, with the

510 isolation of intermediates and labelling studies, complemented by the purification and characterization of enzymes and genetic studies; labelled glycerol is incorporated into carbons C-5 to C-7 of the CA molecule while arginine is incorporated into carbons C-2, C-3 and C-8 to C-10. Glyceraldehyde 3P appears to be the immediate precursor of the C-3 unit. Indeed, Townsend (2002), in a review paper, states that ‘‘A battery of whole-cell incorporation and stereochemical experiments has already established the origin of these three carbons as likely in a C3 carbohydrate related to glycolysis and lying between glycerol and phosphoenolpyruvate’’. On the other hand, Perez-Redondo et al. (1999) show evidence for two different genes involved in the formation of the C3 unit, suggesting that an alternative gene product catalyses the incorporation of glycerol into CA. Their finding was based on experiments with a pyc (for pyruvate-converting) replacement mutant which was unable to produce CA except in glycerol-containing medium. Furthermore, Mellado et al. (2002) have recently identified seven additional genes related to CA biosynthesis or regulation, but suggest that further studies are necessary to elucidate their function. Apart from the actual role of glycerol, or any of the glycolytic pathway intermediates, in the rate of CA biosynthesis, glycerol is regarded as a ratelimiting substrate and a component of primary importance in this process. Indeed, Romero et al. (1984) observed the dissociation of cephamycin and CA biosynthesis by glycerol limitation; in the absence of glycerol, no CA was formed and a maximal production rate was found with 110 mM glycerol, reducing with further increase in glycerol concentration. During fermentation, high levels of CA, like other secondary metabolites, are achieved after most of the growth has occurred (Martin & Demain 1980). Fed-batch culture with a glycerol or complete medium feed is frequently proposed, to extend the CA production phase while minimizing both the inhibitory effect of glycerol on productivity and also the CA degradation rate (Mayer & Deckwer 1996; Roubos et al. 2002). An alternative to maintaining the level of glycerol for long periods is substituting lipids for glycerol, as suggested by Butterworth (1984). So far only two pieces of work in the literature deal with the use of lipids in the CA production process by S. clavuligerus (Lee & Ho 1996; Large et al. 1998). According to Large et al. (1998), the addition of oil is preferred on an energy basis, as typical oil contains around 2.4 times the energy of glucose. It can also act as antifoam and enhance secondary metabolism. These authors report CA production in relation to the viscosity of the medium. Their results suggest production of approximately 80 mg CA l)1, with a medium containing an unspecified lipid. Lee & Ho (1996), working with various carbon sources, including fatty acids and palm oil, obtained higher titres (ca. 5 mg l)1 CA) with palm oil. In the present work, the effect of various edible vegetable oils, added to an inexpensive medium with soybean flour as the

G.L. Maranesi et al. nitrogen source, on CA production was investigated and compared with results found in the literature. Materials and methods Microorganism and cultivation conditions S. clavuligerus ATCC 27064 was used throughout this work. Vegetative cells were stored at )70 °C in cryotubes with 10% (v/v) glycerol. Seed medium contained (in g l)1 distilled water): glycerol, 10; bacto peptone, 10; malt extract, 10; yeast extract, 1.0; K2HPO4, 2.5; MgSO4Æ7H2O, 0.75; MnCl2Æ4H2O, 0.001; FeSO4Æ7H2O, 0.001; ZnSO4Æ7H2O, 0.001; the pH was adjusted to 6.8, prior to sterilization. Inoculum medium had the same composition as production medium, as described below. Four different production media, designated #1 to #4, based respectively on those reported by Reading & Cole (1977), Mayer & Deckwer (1996), Large et al. (1998) and Laat & Kraben (2000) were tested. The media had the following compositions (in g l)1 distilled water). Medium #1: dextrin, 20; soybean flour, 10; malt extract, 1.0; FeSO4Æ7H2O, 0.1; MOPS buffer, 21 (100 mM); pH 7.0. Medium #2: glycerol, 15; bacto peptone, 10; soybean flour, 30; MOPS buffer, 21, pH 6.5. Medium #3: soluble starch, 10; soybean flour, 20; soybean oil, 23; K2HPO4, 1.2; MOPS buffer, 21; MnCl2Æ4H2O, 0.01; FeSO4Æ7H2O, 0.01; ZnSO4Æ7H2O, 0.01, pH 7.0. Medium #4: glycerol, 15; soybean flour, 20; Samprosoy 90NB (soybean protein hydrolyzate from Ceval Alimentos S.A., Esteio RS, Brazil), 2.5; K2HPO4, 0.80; MOPS buffer, 21; MnCl2Æ4H2O, 0.001; FeSO4Æ7H2O, 0.001; ZnSO4Æ7H2O, 0.001; CaCl2, 0.001; pH 7.0. Subsequently, variants of medium #3 were tested, in which, first, the carbon source was changed (glycerol instead of starch) and, later, the concentration and origin of vegetable oils. Cell suspensions (3.5 ml), with a concentration of ca. 5 g dry matter l)1 were inoculated into 50 ml seed medium in a 500 ml Erlenmeyer flask and incubated at 28 °C and shake at 250 rev min)1 for 24 h. Five ml of the cultivated seed broth was transferred to 45 ml of inoculum medium and incubated at 28 °C, 250 rev min)1 for 24 h in a 500 ml shake flask. The culture obtained was then inoculated in a 3-l flask containing 450 ml of production medium, and 50 ml of this inoculated medium was transferred to each of several 500 ml Erlenmeyer flask. Cultivations were performed in orbital shaker (New Brunswick Sci. Inc.) at 28 °C, 250 rev min)1, for 120–160 h, and one flask was removed every 12 h for the determination of cell growth and substrate and product concentrations. Analytical methods Cell growth was determined indirectly by measuring the broth rheological parameter K (consistency index) using a Brookfield concentric-cylinders rheometer.

511

Vegetable oil in the production of clavulanic acid Glycerol concentration was determined spectrophotometrically by a chemical method proposed by Lambert & Neish (1950). CA concentration was determined by measuring spectrophotometrically a derivative obtained by the reaction of CA with imidazole, as proposed by Bird et al. (1982). The assay results were checked by a highperformance liquid chromatography (HPLC) method, as described by Foulstone & Reading (1982) and bioassay with Klebsiella pneumoniae ATCC 29665 (Romero et al. 1984). CA from DSM Gist Delft (potassium clavulanate and silicon dioxide 1:1) was utilized as standard.

Results Initially, cultivations were carried out in the four different production media based on published accounts: media #1, #2, #3 and #4 described in Materials and methods. Time courses of the consistency index of the broth, K, and the CA concentration are shown in

(a)

60

Medium #1 Medium #2 Medium #3 Medium #4

K (dina.cm-2 .sn)

50 40 30 20 10 0 0

20

40

60

80

100

120

Time (h)

Figure 1. The rheological parameter in Figure 1a shows that the best growth was accomplished with medium #3, in which soybean oil, together with soluble starch were added as carbon source. Also, for CA production, the highest titre was achieved with this medium (Figure 1b). The authors referred to report CA titres with medium #1, #2, #3 and #4 of approximately 200, 300, 80 and 300 mg l)1, respectively. Differences from our results can be explained by the different strains utilized and also by different means of preservation and propagation of the microorganism (Sanchez & Brana 1996; Neves et al. 2001). The enhanced production achieved in the present work with medium #3 containing soybean oil, similar to that utilized by Large et al. (1999) with 10 g soluble starch l)1 and 23 g of an unspecified oil l)1 is worth mentioning. A maximum concentration of 458 mg l)1 was obtained against ca. 80 mg l)1 by Large et al. (1998). Soybean oil may have contributed to the enhanced titre. Growth was evaluated in terms of the rheological parameter K (consistency index), which is similar to that described by these authors, who calculated the apparent viscosity in order to follow the growth characteristics. It is observed that medium #3 gave both the fastest growth rate and the highest cell concentration. Since the best production was attained with medium #3, containing starch and soybean oil, a new medium #5 was prepared by replacing starch with more soybean oil, so that the initial oil concentration was 28 g l)1, to give the same amount of carbon in both media. Figure 2 shows the results obtained with the new medium and it can be observed that a higher concentration of CA, 478 mg l)1, was achieved. However, a longer time was required (120 h) since the reduced availability of glycerol resulted in slower growth, as indicated by the low consistency index K. To improve the availability of carbon source during the growth phase, media with glycerol (10 g l)1), instead of the starch of medium #3, were prepared with three

(b) 500

Medium #1 Medium #2 Medium #3 Medium #4

30

CCA

300

200

100

25

K

400

20

300

15

200

10

100

5

K (dina.cm-2 .sn)

500

CCA(mg. L-1)

CCA (mg.L-1)

400

600

0 0

20

40

60

80

100

120

Time (h)

0 0

20

40

60

80

100

120

0 140

Time (h) Figure 1. Time course of (a) rheological parameter K (consistency index) related to cell growth and (b) Clavulanic Acid concentration, CCA from cultivation of S. clavuligerus ATCC 27064 in Medium #1 (Reading & Cole 1977), Medium #2 (Mayer & Deckwer 1996), Medium #3 (Large et al. 1999), and Medium #4 (Laat & Krabben 2000).

Figure 2. Time course of the rheological parameter K (consistency index) related to cell growth and Clavulanic Acid concentration, CCA from cultivation of S. clavuligerus ATCC 27064 in Medium #5, containing 28 g of soybean oil l)1.

512

G.L. Maranesi et al.

levels of soybean oil: medium #6, medium #7 and medium #8 with 16, 23 and 30 g l)1 of oil respectively. Figure 3 shows the time course of (a) glycerol consumption, (b) growth as indicated by changes in the consis(a)

18

Medium #6 Medium #7 Medium #8

16 14

CGly (g.L-1)

12 10 8 6 4 2 0 0

10

20

30

40

50

Time (h) (b)

60


K (dina.cm-2 .sn)

50

Discussion

40 30 20 10 0 0

20

40

60

80

100

120

140

160

120

140

160

Time (h) (c)

800


700 600

CCA(mg.L-1)

tency index K, and (c) CA concentrations for the three media. It is observed that glycerol consumption was fastest in medium containing 23 g oil l)1, and although in medium #6 a peak in the consistency index occurred, growth and oil content are apparently unrelated. However, CA production rate was highest in the medium containing 23 g l)1 of oil, while the greatest concentration (753 mg l)1 in 130 h) was obtained with medium containing 30 g l)1, against 722 mg l)1 at 120 h cultivation time with medium #7 (23 g l)1). To investigate the effect of the origin of the oil on the production of CA, two experiments were performed with two media containing 23 g of another edible oil l)1 instead of the soybean oil of medium #7, one of them with sunflower oil and the other with corn oil. Figure 4 shows the time course of glycerol consumption, growth and CA production for each oil. It can be seen that the behaviour was very similar to that found with medium #7. Maximal growth was achieved in ca. 60 h and CA titres were around 700 mg l)1 in 120 h. Figure 4 shows the results of these experiments.

500 400 300 200 100 0 0

20

40

60

80

100

Time (h) Figure 3. Time course of (a) the glycerol consumption, (b) rheological parameter K (consistency index), related to cell growth and (c) Clavulanic Acid concentration, CCA, in cultivations of S. clavuligerus ATCC 27064 in Medium #6 (16 g of soybean oil l)1), Medium #7 (23 g l)1), Medium #8 (30 g l)1).

The results of the first group of experiments, in which the organism was cultivated in four different media described in the literature, showed a remarkable enhancement, both in growth and CA titre, when soybean oil (23 g l)1) together with soluble starch (10 g l)1) are the carbon sources, in comparison with media containing no lipid. It should be mentioned that the strain and experimental apparatus and conditions were exactly the same for all experiments. Furthermore, the results of the experiment carried out with a modified form of this medium, in which the soluble starch was replaced with more soybean oil, show that production remained high. However, it was delayed, presumably due to the low solubility of oil and consequently lower availability of carbon source for growth (Figure 2). The slow formation of glycerol, which is a product of the enzymatic hydrolysis of lipid, was reflected in low growth, inferred from the low consistency index (K) attained. Results obtained in media containing glycerol and three different quantities of soybean oil showed that, since glycerol is rapidly consumed for growth during the trophophase and lipid is slowly metabolized to produce glycerol and fatty acids for cell maintenance during the idiophase, CA production is remarkably improved, indicating that glycerol plays an important part in this process, being the preferred carbon source for growth, the precursor of the CA molecule and, when in excess, an inhibitor of the CA production. Roubos et al. (2001) take into account this last phenomenon in the development of a Semi-Stoichiometric Fed-Batch model. These authors state, ‘‘It was decided to set the specific CA production rate to zero when the glycerol concentration becomes above 0.7 Cmol/L’’. Furthermore, according to Large et al. (1999), ‘‘once inside the cell, the fatty

513

Vegetable oil in the production of clavulanic acid (a)

16

Medium #9 Medium #10

14

CGly (g.L-1)

12 10 8 6 4 2 0 0

10

20

30

40

50

60

70

100

120

140

Time (h) (b)

60


K (dina.cm-2 .sn)

50 40 30 20 10 0 0

20

40

60

80

Time (h) (c)

(30 g l)1), and faster production rate, at somewhat intermediate oil concentration (23 g l)1), should be found and established for this process. Certainly the results obtained here in shake flasks can be improved in large-scale conventional fermentors. The results of the experiments with 23 g of edible corn and sunflower oil l)1 showed a very similar behaviour to those obtained with soybean oil, suggesting that any common easily available edible oil is perfectly adequate for this process. The maximum CA concentration found in the cultivations performed in this work is much higher than those reported, so far, in the literature with lipids as carbon source and even than those obtained with other types of media, analytical procedures and bacterial strain storage and preservation conditions. In the present work, the analytical method performed avoided overestimation since Bird’s method excludes interference from other substances, mainly CA degradation products and medium components. Moreover, the maximum concentrations found were checked by HPLC (Foulstone & Reading 1982) and bioassay against Klebisella pneumoniae ATCC 29665. The HPLC peaks were checked in a Photo Diode Array Detector (Waters PAD model 996) and the u.v. spectrum was scanned and compared with that of the pure CA salt. Concerning the long-term preservation of the Streptomycete strain, lyophilized mycelium was prepared according to Sanchez & Brana (1996). From the results presented here, it can be concluded that edible oil is a very promising substrate to be used in the CA production process as its intrinsic characteristics allow an adequate supply of glycerol and carbon source.

800


700

Acknowledgements

600

This work was supported by FAPESP (Grant Proc. 02/ 00189-1 and Proc. 03/11722-5) and CNPq, Grant Proc. 523467/94-0.

CCA (mg.L-1)

500 400 300 200

References

100 0 0

20

40

60

80

100

120

140

Time (h) Figure 4. Time course of (a) the glycerol consumption, (b) rheological parameter K (consistency index) related to cell growth and (c) CA concentration, CCA in cultivations of S. clavuligerus ATCC 27064 in Medium #9 (23 g of corn oil l)1), Medium #10 (23 g of sunflower oil l)1).

acids enter the b-oxidation cycle to release acetyl or propionyl coenzyme A, which are the precursors for the formation of many antibiotics’’. This may also account for the high CA titres obtained when lipids are utilized. From an economical point of view, a compromise between higher titre, at higher oil concentration

Aharowitz, Y. & Demain, A.L. 1978 Carbon catabolite regulation of cephalosporin production in Streptomyces clavuligerus. Antimicrobial Agents and Chemotherapy 14, 159)164. Bird, A.E., Bellis, J.M. & Gasson, B.C. 1982 Spectrophotometric assay of CA by reaction with imidazole. Analyst 107, 1241–1245. Brown, A.G., Butterworth, D., Cole, M., Hanscomb, G., Hood, J.D., Reading, C. & Roinson, G.N. 1976 Naturally occurring blactamase inhibitors with antibacterial activity. The Journal of Antibiotics 29, 668–669. Butterworth, D. 1984 CA: properties, biosynthesis and fermentation. In Biotechnology of Industrial Antibiotics, ed. Vandamme, E.J. New York: Marcel Dekker. ISBN 0824770560. Chen, K.C., Lin, Y.H., Tsai, C.M., Hsieh, C.H. & Houng, J.Y. 2002 Optimization of glycerol feeding for CA production by Streptomyces clavuligerus with glycerol feeding. Biotechnology Letters 24, 455–458. Foulstone, M. & Reading, C. 1982 Assay of amoxicillin and CA, the components of Augmentin, in biological fluids with HPLC. Antimicrobial Agents and Chemotherapy 22, 753–762.

514 Garcia-Dominguez, M., Martin, J.F. & Liras, P. 1989 Characterization of sugar uptake in wild-type Streptomyces clavuligerus, which is impaired in glucose uptake, and in a glucose-utilizing mutant. Journal of Bacteriology 171, 6808–6814. Gouveia, E.R., Baptista-Neto, A., Azevedo, A.M., Badino, A.C., & Hokka, C.O. 1999 Improvement of CA production by Streptomyces clavuligerus in medium containing soybean derivatives. World Journal of Microbiology and Biotechnology 15, 623–625. Higgens, C.E. & Kastner, R.E. 1971 Streptomyces clavuligerus sp. nov., a b-lactam antibiotic producer. International Journal of Systematic Bacteriology 21, 326–331. Kim, I.C., Kim, C.H., Hong, S.I. & Kim, S.W. 2001 Fed-batch cultivation for the production of CA by an immobilized Streptomyces clavuligerus mutant. World Journal of Microbiology and Biotechnology 17, 869–872. Laat, W.T.A.M. & Krabben, P. 2000 Fermentation process to produce CA at low concentration of free aminoacids. Patent Number WO0001840 A. Lambert, M. & Neish, A.C. 1950 Rapid method for estimation of glycerol in fermentation solutions. Canadian Journal of Research 28, 83–89. Large, K.P., Ison, A.P. & Williams, D.J. 1998 The effect of agitation rate on lipid utilization and CA production in Streptomyces clavuligerus. Journal of Biotechnology 63, 111–119. Large, K.P., Mirjalili, N., Osborne, M., Peacock, L.M., Zormpaidis, V., Walsh, M., Cavanagh, M.E., Leadlay, P.F. & Ison, A.P. 1999 Lipase activity in Streptomycetes. Enzyme and Microbial Technology 25, 569–575. Lee, P.C. & Ho, C.C. 1996 Production of CA and cephamycin C by Streptomyces clavuligerus. World Journal of Microbiology and Biotechnology 12, 73–75. Liras, P. & Rodriguez-Garcia, A. 2000 CA, a b-lactamase inhibitor: biosynthesis and molecular genetics. Applied Microbiology and Biotechnology 54, 467–475. Martin, J.F. & Demain, A. 1980 Control of antibiotic biosynthesis. Microbiological Reviews 44, 230–251.

G.L. Maranesi et al. Mayer, A.F. & Deckwer, W.D. 1996 Simultaneous production and decomposition of CA during Streptomyces clavuligerus cultivation. Applied Microbiology and Biotechnology 45, 41–46. Mellado, E., Lorenzana, L.M., Rodriguez-Saiz, M., Diez, B., Liras, P. & Barredo, J.L. 2002 The CA biosynthetic cluster of Streptomyces clavuligerus: genetic organization of the region upstream of the car gene. Microbiology 148, 1427–1438. Neves, A.A., Vieira, L.M. & Menezes, J.C. 2001 Effects of preculture variability on CA fermentation. Biotechnology and Bioengineering 72, 28–633. Perez-Redondo, R., Rodriguez-Garcia, A., Martin, J.F. & Liras, P. 1999 Deletion of the pyc Gene blocks CA biosynthesis except in glycerol-containing medium: evidence for two different genes in formation of the C3 unit. Journal of Bacteriology 181, 6922– 6928. Reading, C. & Cole, M. 1977 CA: a b-lactam from Streptomyces clavuligerus. Antimicrobial Agents and Chemotherapy 11, 852–857. Romero, J., Liras, P. & Martin, J.F. 1984 Dissociation of cephamycin and CA biosynthesis in Streptomyces clavuligerus. Applied Microbiology and Biotechnology 20, 318–325. Roubos, J.A., Krabben, P., Luiten, R.G.M., Babuska, R. & Heijnen, J.J. 2001 A semi-stoichiometric model for a Streptomyces fed-batch cultivation with multiple feeds. In Computer Applications in Biotechnology 2001, Vol 8, eds. Dochain, D. & Perrier, M. Quebec City, Canada: ISBN 0080436811. Roubos, J.A., Krabben, P., Luiten, R.G.M., Laat, W.T.A.M., Babuska, R. & Heijnen, J.J. 2002 CA degradation in Streptomyces clavuligerus fed-batch cultivations. Biotechnology Progress 18, 451–457. Sanchez, L. & Brana, A.F. 1996 Cell density influences antibiotic biosynthesis in Streptomyces clavuligerus. Microbiology 142, 1209– 1220. Townsend, C.A. 2002 New reactions in CA biosynthesis. Current Opinion in Chemical Biology 6, 583–589.

World Journal of Microbiology & Biotechnology (2005) 21:515–518 DOI 10.1007/s11274-004-2394-y

Springer 2005

Cytogenetic analysis of metaphase chromosomes from pupal testes of four mosquito species using fluorescence in situ hybridization technique (FISH)q Fatma A.E. Sallam1,* and Refaat G. Abou El Ela2 1 Zoology Department, Faculty of Women for Arts, Science and Education, Ain Shams University, Cairo, Egypt 2 Entomology Department, Faculty of Science, Cairo University, Cairo, Egypt *Author for correspondence: Tel.: +202-010-5700416; Fax: +202-4857000, E-mail: fifi[email protected] Keywords: Aedes aegypti, Aedes albopictus, Aedes triseriatus, Culex pipiens, fluorescence in situ hybridization tags, metaphase chromosomes, pupal testes

Summary The DNA probes, P1887, P2405, P2056 (being specific tags for Aedes aegypti genes coding for ribosomal RNA) and a centric heterochromatin probe, K20-1A5, were chosen to hybridize the metaphase chromosomes from the testes of four mosquito species, Culex pipiens, Aedes aegypti, Aedes albopictus and Aedes triseriatus. In addition, a single plasmid, P2392, which contained the three probes, P1887, P2405 and P2056, was also used as chromosome landmark in aedine species. Only the Aedes aegypti metaphase chromosome 1-specific tag, P1887, was conserved in Aedes albopictus, Aedes triseriatus, and Culex pipiens metaphase chromosomes. Aedes triseriatus exhibited two gene loci, on chromosomes 1 and 3, coding for ribosomal RNA per haploid genome. When the specific probes for chromosomes 2 and 3, 2405 and 2056, were used in the fluorescence in situ hybridization technique against the metaphase chromosomes the fluorescent signals were not seen in Aedes albopictus, Aedes triseriatus or Culex pipiens. Also the centric heterochromatin probe, K20-1A5, exhibited strong fluorescent signals on chromosomes 1, 2 and 3 of Aedes aegypti. These fluorescent signals were not observed in metaphase chromosomes derived from the other aedine species, indicating that the centromere sequence can vary within the species.

Introduction Malaria, filariasis and dengue fever are the three major causes of morbidity and mortality in developing countries. Disease caused by arboviral, filarial and malarial parasites are transmitted to humans by mosquitoes from the sub-families Culicinae and Anophelinae. A great deal of information has accumulated on chromosome numbers and heterochromatin distribution, as well as genomic size and organization, in the mosquito family Culicidae, since the inheritance of filarial vector competence as a sex-linked recessive trait was first demonstrated by MacDonald (1962a, b). Genera of Anophelinae have heteromorphic sex chromosomes, of small genomic size and repetitive elements, which are distributed in a long-period interspersion pattern. In contrast, genera of Culicinae q This paper was presented at the Second Arab Conference on Biotechnology and Genetic Engineering, held in the Kingdom of Bahrain, 15–17 April, 2002 and is published here with the endorsement of the Co-ordinator of the Scientific Committee, Professor Essam H. Ghanem, University of Bahrain. Its publication has been delayed because of the ill health of the senior author. Other papers from this conference were published in the July 2003 issue (vol. 19, no. 5).

have homomorphic sex chromosomes and repetitive DNA organized in a short period interspersion pattern (Kumar & Rai 1990). Aedes aegypti and Anopheles gambiae are the two most studied mosquito species. Aedes belongs to the sub-family Culicinae and has a genomic organization more similar to human genome whereas Anopheles belongs to the sub-family Anophelinae and has a genomic organization similar to Drosophila (Knudson et al. 1996). Application of the fluorescence in situ hybridization technique, FISH, in biological studies has expanded rapidly since the introduction of the technique by Rudkin & Stollar (1977). This technique has several advantages over hybridization with isotopically labelled probes, i.e. spatial resolution, speed and probe stability. A variety of probe-labelling schemes are available for simultaneous detection of different chromosomal subregions in the same nucleus and in the entire chromosomes. Chromosomal sub-regions can be specifically highlighted in different colours depending on the probes used. Probe-labelling and fluorescent reagents make the FISH procedure straightforward and reliable (Nederlof et al. 1990; Trask 1991). Standard FISH techniques were employed for visualizing the position of hybridized

516

F.A.E. Sallam and R.G.A. El Ela

probes on the extended DNA strands through fluorescence microscopes (Parra & Windle 1993). A genetic map for Anopheles gambiae was constructed either by in situ hybridization of genetic markers to polytene chromosomes or by hybridization of genetic markers to polytene divisional pools (Zheng et al. 1993, 1996; Dimopoulos et al. 1996). The physical map for Aedes aegypti was difficult to generate because it did not yield usable polytene chromosomes. Brown & Knudson (1997) constructed a single landmark probe from repetitive DNA that uniquely marked each of the three chromosomes with paired signals and with distinct signal intensity. The aim of the present work was to determine whether, using the FISH technique, the specific tags for Aedes aegypti genes coding for ribosomal RNA and the centric heterochromatin probe would be useful and applicable as chromosome markers to other related mosquito species. Materials and methods Preparation of metaphase chromosomes Metaphase chromosomes were prepared from pupal testes of four mosquito species :Culex pipiens, Aedes aegypti, Aedes albopictus, and Aedes triseriatus using standard cytogenetic procedures of French et al. (1962), except that cholchicine treatment was omitted in the present work to avoid its toxicity. In situ hybridization, microscopy and digital imaging Laboratory protocols for in situ hybridization reactions have been described in detail elsewhere (Ausubel et al. 1998; Brown et al. 1995). Briefly, probes were labelled with biotin-14-deoxyadenosine-5-triphosphate (biotin14-dATP) using standard nick translation procedures. The labelled probes were sized to 100–500 bp (10 lg), precipitated denatured by boiling at 80 C for 10 min, and allowed to reanneal at 37 C for 30 min. Slides containing metaphase chromosomes were treated separately to denature the chromosomal DNA, the preannealed probe was added to the slide, and hybridization occurred overnight. The excess probe was removed from the slides by several washes. The slides were blocked

with 3% bovine serum albumin in 4· saline sodium citrate (SSC) (1:1, v/v) and the biotinylated probe was detected with FITC-conjugated avidin and any excess was removed by a brief wash. The slides were counterstained with 4-,6-diamidino-2-phenylinodle (DAPI ; 0.2 lg ml)1) and stored at 4 C until examined optically. To simplify orientation of the chromosomes and signal measurements, a single plasmid, P2392 containing the chromosomal landmarks (Brown & Knudson 1997) was also nick-translated with digoxigenin 11-deoxyuradine 5-triphosphate (digoxigenin-11-dUTP), added to the preannealed probe mix, and detected using rhodamineconjugated anti-digoxigenin. Digital images were captured of the DAPI, FITC, and rhodamine-stained images using a cooled-array charged coupled device (CCD) and they were processed as described previously (Brown et al. 1995; Brown & Knudson 1997). Nonoverlapping chromosome spreads were examined for the position and intensity of the landmark probe and test FISH signals. Measurements were made of the short arm (p-arm), long arm (q-arm), and the total chromosome length; the FISH signal position was expressed as a percentage of fractional length (% FL) from the smaller arm or p-arm terminus (pter) relative to the total length of the chromosome (% FLpter). Results The centromeric positions and lengths of the three chromosomes in the four mosquito species under investigation are given in Table 1. When the specific tag for genes coding for ribosomal RNA (P1887) on chromosome 1 was used as a FISH probe to metaphase chromosomes, the signals were observed as broad bands at 70, 71.4 and 69.5% FLpter of chromosome 1 of Aedes aegypti, Aedes albopictus and Culex pipiens, respectively (Figure 1a, b and d) (FLpter is the percentage of fractional length, %FL, from the smaller arm or p-arm terminus, pter, relative to the total length of the chromosome). In addition, Aedes triseriatus had signals on chromosomes 1 and 3, indicating that two ribosomal RNA loci per haploid genome were present (Figure 1c). When the specific tag for chromosome 2 genes, coding for ribosomal RNA, P2405, was used, the FISH signals were found only on the three pairs of chromosomes of Aedes aegypti (Figure 1f).

Table 1. Chromsome measurements of mosquito species. Species

Aedes aegypti Aedes Albopictus Aedes triseriatus Culex pipiens

Chromosome 1 (Shortest)

Chromosome 2 (Longest)

Chromosome 3 (Intermediate)

Length (lm)

Centromere position

Length (lm)

Centromere position

Length (lm)

Centromere position

9.4 11.4 9.6

Metacentric Submetacentric Slightly submetacentric Metacentric

12.6 17.7 11.4

Metacentric Submetacentric Submetacentric

11.5 15.6 10.3

Submetacentric Metacentric Submetacentric

10.0

Slightly submetacentric

7.8

6.2

Metacentric

Cytogenetic analysis of metaphase chromosomes

517

Figure 1. FISH landmark probes to Aedes aegypti, Aedes albopictus, Aedes triseriatus and Culex pipiens metaphase chromosome spreads. FISH of the tagging clone P1887 is depicted in merged images that include FISH hybridization, using the P2392 probe. The digital images for chromosome 1 are coloured and merged by software to yield the composite final images (a–d). FISH of the tagging clones, P1887, 2405 & 2056 are depicted in merged images that include FISH hybridization using the P2392 probe. The digital images for Aedes aegypti chromosomes 1, 2 and 3 are coloured and merged by software to yield the composite final images (e–g). FISH of the K20-1A5 probe is depicted in merged images that include FISH hybridization using the P2392 probe. The digital images for chromosome 1 are coloured and merged by software to yield the composite final images (h–k).

Also, when the specific tag for chromosome 3 genes coding for ribosomal RNA (P2056) was used, the FISH signals were only located on chromosome 3 of Aedes aegypti (Figure 1g). On the other hand, when the landmark probe, P2392, was used, a strong signal was noticed in chromosome 1. The next most intense signal was on chromosome 2 and the weaker signal was on chromosome 3 of Aedes aegypti (Figure 1e–g). Also the centric heterochromatin probe K20-1A5 exhibited strong signals on the three pairs of chromosomes of Aedes aegypti (Figure 1h). No signals were recorded in Aedes albopictus, Aedes triseriatus and Culex pipiens metaphase chromosomes when P2405, P2056, P2392 and K20-1A5 were used as FISH tags (Figure 1b–d, i–k).

Discussion The conservation of genes coding for ribosomal RNA in the four mosquito species has been confirmed using the FISH probe, P1887. On the other hand, P2405 and P2056, used as specific probes of genes coding for

ribosomal RNA of chromosomes 2 and 3 in Aedes aegypti, showed no similarity with the sequences found in Aedes albopictus, Aedes triseriatus and Culex pipiens. The three specific FISH tags for chromosomes 1, 2 and 3 (P1887, P2405 and P2056) together form the cosmid P2392 that contains a repetitive sequence in Aedes aegypti (Brown & Knudson 1997). The results of this work showed that P2392-tagging reagent could be used successfully as a landmark FISH probe, which allowed the chromosomes and the chromosomal arms to be identified in such a way that determined the location of the genetic marker sequences accurately and quickly in Aedes aegypti. On the other hand, this P2392-tagging reagent did not work as a chromosome marker in Aedes albopictus, Aedes triseriatus and Culex pipiens. The results of this work agree with those of Kumar & Rai (1990) who demonstrated two genes for ribosomal RNA in chromosomes 1 and 3 of 20 mosquito species belonging to eight genera of sub-families Culicinae and Anophelinae. The conservation of the genes coding for ribosomal RNA in mosquitoes has been confirmed using FISH by Marchi & Pili (1994) and Ferguson et al. (1996). They demonstrated that those genes are localized

518 on the heterochromatic arm of both sex chromosomes in Anopheles genus and on the short arm of chromosome 1 in a region proximal to the centromere in Culex pipiens and in the middle of chromosome 1 in Aedes aegypti. During the last 10 years, the FISH technique has been used to localize genes coding for ribosomal RNA on the chromosomes of different insects belonging to order Diptera (Marchi & Pili 1994; Brown & Knudson 1997; Willhoeft 1997; Nunamaker et al. 1999; Brown et al. 2000). Eukaryotic chromosomes have organelles (telomeres and centromeres) that ensure their independence during mitosis and meiosis. In this work, the centromere structure of four mosquito species was studied using a centric heterochromatic probe, K20-1A5. This probe exhibited strong FISH signals on chromosomes 1 and 3, while chromosome 2 had faint signal in Aedes aegypti. Such results indicated that the centromeres of chromosome 1 and 3 are similar in sequences, while centromere of chromosome 2 exhibiting only a minor sequence similarity. Such FISH signals were not observed in centromeres of Aedes albopictus, Aedes triseriatus and Culex pipiens, indicating that those centromere sequences were different from that of Aedes aegypti. This results also showed that the centromere sequence can vary within the aedine species.

Acknowledgments We would like to express our thanks to Prof. D.L. Knudson, Department of Bioagricultural Sciences and Pest Management, College of Agricultural Sciences, Colorado State University, Fort Collins, USA, for providing laboratory facilities needed for this work.

References Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. & Struhl, K. 1998 Current Protocols in Molecular Biology; pp. 33–42, eds. Seidman et al., New York: Green Publishing Associates and Wiley-Interscience. ISBN 0-471-50338-X. Brown, S.E., Menninger, J., Difillipantonis, M., Beaty, B.J., Ward, D.C. & Knudson, D.L. 1995 Toward a physical map of Aedes aegypti. Insect Molecular Biology 4, 161–167. Brown, S.E. & Knudson, D.L. 1997 FISH landmarks for Aedes aegypti chromosomes. Insect Molecular Biology 6, 197–202.

F.A.E. Sallam and R.G.A. El Ela Brown, S.E., Severson, D.W., Smith, L.A. & Knudson, D.L. 2000 Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics 157, 1299–1305. Dimopoulos, G., Zheng, L., Kumar, V., Delta Torne, A. & Kafatos, F.C. 1996 Integrated genetic map of Anopheles gambiae: use of RAPD polymorphisms for genetic, cytogenetic and STS landmarks. Genetics 143, 953–960. Ferguson, M.L., Brown, S.E. & Knudson, D.L. 1996 FISH digital imaging microscopy in mosquito genomics. Parasitology Today 12, 91–96. French, W.L., Bakery, R.H. & Kitzmiller, H. 1962 Preparation of mosquito chromosomes. Mosquito News 22, 377–383. Knudson, D.L., Zheng, L., Gordon, S.W., Brown, S.E. & Kafatos, F.C. 1996 Genome organization of vectors. In The Biology of Disease Vectors, eds. Beaty, B.J & Marquardt, N.C. pp. 175–214. Niwot, co: University Press of Colorado. ISBN 0870-814117. Kumar, A. & Rai, K.S. 1990 Chromosomal localization & copy number of 18S-28S ribosomal RNA genes in evolutionarily diverse mosquitoes (Diptera, Culicidae). Heredity 113, 277–289. MacDonald, W.W. 1962a The genetic basis of susceptibility to infection with semi-periodic Brugia malayi in Aedes aegypti. Annals of Tropical Medical Parasitology 52, 368–372. MacDonald, W.W. 1962b The selection of a strain of Aedes aegypti susceptible to infestation with semi-periodic Brugia malayi. Annals of Tropical Medical Parasitology 56, 368–372. Marchi, A. & Pili, E. 1994 Ribosomal RNA genes in mosquitoes: localization by fluorescence in situ hybridization (FISH). Heredity 72, 599–605. Nederlof, P.M., Van der Flier, S., Wiegant, J., Raap, A.K., Tanke, H.J., Ploem, J.S. & Van der Ploeg, M. 1990 Multiple fluorescence in situ hybridization. Cytometry 11, 126–131. Nunamaker, R.A., Brown, S.E. & Knudson, D.L. 1999 Fluorescence in situ hybridization landmarks for chromosomes of Culicoides variipennis (Diptera: Ceratopogonideae). Journal of Medical Entomology 36, 171–175. Parra, I. & Windle, B. 1993 High resolution visual mapping of stretched DNA by fluorescent hybridization. Nature Genetics 5, 17–21. Rudkin, G.T. & Stollar, B.D. 1977 High resolution of DNA-RNA hybrids in situ by indirect immunofluorescence. Nature 265, 472–473. Trask, B.J. 1991 Fluorescence in situ hybridization. Applications in cytogenetics & gene mapping. Trends in Genetics 7, 149–154. Willhoeft, U. 1997 Fluorescence in situ hybridization of ribosomal DNA to mitotic chromosomes of tsetse flies (Diptera: Glossinidae: Glossina). Chromosome Research 5, 262–267. Zheng, L., Collins, F.H., Kumar, V. & Kafatos, F.C. 1993 A detailed genetic map for the X chromosomes of the malaria vector, Anopheles gambiae. Science 261, 605–608. Zheng, L., Benedict, M.Q., Cornel, A.J., Collings, F.H. & Kafatos, F.C. 1996 An integrated map of the African human malaria vector mosquito, Anopheles gambiae. Genetics 143, 941–952.

Springer 2005


Evaluation of agro-food byproducts for gluconic acid production by Aspergillus niger ORS-4.410 O.V. Singh1,2, N. Kapur1 and R.P. Singh1,* 1 Department of Biotechnology, Indian Institute of Technology, Roorkee-247 667, India 2 Department of Pediatrics, Johns Hopkins School of Medicine, Baltimore, MD 21287, USA *Author for correspondence: Tel.: +91–1332-285792, Fax: +91–1332-273560, E-mail: [email protected] Keywords: Aspergillus niger, banana-must, batch fermentation, gluconic acid, grape-must, molasses

Summary Certain cost-effective carbohydrate sources in crude as well as after purification were utilized as the sole sources of carbon for gluconic acid production using Aspergillus niger ORS-4.410 under submerged fermentation. Crude grape must (GM) and banana-must (BM) resulted into significant levels of gluconic acid production i.e. 62.6 and 54.6 g/l, respectively. The purification of grape and banana-must led to a 20–21% increase in gluconic acid yield. Molasses as such did not favour gluconate production (12.0 g/l) but a significant increase in production (60.3 g/l) was observed following hexacyanoferrate (HCF) treatment of the molasses. Rectified grape must (RGM) appeared to be best suitable substrate which after 144 h resulted in 73.2 g of gluconic acid/l with 80.6% yield followed by the yield obtained from the rectified banana must (RBM) (72.4%) and treated cane molasses (TM) (61.3%). Abundant growth of mould A. niger ORS-4.410 was observed with crude grape (0.131 g/l/h) and banana must (0.132 g/l/h).

Introduction Gluconic acid is regarded as a bulk chemical and is used as an important product in the food, feed, beverage and textile industries and for various clinical approaches. Due to the potential demand for it of about 50,000 to 60,000 tons per annum, microbial fermentation is exclusively used for commercial scale production using glucose as a major carbohydrate source (Roehr et al. 1996; Roukas 2000). There are many reports on the fermentative production of gluconic acid and its salts by various bacterial and mould species. The commonly studied bacterial species belong to Pseudomonas, Acetobacter, Gluconobacter, Zymomonas (Bekers et al. 2000; Chen & Liu 2000; Moonmangmee et al. 2000), while in moulds, Penicillium, Aspergillus, Aureobasidium (Petruccioli 1994; Anastassiadis et al. 2003; Singh et al. 2003) have been considered suitable strains for gluconic acid production. Refined glucose, glucose syrup and sucrose have been the main substrates for gluconic acid production (Ray & Banik 1999; Silveira et al. 1999; Bekers et al. 2000). The process could be further economized by replacing conventional refined carbohydrate materials with more economical substrates. A large quantity of raw fruit materials during storage undergo decomposition and generate a waste that may cause environmental pollution. Utilization of these

waste materials can be a part of environmental pollution control on one hand and production of value-added products of commercial significance on the other, thus changing their status from waste to potential provider. Agro-food byproducts such as grape-must, bananamust and sugarcane molasses contain high concentrations of sugars and can be considered as potential substrates that are easily available and economical. The present study is aimed at evaluating the economical waste carbohydrate sources grape-must, banana-must and sugarcane molasses for gluconic acid production by a mutant Aspergillus niger strain ORS-4.410. Concentrated purified grape-must, banana-must and treated molasses have also been evaluated for gluconic acid production. Materials and methods Microorganism Aspergillus niger mutant ORS-4.410 (Singh et al. 2001a) derived from the wild type Aspergillus niger ORS-4 (ITCC 5231) (Singh et al. 1999) after a two step u.v. irradiation, was used for this study. The strain was maintained on potato dextrose agar (PDA) slant by periodical transfers; and was incubated following transfer for 72 h (30 C) before storing at 4 C.

520 Preparation and purification of grape-must Grape juice has high sugar content (17% total sugar: 50% glucose and 50% sucrose) and is acidic (up to 10 g/ l tartaric acid). Market-refused red grapes of the Concord variety (100% ripened) that did not meet with the quality norms were used in fermentation reaction for gluconic acid production. Clarification of grape-must was followed as described (Grassim & Fauquembergue 1996) with slight modifications. Briefly, decomposed and market-refused grapes were collected (1 kg) and mixed with 1 l double distilled water. These were then destemmed, crushed and heated at 80 C for 30 min to release the red colour from the grape skin and to inactivate the endogenous polyphenol oxidase. Material thus obtained was filtered through muslin cloth and the juice that emerged was considered as grape-must (GM), which was then diluted to give 10–12% sugar concentration and used for gluconic acid fermentation. This grape-must was further clarified by addition of Cytolase (50 lg/g of original fruit mass) at room temperature for 30 min. The resulted free run juice was subjected to vacuum filtration, cooled at 4 C to prevent fermentation and then depectinized with Klerzyme, (200 lM for 2 weeks). The filtrate juice was referred as rectified grape must (RGM) and diluted to 120 g glucose/l before being used for fermentation. Preparation and purification of banana-must Market-rejected yellow rotten bananas that did not meet quality norms for consumption was utilized as the substrate for gluconic acid fermentation. Preparation and clarification of banana-must was followed as described (Grassim & Fauquembergue 1996). Briefly, the rotten bananas (1 kg) were peeled, ground and blanched in 1 l double distilled water. The obtained slurry was heated at 85 C for 2–3 min to inhibit polyphenol oxidase. Potassium metabisulphite (100 lM) was then added to prevent browning. The slurry was subjected to vacuum filtration and the free run juice thus collected was referred to as banana-must (BM). Further, banana-must was treated with Rapidase (75–100 lg/g of fruit pulp for 1–2 h at 45 C) and clarified by centrifugation (5000 · g, 30 min). Clarified supernatant juice was referred as rectified banana-must (RBM) and further diluted to 120 g glucose/l of fermentation medium prior to fermentation set-up. Clarification of molasses Crude molasses (CM) was found to contain high concentrations of heavy metals and other compounds that inhibited gluconic acid fermentation, hence it was treated with hexacyanoferrate (HCF) prior to use. The crude cane molasses (1 kg, obtained from a local sugarcane mill) was diluted 4–5 times with deionized water and passed through a bed of activated charcoal for decolourization. HCF (3.8 mM) was added to the

O.V. Singh et al. decolorized molasses at pH 4.0–4.5, followed by heating at 70–90 C for 15 min. The precipitate formed containing metallic complex was removed by filtration, and the filtrate was referred as treated cane molasses (TM). The pH of clarified molasses was adjusted to 4.5 before its use for gluconic acid fermentation. Growth and fermentation condition The spores (5 days-old) were suspended in 5 ml of sterile 50 mM phosphate buffer (pH 6.8) containing 0.1% (v/v) Tween-80 (1010–1012 spores/ml) and used as inoculum (2–3%, v/v) for batch fermentation. The fermentation medium contained: (NH4)2HPO4, 1.0 g/l; KH2PO4, 0.5 g/l; MgSO4.7H2O, 0.15 g/l; CaCO3, 40 g/l (sterilized separately), medium was supplemented with 120 g/l glucose from previously diluted each substrate type i.e. grape-must (corresponding to 250 g t.r.c./l), RGM (corresponding to 250 g t.r.c./l); banana-must (corresponding to 240 g t.r.c./l), RBM (corresponding to 240 g t.r.c./l); crude hydrolysed molasses (corresponding to 285 g t.r.c./l) and HCF-treated molasses (corresponding to 285 g t.r.c./l) as the sole carbon source in separate fermentation reactions. Initial pH was 5.5 at 30 C unless CaCO3 was added in the medium (pH 6.5±0.1). The submerged culture cultivation was carried out in batches using Erlenmeyer flasks (500 ml), each containing 100 ml medium; flasks were incubated at 30 C in an Orbital shaker (Sanyo Gallenkamp, U.K.) at 150 rev/min for up to 8 days. Determination of glucose and gluconic acid Unfermented total residual sugar was determined according to Miller (1959) and the total reducing carbohydrate was estimated as described by Mann & Saunders (1960). The gluconic acid formed was qualitatively analysed by HPLC (Waters, Milford, USA) using C18 ODS2 column. Elution was performed with an isocratic solvent (0.8 ml/min) using acetonitrile: H2O (3:7 v/v) and detected at 210 nm. A standard solution of gluconic acid (Sigma) was prepared and eluted similarly. The elution times of peaks were compared to the elution time of a standard peak. Fermented broth containing gluconic acid was subjected to acid hydrolysis and the resulting gluconolactone was measured by a modified hydroxamate method (Lien 1959). Total yield of gluconic acid was determined by measuring the dissolved calcium in the fermentation broth as described by Lehman (1985). Briefly, 2 ml of supernatant (obtained by centrifuging fermented broth) was diluted with 600 ml of double distilled water. To this, 5 ml of concentrated ammonia solution was added followed by a pinch of Eriochrome-red B powder. The sample thus prepared was titrated with 0.1 M Titriplex solution until the color changed from yellow to green (1 ml Titriplex III=2.004 g Ca/l broth; Total gluconic acid yield (%) = gluconic acid produced/ total sugar utilized · 100).

521

Gluconic acid fermentation Determination of dry cell mass Culture fluid was filtered through Whatman No. 1 paper. The filtered mycelia were washed with acidified (pH 2.5 with 4 M HCl) doubled distilled water to convert the insoluble CaCO3 to soluble CaCl2. The separated mycelia were washed several times with deionized water until pH of washing was 7.0; mycelia were then dried at 75 C to constant weight after repeated weighing. Reproducibility of results All fermentation was carried out in triplicate and the experimental results represent the mean of three identical fermentations. Statistical analysis was performed using ANOVA test software.

Results and Discussion Utilization of grape-must and the banana-must for gluconic acid fermentation Cheap carbohydrate sources such as GM, RGM, BM and RBM and cane molasses were evaluated for gluconic acid production by A. niger mutant ORS4.410. Among all the substrates used, RGM appeared to be a potential substrate resulting into higher levels of gluconic acid. An increase in the levels of gluconic acid produced with RGM was observed after 72 h followed by maximum production (73.2 g/l) after 144 h (Figure 1) with 80.6% yield, whereas, GM resulted into 62.6 g gluconic acid/l, with 60.4% yield. Yield was

140

90 80

120

Gluconic acid (g/l)

100 60 50

80

40

60

30

Residual sugar (g/l)

70

40 20 20

10 0 0

24

48

72

96 120 Time (h)

144

168

0 192

Figure 1. Utilization of grape-must (s, n) and rectified grape-must (d, m) as a sole source of carbon for gluconic acid production (s, d) and residual sugars (n, m) by Aspergillus niger ORS-4.410. The fungus was grown in fermentation medium under submerged culture cultivation with an initial pH of 6.5 at 30 C.

therefore 20% lower with GM as compared with that of RGM as the substrate. ANOVA test for significant differences between gluconic acid production was performed at different time periods for both substrates (GM: F=103.4; d.f.=7, 16; P=0.000; RGM: F= 135.4; d.f.=7,16; P=0.000). Kinetic analysis of the bioconversion also showed that the degree of conversion (0.611 g/g) and gluconic acid production rate (0.509 g/l/h) were higher with RGM as compared to the GM (degree of conversion, 0.522 g/g; gluconic acid production rate, 0.435 g/l/h) (Table 1). A. niger mutant ORS-4.410 yielded rapid growth on the crude substrates such as grape-must and banana-must and had shown higher substrate utilization (Table 1) but had lower gluconic acid productivity. Significant growth of mould A. niger ORS-4.410 was observed during 24–96 h of fermentation with GM having a specific biomass growth rate of 0.131 g/l/h whereas a lower growth rate (0.106 g/l/h) was observed with RGM (Table 1). Higher salt concentration in the crude substrates i.e. GM and BM (1.0 and 1.9 g total nitrogen/l, respectively) (Holland et al. 1997) may possibly favour biomass accumulation than the gluconic acid accumulation (Buzzini et al. 1993; Ray & Banik 1999). Grape and banana-must when rectified appeared to be the better substrates that has improved gluconic acid yield 20– 21% in fermentation medium. The biosynthetic activity of A. niger ORS-4.410 increased rapidly after a latent period of 24 h followed by the maximum production after 144 h, acid production activity of the mould afterwards declined, probably due to the reduced amount of glucose in the fermentation medium. Another cheaper substrate i.e. RBM from marketrefused banana was evaluated for gluconic acid production. Use of banana-must as such led to 54.6 g/l gluconic acid, while RBM was found to result into a 27% increase in acid production (Figure 2) with significant yield 72.4% as compared to crude bananamust (51.7%) (Table 1). A total of 79.6 and 88.0% of the glucose were utilized after single cycle of fermentation (144 h) from RBM and BM, respectively (Table 1). Significant differences in between gluconic acid production were found at different time intervals using RBM and BM as sole carbon sources in fermentation medium (BM: F=76.64; d.f. =7, 16; P= 0.00; RBM: F=231.2, d.f. = 7, 16; P=0.000).

Utilization of sugarcane molasses for gluconic acid fermentation Molasses resulted into lower levels of gluconic acid production (12.0 g/l), however a notable increase in gluconic acid production was observed with TM (60.3 g/l) when used as the substrate (Figure 3). Comparison of gluconic acid yields as obtained from TM (61.3%) with that of rectified fruit wastes (RGM, 80.6% and RBM, 72.4%) had indicated that TM had yielded a comparatively lower amount of gluconic acid

522

O.V. Singh et al.

Table 1. Evaluation of the kinetic parameters for gluconic acid production using cheap carbohydrate sources by Aspergillus niger ORS-4.410 Parametersaa b

Gluconic acid yield (%) Degree of conversionc (g/g) Gluconic acid production rated (g/l/ h) Specific glucose uptake rated (g/l/ h) Glucose utilizatione (%) t.r.c. utilization (%) Specific biomass growth rated (g/l/ h) Biomass yieldd, f (g/g)

GM

RGM

BM

RBM

CM

TM

60.4 0.522 (±0.241) 0.435 (±0.219)

80.6 0.611 (±0.306) 0.509 (±0.301)

51.7 0.455 (±0.211) 0.379 (±0.127)

72.4 0.578 (±0.293) 0.481 (±0.139)

15.3 0.100 (±0.098) 0.083 (±0.021)

61.3 0.486 (±0.251) 0.405 (±0.206)

0.721 (±0.302)

0.631 (±0.264)

0.733 (±0.348)

0.115 (±0.095)

0.083 (±0.026)

0.118 (±0.094)

86.5 57.5 0.131 (±0.093)

75.8 75.4 0.106 (±0.084)

88.0 61.7 0.132 (±0.075)

79.6 66.1 0.115 (±0.094)

65.3 49.3 0.083 (±0.031)

79.3 59.4 0.118 (±0.071)

0.183 (±0.086)

0.168 (±0.076)

0.180 (±0.073)

0.174 (±0.085)

0.153 (±0.062)

0.178 (±0.079)

a

Analyzed at 144 h of fermentation. Calculated as per utilized glucose. c Degree of conversion (1=p/s), P, product; S, initial glucose concentration. d Mean of three replicates ± S.D. e Calculated as per utilized total reducing carbohydrate (t.r.c.). f Y(g/g), values calculated on the basis of biomass obtained and the substrate utilized. b

than the other two rectified fruit wastes used (Table 1). Statistically, significant differences were found in between gluconic acid production using crude and TM (CM: F=2.254; d. f. = 7, 16; P= 0.085; TM: F = 125.8; d.f. = 7, 16; P = 0.000). The higher concentrations of heavy metal ions not only hindered gluconic acid production but also sustained the cellular growth of the mould. The reduction in gluconic acid production may be due to the inactivation of intracellular glucose oxidase at higher metal ion concentration (Liu et al. 2001). Utilization of total reducing carbohydrates was lower with CM when compared to the other two substrates GM and BM (Table 1).

140

70

120

60

100

60 30 40

20

Gluconic acid (g/l)

80 40

140

70

120

60 Residual Sugar (g/l)

50

80

100

50 80 40 60 30 40

20 20

10

20

10

0 0

24

48

72

96

120

144

168

0 192

Time (h)

Figure 2. Utilization of banana-must (s, n) and rectified bananamust (d, m) as a sole source of carbon for gluconic acid production (s, d) and residual sugars (n, m) by Aspergillus niger ORS-4.410. The fungus was grown in fermentation medium under submerged culture cultivation with an initial pH of 6.5 at 30 C.

Residual sugar (g/l)

80

Gluconic acid (g/l)

It is therefore apparent that RGM was the better carbon source resulting in 6 and 22% higher production of gluconic acid than RBM and treated molasses, respectively. The analysis of gluconic acid production by A. niger mutant ORS-4.410 indicated that direct fermentation of pure glucose resulted in 91.7 g gluconic acid/l, with 94.5% yield after 144 h of incubation (Singh et al. 2001b). Comparison of total gluconic acid production from RGM, RBM and TM with glucose indicated that RGM, RBM and TM resulted in 80, 76 and 66% gluconic acid production with respect to the production obtained with glucose. These observations therefore substantiated that the rectified grape, banana-

0 0

24

48

72

96 120 Time (h)

144

168

0 192

Figure 3. Production of gluconic acid (s, d) and recovery of residual sugars (n, m) in fermentation medium using crude (s, n) and HCF treated cane molasses (d, m) under submerged fermentation by fungus Aspergillus niger ORS-4.410, grown in fermentation medium with an initial pH 6.5 at 30 C.

Gluconic acid fermentation must and the treated molasses are potential substrates for gluconic acid production. Depending upon the substrate used, varying degree of the unfermented sugars remained in the fermentation medium and consisted mainly of complex carbohydrates, which were the major carbohydrate residual material of each substrate. Earlier, attempts have been made to utilize the fig, grape-must and sugarcane molasses for gluconic acid production using Aspergillus niger and Penicillium funiculosum MN 238 strains (Kundu & Das 1984; Buzzini et al. 1993; Roukas 2000); however, A. niger ORS-4.410 appeared to have yielded higher production levels with RGM and treated cane molasses as compared to the earlier reports (Kundu & Das 1984; Buzzini et al. 1993). Analysis of kinetic parameters had also clearly demonstrated RGM followed by RBM are the potential raw substrates for gluconic acid production (Table 1). Present study thus reveals that mutant A. niger ORS-4.410 can be an effective and promising mould that could be utilized for gluconic acid production using horticultural and agricultural byproducts as the cheaper carbohydrate substrates. Economics is of prime importance for any fermentation industry to be viable and successful, and to a greater extent depends on selection of the materials for the process. The choice is undoubtedly for the more economical carbohydrate raw materials provided that the microorganisms do not impose any special requirements for the particular substrate. These specificities, therefore, led to the search for significant carbohydrate materials containing high sugar content and that are wastes with no further applications. Fruit wastes are generated either as decomposed fruit pulps during storage and processing of the fruit material in horticulture industries or as marketrejected fruit wastes from numerous regional markets. These wastes are easily available in market at substantially lower prices or at free of cost. Among the fruit wastes, grape-must and the banana-must appear to have a high sugar content. In addition, the molasses that are generated from the sugarcane processing industries do have the high sugar content and are also low priced. These materials, which are cost-effective and are easily available, therefore, are promising substrates for economical production of this industrially significant product.

Acknowledgments We thank Mr. Amit Sharma for his excellent technical assistance and help in preparation for this manuscript. This work was partially supported by grant 7759- 35 of All India Council for Technical Education (AICTE), New Delhi of the Government of India.

References Anastassiadis, S., Aivasidis, A. & Wandrey, C. 2003 Continuous gluconic acid production by isolated yeast-like mould strains of

523 Aureobasidium pullulans. Applied Microbiology Biotechnology 61, 110–117. Bekers, M., Vigants, A., Laukevics, J., Toma, M., Rapoports, A. & Zikmanis, P. 2000 The effect of osmo-induced stress on product formation by Zymomonas mobilis on sucrose. International Journal of Food Microbiology 55, 147–150. Buzzini, P., Gobbetti, M., Rossi, J. & Ribaldi, M. 1993 Utilization of grape-must and concentrated rectified grape-must to produce gluconic acid by Aspergillus niger, in batch fermentation. Biotechnology Letters 15, 151–156. Chen, C. & Liu, B.Y. 2000 Changes in major components of tea fungus metabolites during prolonged fermentation. Journal of Applied Microbiology 89, 834–839. Grassim, C. & Fauquembergue, P. 1996 Fruit Juices. In Industrial Enzymology. ed. Godfrey, T. & West, S.T. pp. 227–260. London, Macmillan Press, ISBN 03–335-9464–9. Holland, B., Welch, A.A., Unwin, I.D., Buss, D.H., Paul, A.A. & Southgate, D.A.T. 1997 In The Composition of foods, 5th edn, pp. 852–971. ed. McCane & Widdowson’s, Royal Society of Chemistry, Cambridge, ISBN 0–854-04428–0. Kundu, P. & Das, A. 1984 Utilization of cheap carbohydrate sources for calcium gluconate production by Penicillium funiculosum mutant MN 238. Indian Journal of Experimental Biology 22, 279–281. Lehman, J.K. 1985 Comparative tests for fermentation. In Biotechnology. Vol. 2, ed. Rehm, H.J. & Reed, G. pp. 620–624, Weinheim: VCH Publishers, ISBN 3–527-25764–0. Lien, O.G. 1959 Determination of gluconolactone, galactonolactone and their free acids by the hydroxamate method. Analytical Chemistry 31, 1363–1366. Liu, J.Z., Huang, Y.Y., Liu, J., Weng, L.P. & Ji, L.N. 2001 Effects of metal ions on simultaneous production of glucose oxidase and catalase by Aspergillus niger. Letters of Applied Microbiology 32, 16–19. Mann, F.G. & Saunders, B.C. 1960 Practical Organic Chemistry. 4th edn. pp. 458–461, London: Longman, ISBN 81-250-1380-6. Miller, G. L. 1959 Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry 31, 426–428. Moonmangmee, D., Adachi, O., Ano, Y., Shinagawa, E., Toyama, H., Theeragool, G., Lotong, N. & Matsushita, K. 2000 Isolation and characterization of thermotolerant Gluconobacter strains catalyzing oxidative fermentation at higher temperatures. Bioscience Biotechnology and Biochemistry 64, 2306–2315. Petruccioli, M., Piccioni, P., Fenice, M. & Federici, F. 1994 Glucose oxidase, catalase and gluconic acid production by immobilized mycelium of Penicillium variabile P16. Biotechnology Letters 16, 939–942. Ray, S. & Banik, A.K. 1999 Effect of ammonium and nitrate ratio on glucose oxidase activity during gluconic acid fermentation by a mutant strain of Aspergillus niger. Indian Journal of Experimental Biology 37, 391–395. Roehr, M., Kubicek, C.P. & Kominek, J. 1996 Gluconic acid. In Biotechnology, Products of Primary Metabolism. Vol. 6, ed. Rehm, H.J. & Reed, G. pp. 347–362, Weinheim: VCH Publishers, ISBN 3–527-28316–1. Roukas, T. 2000 Citric acid gluconic acid production from fig by Aspergillus niger using solid-state fermentation. Journal of Industrial Microbiology and Biotechnology 25, 298–304. Silveira, M.M., Wisbeck, E., Lemmel, C., Erzinger, G., da Costa, J. P., Bertasso, M. & Jonas, R. 1999 Bioconversion of glucose and fructose to sorbitol and gluconic acid by untreated cells of Zymomonas mobilis. Journal of Biotechnology 75, 99–103. Singh, O.V., Pereira, B.M.J. & Singh, R.P. 1999 Isolation and characterization of a potent fungal strain Aspergillus niger ORS4 for gluconic acid production. Journal of Scientific and Industrial Research 58, 594–600. Singh, O.V., Sharma, A. & Singh, R.P. 2001a Mutagenesis and production of gluconic acid by Aspergillus niger mutant ORS-4.410 in submerged and solid state surface cultivation. Indian Journal of Experimental Biology 39, 691–696.

524 Singh, O.V., Sharma, A. & Singh, R.P. 2001b Optimization of fermentation conditions for gluconic acid production by mutant Aspergillus niger. Indian Journal of Experimental Biology 39, 1136– 1143.

O.V. Singh et al. Singh, O.V., Jain R.K. & Singh R.P. 2003 Gluconic acid production under varying fermentation conditions by Aspergillus niger. Journal of Chemical Technology and Biotechnology 78, (2–3), 208–212.


Springer 2005

A comparative evaluation of oxygen mass transfer and broth viscosity using Cephalosporin-C production as a case strategy Punita Mishra, Pradeep Srivastava* and Subir Kundu School of Biochemical Engineering, Institute of Technology, Banaras Hindu University, Varanasi- 221005, India *Author for correspondence: E-mail: [email protected]

Keywords: Air lift reactor, Cephalosporin-C, consistency index, viscosity, volumetric gas–liquid mass transfer coefficient

Summary The production of Cephalosporin-C (CPC) a secondary metabolite, using a mold Acremonium chrysogenum was studied in a lab scale Internal loop air lift reactor. Cephalosporin-C production process is a highly aerobic fermentation process. Volumetric gas–liquid mass transfer coefficient (kLa) and viscosity (g) were evaluated, during the growth and production phases of the microbial physiology. An attempt has been made to correlate the broth viscosity, g and volumetric oxygen transfer coefficient, kLa during the Cephalosporin-C production in an air lift reactor. The impact of biomass concentration and mycelial morphology on broth viscosity has been also evaluated. The broth exhibits a typical non-Newtonian fermentation broth. Rheology parameters like consistency index and fluidity index are also studied.

Nomenclature a CPC Cm K k La n g c USG

biomass exponent cephalosporin-C biomass concentration as dry cell weight (g l)1) consistency index volumetric gas–liquid mass transfer coefficient (h)1) fluidity index, flow behavior index viscosity (cp) shear rate (s)1) superficial gas velocity (ms)1)

Introduction The biosynthesis of Cephalosporin-C (CPC), an antibiotic intermediate, is an aerobic fermentation process, using the filamentous microorganism Acremonium chrysogenum. Antibiotics are the product of secondary metabolism of microorganism which is produced after the active growth has declined. It has been observed that there are two phases during the growth of microorganism producing antibiotics. The first phase is called the Trophophase (the balanced growth phase) characterized by the intense accumulation of biomass, which is due to the rapid utilization of the substrate and high rate of oxygen utilization. Antibiotics are not normally formed during this phase though occasionally small amounts are

formed. This is due to inhibition of the formation of antibiotics during this balanced growth phase. The second phase, the Idiophase (unbalanced growth phase), which follows the Trophophase, is the antibiotic production phase. The weight of the biomass increases slowly or even decreases, during this phase because the main ingredient of the medium are already consumed by the microorganism and the medium is enriched with some metabolic products. During the aerobic fermentation process, there is a wide variation of the oxygen mass transfer in the broth. Most of the antibiotic fermentation processes which are of fungal origin exhibit nonNewtonian viscosity and are represented by the power law model. Kawase & Young (1986) have measured volumetric mass transfer coefficient in some non-Newtonian fluids. Several studies have been performed on the evaluation of CPC production process. Recently, some studies by Seidel et al. (2002a, b), to evaluate the Process Engineering aspects of CPC production using complex media in Stirred tank reactor, depict that at the end of the growth phase, the fraction of antibiotic increases to 55%. Also, some of the initial studies by Weichang et al. (1992) on CPC production by Cephalosporium acremonium evaluate the oxygen concentration variation during the fermentation process. The CPC production has also been evaluated in stirred tank and air lift reactor to prove the utility of air lift reactor for its efficient production (Srivastava et al. 1996). The earlier studies by authors, using immobilized systems for CPC production in air lift reactor has

526 depicted the role of broth morphology for controlled CPC production (Srivastava & Kundu 1998). However, an attempt is to be made to study and correlate the variation of oxygen mass transfer and viscosity during the production cycle of CPC, along with the morphological variations in the broth. The objectives of these studies include evaluation of broth viscosity in relation to morphological variation during the growth of the organism Acremonium chrysogenum, the studies on oxygen mass transfer coefficient during the CPC production in the air lift reactor, and also the evaluation of a correlation for the above mentioned parameters.

Materials and methods Organism Acremonium chrysogenum (a gift from J.K. Pharmaceuticals Limited, Cuddalore, Pondichery, India) was used for the production of CPC. Acremonium chrysogenum culture was maintained on potato dextrose agar (PDA) medium. Medium All analytical grade chemicals were used throughout the studies. The growth and production medium used during the study were of, Kennel & Demain (1978), which used sucrose as the carbon substrate. Requisite quantity of silicone oil was added as an antifoaming agent. Methods Experimental A 1.3 l air lift internal loop reactor (ALR) was indigenously designed to study the highly aerobic CPC production process. The basic design of the lab scale air lift reactor was determined from the earlier experiments (Srivastava 1998). Borosilicate glass was used for the construction of ALR. The dimensions were restricted to ease the sterilization process in laboratory autoclave. A constant air flow rate was maintained through an air filter, and the flow rate was measured with a Rota meter. Dried air was passed at 28 C. All the ports of ALR were aseptically sealed after inoculation. Batch CPC production was carried out in ALR. Sterile air was sparged co-currently through a single sparger and air flow rate was maintained. Analytical methods Reducing sugar estimation Sugar was estimated by dinitrosalicylic acid (DNS) reagent method described by Miller (1959). Cephalosporin-C estimation CPC has been estimated by hydroxylamine method. The method is described by Boxer & Everet (1949).

P. Mishra et al. Cell mass estimation The cell mass produced was monitored by using Dry cell method (Srivastava 1998). Broth rheology The physical properties of the CPC production broth were studied using Brooke-field Viscometer (BV) (Dial Reading & Digital DV-I, Manual No. M/85-170-B, Brook-field Engineering Laboratories, Inc., 240 Cushing Street, Stoughton, MA 02072, USA). To examine the influence of biomass concentration on broth rheology, broth samples were taken throughout the time course of several fermentation and reconstituted to the differing biomass levels. Each sample was reconstituted as in Tucker (1994) to form four or five subsamples of identical morphology but with biomass concentration ranging between 3 and 15 g l)1 dry cell weights. From the rheological measurement on these subsamples, values of the biomass exponent, a at various time could be estimated. a values, at any time were determined from the slope of the logarithmically transferred plots of the Consistency Index vs. the subsample biomass concentration (Riley et al. 1999). Volumetric mass transfer coefficient The volumetric oxygen transfer coefficients, kLa, were determined using dynamic method of Ruchti et al. (1981). Oxygen uptake rates (in vitro method) Oxygen uptake rate was determined by Gbewonoyo & Wang (1983) method.

Results and discussion Visual observation of CPC broth During the fermentation process, the CPC production broth was monitored and observed using a microscope (100· magnification). A notable change was observed in broth characteristics. After 3–4 days CPC broth exhibited high viscosity and appeared pale yellow in color. The bubble size distribution in the riser of ALR was also closely observed. Initially most of the bubbles were in the size of 2–3 mm diameter. However, as the biomass concentration in the fermentation increased, the broth became more viscous and non-Newtonian. Also, the turbulence in the riser was observed to decrease considerably and the bubble size distribution changed. The larger size bubbles closely equal to the diameter of the draft tube, rise rapidly through the riser and were disengaged at the top of it, while the smaller bubbles remained trapped inside the fermentor. The broth in the down comer appeared to be stagnant like a slug, in plug flow regime. It was also observed that clumps of mycelia were formed in the late stages of fed batch fermentation.

527

Oxygen mass transfer and broth viscosity (a) 40 Consistency Index,k(N/m)

Also, the percentage of clumps was around 40–50% of the sample. On microscopic observation, the biomass could be divided into two morphological forms, freely dispersed mycelial forms with up to 2–3 hyphal mycelia leading to hyphal loops in the images and second the clumped form, which use these loops to define a structure. Further studies on image analysis of the mycelia should be performed to evaluate compactness and clump roughness parameters.

35 30 25 20 15 10

Broth density variation study

Rheology of the fermentation broth Elaborate viscosity measurements were performed using CPC broth at various stages of the batch processes. The broth exhibits a typical non-Newtonian behavior, and follows power law model. The viscosity of the broth increases in the early hours of fermentation, which can be attributed to the growth phase of the microbes. The rate of growth of the microbes (dx/dt) was also observed to increase during 0–60 h. Also the consistency index, K and fluidity index, n varies with time. Consistency index, K was observed to be varying between 15 and 38 N m)1 from 24 to 120 h. In later stages consistency index, K declined. Fluidity index shows also a change, and the details are exhibited in Figure 1a and Figure 1b, respectively. The change in the apparent viscosity of the broth with time depicts the morphological differentiation of the Acremonium chrysogenum. However, in the later fermentation stages the formation of spherical arthrospore (Matsumura et al. 1978) reduced the viscosity of the broth. The correlation of the broth morphology with the rheology in the growth phase of the microbes is an attractive proposition for the further study. A funda-

0 0

50

100 Time (h)

150

200

(b) 0.7 0.6 Fluidity index,n (1/s)

The importance of biomass concentration on the broth density was evaluated. An increase in the phase volume (volume of suspended material/volume of continuous phase) causes an increase in the apparent viscosity. An increase in the biomass concentration also causes an increase in the phase volume. However, the broth viscosity remains nearly constant in the later part of the batch. The colloidal forces in between the mycelia as well as the mycelial entanglement define the interactions between the mycelia and hence affect the phase volume. Assuming mycelial interactions are important, hence particle size might play an important role as well as the particle size distribution, for the rheology of the broth. It has been observed that broth density varies with age of CPC fermentation. In the early fermentation hours, the broth was of watery fluid in nature with density approximately 1.150 g l)1. It increased up to 1600 g l)1 at 60 h. However, with subsequent increase of time, no further increase in the broth density was observed, and further it decreases slightly. This decrease in the density of the broth in the last phase of antibiotic production can be attributed to the arthrospore formation by the mold (Matsumura et al. 1978).

5

0.5 0.4 0.3 0.2 0.1 0 0

20

40

60

80 100 Time (h)

120

140

160

Figure 1. (a) Change in consistency index, K with the fermentation time; (b) change in fluidity index, n with fermentation time.

mental problem with developing correlations between mycelial broth rheology, biomass concentration and morphology is the lack of understanding, how each factor affects the other. This area needs further research. However, preliminary investigations of the effect of biomass concentration separately from that of mycelia morphology were also performed. It was observed that rheological property can be correlated to the change in biomass concentration and the correlation of Tucker (1994) holds true. This defines the correlate of rheological parameters to the biomass concentration with an empirical correlation constant a, as an exponent. It has also been assumed that the rheology of fungal fermentation broth can be related to clump formation rather than to the morphology of free mycelia (Riley et al. 1999). However, further correlation for clump morphology factors like compactness and roughness and the statistical correlation analysis ( ƒ ) needs to be evaluated. a value, determined for the correlation of the consistency index to biomass concentration is shown in Figure 2. For the present study in fed batch fermentation in air lift reactor, a was observed to be 0.53, and was calculated throughout the batch fermentation. The standard deviation and standard error for a value were also evaluated (not shown). However, the variation in a value (0.3–0.8), lies within the standard deviation of the mean, hence justify the use of a. This deviation in a value with the time of fermentation is due to the

528

P. Mishra et al. 70

3.8 3.6

60 50

3.2 -1

KLa (h )

l n k, Consistency index

3.4

3 2.8 2.6

40 30 20

2.4 10

2.2 0

2 2

2.5

3

3.5

4

4.5

5

0

5.5

20

40

1.2 1 2

0.8 0.6 0.4 0.2 0 0

50

100

150

200

Time (h)

Figure 3. Time profile of the consistency index, K divided by the squared biomass concentration as dry cell weight, Cm(K/Cm2) for fermentation.

uncharacterized degradation of the biomass. The mycelial degradation might affect hyphal rigidity and clump interaction effecting a change in the exponent on the biomass concentration (Allen & Robinson 1990). The consistency index divided by the square of biomass concentration (K/Cm2), is plotted against fermentation time and shown in Figure 3. The nature of plot shows a steep decline in the early fermentation hours, followed by a low constant value, with little deviation, which is quite similar to the earlier observations of Riley et al. (1999). This plot illustrates the reason for the poor quality of correlation based purely on biomass concentration. The plot clearly depicts that this is not possible, as K/Cma is equivalent to this constant and changes throughout the fermentation. Hence, it is imperative to develop a relationship between the morphological factor and K/Cma. Variation of oxygen mass transfer in the broth The oxygen transport during the fermentation, from the gas phase through the liquid medium and then to the

100

120

140

Figure 4. Variation of volumetric mass transfer coefficient with time.

microorganism, was studied and the results have been shown in Figure 4. With the increasing biomass concentration, the solid sediment fraction and viscosity increases for the free cells and a sharp decrease in kLa is observed due to spherical arthrospore formation by the mold and the viscosity was effectively controlled. However, it was observed that further decrease in kLa during the late exponential phase can be attributed to high oxygen demand during CPC formation, and the kLa could be only controlled at 15 h)1 at 60 h (Srivastava 1998). The high oxygen demand of the CPC production processes may be attributed to its demand in the biosynthetic pathway. The biosynthetic pathway of CPC shows that there are three oxygen consuming steps in the pathway: (i)

Cyclization of the tripeptide, a-aminoadipylcystenyl valine into isopenicillin N. (ii) The ring expansion of penicillin N into deacetoxycephalosporin (CDAOC). (iii) The hydroxylation of DAOC to give deacetyl CPC. It has been observed in the study that with the decline in the oxygen availability in the broth, the product

3.5 3

Cephalosporin-C (g/L)

1.4

(K/Cm )

Consistency index/Square of dry cell mass

1.6

80

Time (h)

ln T, Time

Figure 2. Logarithmic plot of time vs. consistency index for evaluation of exponent of biomass (a value determination).

60

2.5 2 1.5 1 0.5 0 0

50

100

150

Time (h)

Figure 5. The product concentration (CPC) with time.

200

529

Oxygen mass transfer and broth viscosity concentration and its formation rate (dp/dt) decreased at 120 h and above (Figure 5). Correlation of broth properties and volumetric gas–liquid mass transfer coefficient

Volumetric oxygen transfer coefficient (kLa),h

-1

It is observed that an increase in pesudoplasticity of the media causes a sharp decrease in the oxygen mass transfer coefficient, kLa. The increasing pseudoplasticity results in a thick pulpy mass of the broth with poor oxygen transfer rate. The oxygen mass transfer studies were performed in ALR during CPC fermentation, at shear rate of 175 and 100 S)1. It was observed that kLa increases with shear rate. Furthermore, in non-Newtonian broth, small rising bubbles coalesce and form large bubbles, which may possibly enhance axial mixing. This is in strong agreement with earlier results on homogenous viscous liquids. For example, based on c ¼ 5000USG.. Popovic & Robinson (1989) found that kLa is proportional to g0:89 effective and Godbole et al. (1984), found that kLa is proportional to g1:01 effective . It has been observed that lower values of kLa coincide with a noticeable change in the bubble size distribution towards larger spherical capped bubbles and resulting in the reduction of the specific interfacial area. Similar, observations has been made in the studies of interfacial area with non-Newtonian homogenous fluids (Popovic & Robinson 1989). Very few studies however have been attempted to evaluate quantitative correlation developed for homogenous fluids to actual mycelial fermentation. Figure 6 shows the relationship between kLa and viscosity of the broth at two shear rate. During the present study it was observed that kLa is proportional to the effective viscosity of the broth. This is different from the CMC homogenous solution studies for chemical system. It can be attributed to the nature of Acremonium chrysogenum broth which behaves as heterogeneous

140 120 100 80 60 40

slurry. The major resistance to oxygen transfer in a fermentor is considered to occur in a thin film surrounding the air bubbles, the slip and bio-particles. The kLa decreases with increasing cell mass concentration. This can be attributed to an interface blockage by cells which have lower oxygen permeability than the liquid media. However, there is no parameter to account for the yield stress of the fluid, which exists in the broth. The dependence of kLa with geffective was observed to be inversely related. For the present study, as shown in Figure 6, it was observed that kLa is proportional to g0:7 effective (calculated from the plot of K and n variation with time). This is due to the nature of the microbial broth. This observation of the dependence of kLa on effective viscosity is quite similar to Aspergillus niger broth, as studied by Allen & Robinson (1989) who found that kLa is proportional to g0:89 effective .

Conclusion The importance of the biomass concentration in broth rheology has been evaluated. The increase in phase rheology causes an increase in apparent viscosity. Also, the consistency index is observed to strongly correlate with biomass concentration. Studies on volumetric mass transfer coefficients and rheology correlation for CPC production were evaluated. It was observed that the volumetric mass transfer coefficient decreased sharply with increase in CPC broth viscosity. The decrease has been explained by an interface blockage by cells, which have lower oxygen permeability than the liquid media. The dependence of kLa to the apparent broth viscosity, for microbial system has good similarity to the other works done earlier on carboxyl methyl cellulose solution. Oxygen transfer in the broth is a potential parameter for the efficient design of a suitable air lift reactor for CPC production. The rheological studies using Acremonium chrysogenum broth exhibit a typical fungal fermentation and follow power law model. However, the study illustrates the problem of characterizing broth rheology in terms of biomass concentration and the product formation. Also, a correlation of fluidity index to the broth morphology needs to be explored. The studies on clump morphology factor like compactness and roughness and its statistical correlation analysis (ƒ) need to be evaluated and can be the part of further communication. However, with no basic understanding of the process and interaction involved, the correlation cannot have a good theoretical basis.

20

Acknowledgment

0 0

50

100

150

Apparent Viscosity (CP)

Figure 6. Variation of oxygen mass transfer coefficient with apparent viscosity of broth. (c) changes at 100 S)1; (n) changes at 175 S)1.

The authors acknowledge the University Grants Commission, India for the financial assistance received as research Grant.

530 References Allen, D.G. & Robinson, C.W. 1989 Hydrodynamics and mass transfer in Aspergillus niger fermentation in bubble column and loop bioreactors. Biotechnology and Bioengineering 34, 731–740. Allen, D.G. & Robinson, C.W. 1990 Measurement of rheological properties of filamentous fermentation broth. Chemical Engineering Science Part I 45, 37–48. Boxer, G.E. & Everet, P. 1949 Cephalosporin C estimation by hydroxyl amine assay method. Analytical Chemistry 21, 670–678. Gbewonoyo, K. & Wang, D.I.C. 1983 Confining mycelial growth to porous microbeads: a novel technique to alter the morphology of non-Newtonian mycelial cultures. Biotechnology and Bioengineering 25, 967–983. Godbole, S.P., Schumpe, A., Shah, Y.T. & Carr, N.L. 1984 Hydrodynamics and mass transfer in non-Newtonian solutions in a bubble column. Analytical Chemical Engineering 30, 213–220. Kawase, Y. & Young, M. 1986 Mixing and mass transfer in concentric tube airlift fermenters: Newtonian and non-Newtonian media. Journal of Chemical Biotechnology 36, 527–536. Kennel, Y.M. & Demain, A. 1978 Effect of carbon sources on b lactam antibiotic formation by Cephalosporium acremonim. Experimental Mycology 2, 234–238. Matsumura, M., Imanaka, T., Yoshida, T. & Taguchi, H. 1978 Effect of glucose and methionine consumption rates on cephalosporin-C production by Cephalosporium acreomonium. Journal of Fermentation Technology 56, 345–348. Miller, G.L. 1959 Use of dintrosalicylic acid reagent for determining of reducing sugar. Analytical Chemistry 31, 427–428. Popovic, M. & Robinson, C.W. 1989 Mass transfer studies of external loop air lifts and bubble column. Analytical Chemical Engineering Journal 35, 393–405.

P. Mishra et al. Riley, G.L., Tucker, K.G., Paul, G.C. & Thomas, C.R. 1999 Effect of concentration and mycelial morphology on fermentation broth rheology. Biotechnology and Bioengineering 68, 160–172. Ruchti, G., Dunn, I.J. & Bourne, J.R. 1991 Comparison of dynamic oxygen electrode method for the measurement of kLa. Biotechnology and Bioengineering 23, 277–290. Seidel, G., Tollnic, C., Beyer, M., Fahimi, Y. & Schugerl, K. 2002a Process engineering aspects of the production of cephalosporin C by Acremonium Chrysogenum Part Application of complex media. Process Biochemistry 38, 229–239. Seidel, G., Tollnic, C., Beyer, M., Fahimi, Y. & Schugerl, K. 2002b Process engineering.aspects for the. production of cephalosporin C by Acremonium Chrysogenum. Part II. Cultivation in diluted and enriched complex media. Process Biochemistry 38, 241–248. Srivastava, P. 1998 Studies on microbial production of cephalosporin-C in air lift reactor. PhD thesis, Banaras Hindu University, Varanasi, India. Srivastava, P. & Kundu, S. 1995 A laboratory air lift reactor for antibiotic production. Indian Journal of Chemical Engineering 37(4), 136–138. Srivastava, P. & Kundu, S. 1998 A comparative evaluation of cephalosporin C production using immobilization modes. Journal of General and Applied Microbiology 44, 113–117. Srivastava, P., Nigam, V. & Kundu, S. 1996 A comparative evaluation of cephalosporin C production in air lift reactor and stirred tank reactor. Indian Journal of Chemical Technology 3, 371–372. Tucker, K.G. 1994 Relationship between mycelial morphology biomass concentrations and broth rheology in submerged fermentation. PhD thesis, University of Birmingham, Birmingham, UK. Weichang, Z., Rieger, K.H., Dors, M. & Schugerl, K. 1992 Influence of dissolved oxygen concentration on the biosynthesis of cephalosporin C. Enzyme Microbial Technology 14, 848–854.

Springer 2005


Immobilized cells cultivated in semi-continuous mode in a fluidized bed reactor for xylitol production from sugarcane bagasse J.C. Santos, S.S. Silva, S.I. Mussatto*, W. Carvalho and M.A.A. Cunha Department of Biotechnology, Faculty of Chemical Engineering of Lorena, Rod. Itajuba´-Lorena km 74. 5, 12600-970, Lorena-SP, Brazil *Author for correspondence: Tel./Fax: +55-12-31533165, E-mail: [email protected] Keywords: Candida guilliermondii, fluidized bed reactor, porous glass, sugarcane bagasse hydrolyzate, xylitol

Summary Xylitol production from sugarcane bagasse hemicellulosic hydrolyzate was evaluated in a fluidized bed reactor operated in semi-continuous mode, using cells immobilized on porous glass. The fermentative process was performed during five successive cycles of 72 h each one. The lowest xylitol production occurred in the first cycle, where a high cell concentration (12 g l)1) was observed. In the subsequent cycles the xylitol concentration was ever increasing due to the cells adaptation to the medium. In the last one, 18 g xylitol l)1 was obtained with a yield factor of 0.44 g g)1 and volumetric productivity of 0.32 g l)1 h)1.

Introduction Xylitol is a pentahydroxy sugar-alcohol with sweetening power similar to sucrose and that presents important physicochemical and physiological properties, which stands out it among other sweeteners. Xylitol promotes tooth rehardening and remineralization, thereby preventing and reducing dental caries. Besides, this sweetener also prevents otitis, osteoporosis and inflammatory processes, and has an insulin-independent metabolism that permits its utilization by diabetics as a sugar substitute (Mussatto & Roberto 2002). Xylitol occurs widely in nature, in many fruits and vegetables such as plums, strawberries, raspberries, grape, banana, lettuce and cauliflower (Parajo´ et al. 1998). Nevertheless, its extraction from natural sources is not feasible because is a very expensive process. On an industrial scale, xylitol is produced by chemical reduction of D -xylose from hemicellulosic hydrolyzates (mainly wood hydrolyzates), a high-cost process that uses elevated pressure and temperature, and requires extensive xylose purification steps. For these reasons, several researchers are pursuing alternative ways to produce xylitol, and the biotechnological pathway (using microorganisms and/or enzymes as catalysts) appear as an interesting alternative because it requires the use of mild conditions of pressure and temperature, and very little xylose purification (Winkelhausen & Kusmanova 1998), being thus more economical. Recently, many studies have been carried out aiming to improve the performance of the biotechnological process, and the use of immobilization methods has

been proposed (Carvalho et al. 2002, 2003). According to Webb & Atkinson (1992), immobilized cells are sheltered from inhibitor compounds present in the hydrolyzates and can be more easily separated from the culture medium, thus facilitating the reuse of the biocatalyst for extended periods of time. The maintenance of cells into the reactor along the batches is interesting, since the inoculation step can be eliminated and the cells can be adapted to the culture medium, resulting in higher productivities and yields (Sene et al. 1998; Carvalho et al. 2002). In the present study, the xylitol production from sugarcane bagasse hemicellulosic hydrolyzate was investigated in a fluidized bed reactor operated in semicontinuous mode, using cells immobilized in porous glass.

Materials and methods Preparation and treatment of sugarcane bagasse hemicellulosic hydrolyzate A 350-l reactor was loaded with sugarcane bagasse and sulphuric acid solution (100 mg of acid per gram of dry matter) in a solid:liquid ratio of 1:10 (g:g). Reaction was maintained at 121 C for 10 min. After this time, the resulting solid material was separated by centrifugation and the liquid fraction obtained (hemicellulosic hydrolyzate) was concentrated under vacuum in a 4-l evaporator, at 70 ± 5 C. To minimize the concentration of the main fermentation inhibitors, the concentrated hydrolyzate was treated

532 according to the methodology established by Alves et al. (1998). After treated, the hydrolyzate presented the following composition: 57.34 g xylose l)1, 1.97 g glucose l)1, 5.79 g arabinose l)1, and 4.33 g acetic acid l)1. Microorganism, inoculum preparation and fermentation medium Cells of the yeast Candida guilliermondii FTI 20037, maintained at 4 C on agar malt extract slants, were transferred to 125 ml Erlenmeyer flasks containing 50 ml of medium composed of (g l)1): xylose (30), ammonium sulphate (3.0), calcium chloride (0.1), and 10% (v/v) rice bran extract. The flasks were maintained on a rotatory shaker at 200 rev min)1, 30 C, during 24 h. Afterwards, the cells were collected by centrifugation (2200 · g; 20 min) and rinsed twice with sterile distilled water to be added in the fermentation medium. Fermentation medium was composed by the treated sugarcane bagasse hydrolyzate (autoclaved under manometric pressure of 0.5 atm for 15 min), supplemented with ammonium sulphate (3.0 g l)1), calcium chloride (0.1 g l)1), and rice bran extract (10% v/v). Fluidized bed reactor operation and cell immobilization Fermentations were performed in a 1.7-l fluidized bed reactor (Bioengineering AG, Wald, Switzerland), that consisted in a 540 mm · 55 mm column containing a vertical tube in the centre (9 mm inner diameter). In order to maintain the necessary fluidization of the bed, an external pump providing an inlet flow of about 210 l h)1 was coupled with the column. The pumped medium returned from the top to the bottom of the reactor through the central tube. Steel spheres with a diameter of 2 mm (200 g) were placed at the bottom of the reactor to disperse air bubbles. The reactor was coupled with sensors for measurement of dissolved O2 concentration, pH and temperature. The carrier employed consisted of porous glass particles (Siran–Schott, Mainz, Germany) with 2.0– 3.0 mm outer diameter and size of pores 15 mm. b Hp – Helicobacter pylori; Bs – Bacillus subtilis; Pf – Pseudomonas fluorescens; Ec – Escherichia coli, Sa – Staphylococcus aureus; An – Aspergillus niger; Tr – Trichophyton rubrum; Ca – Candida albicans.

556

Y. Li et al. HOOC

Me

H Me Me

OH

OAc

Me

O

COOMe

H Me

H O

Me

OAc

H Me

OMe

OMe

OH

O 1

2 25 22

21 24 18 20

23

11

26 28

17 19

27

13 15

1

1

9

O

10 3

5

3

7

HO

HO

5

8

6O

3

4

Figure 1. Structures of helvolic acid (1), monomethylsulochrin (2), ergosterol (3) and 3b-hydroxy-5a,8a- epidioxy-ergosta-6,22-diene (4).

Table 2. The MIC values (lg/ml) of compounds 1-4.

H. pylori 43504 H. pylori 001 H. pylori 016 H. pylori 018 H. pylori 019 H. pylori 036 S. lutea S. aureus C. albicans a

1

2

3

4

AMPa

5.0 8.0 5.0 8.0 8.0 8.0 15.0 20.0 30.0

10.0 5.0 10.0 5.0 10.0 10.0 30.0 >100 >100

15.0 20.0 10.0 10.0 10.0 20.0 >100 >100 >100

30.0 5.0 30.0 30.0 30.0 30.0 >100 >100 >100

2.0 2.0 2.0 2.0 2.0 2.0 1.0 2.0

KCZa

1.0

AMP – ampicillin; KCZ – ketoconazole.

characters below. The newly isolated mycelium grew well on PDA to produce fruiting bodies easily. Colonies with a regular margin attained 35–45 mm in diameter after incubation on PDA at 28 C for 4 days and took on a weak green colour in PDA plates. Conidiophores were upright, simple, terminating in a globose swelling, bearing phialides at the apex; condia (phialospores)1celled and globose. These morphological observations of the endophytic fungus were nearly identical with those described for other Aspergillus species (Frisvad & Samson 1990; Barnett & Hunter 1998). A living culture is being maintained in our institute. Through a bioassay-guided fractionation of the ethyl acetate extract of the endophytic culture, four main antiH. pylori secondary metabolites (1–4) were obtained. On the basis of spectral and physical data, compounds 1–4 were identified as helvolic acid (Oxley 1966; Okuda et al. 1967), monomethylsulochrin (Turner 1965), ergosterol (Cushley & Filipenko 1976), 3b-hydroxy-5a,8a-epidioxy-ergosta- 6,22-diene (Ma et al. 1994), respectively (Figure 1). To exclude the possibility that any of the four isolated metabolites might have originated from the

medium materials used in the study, an LC-MS examination was therefore conducted with the ethyl acetate extract of the blank sterile medium treated identically to with fungal cultures. Howevert, none of the four fungal metabolites (1–4) could be detected, indicating that all were actually produced by the endophytic fungus. Concerning the results of antimicrobial assays, the four identified metabolites 1–4 displayed significant growth inhibition against all the six strains of H. pylori with the MICs of 8.0, 10.0, 20.0 and 30.0 lg/ml, respectively (Table 2). For a preliminary understanding of the antimicrobial spectrum, the four compounds were tested additionally for the inhibitory effects on other human pathogens including five bacteria: B. subtilis, P. fluorescens, E. coli, S. lutea and S. aureus, as well as three fungi: T. rubrum, A. niger and C. albicans. As summarized in Table 2, helvolic acid (1) was bacteriostatic to S. lutea and S. aureus, and fungistatic to C. albicans whereas monomethylsulochrin (2) was bacteriostatic to S. lutea only. However, ergosterol (3) and 3b-hydroxy-5a, 8a-epidioxy-ergosta-6,22-diene (4) did not show any discernible inhibitory effects on the six test

Anti-H. pylori substances from endophytic fungus microbes. The results observed with insusceptible microbes are not tabulated. As to the magnitude of the antimicrobial action, the presently ascertained MIC values of helvolic acid (1) (8.0 lg/ml) and monomethylsulochrin (2) (10.0 lg/ml) demonstrated that both compounds are fairly comparable to the promisingly potent anti-H. pylori natural products reported previously, such as alkaloids (Hamasaki et al. 2000), flavonoids (Bae et al. 1999; Ohsaki et al. 1999), quinines (Dekker et al. 1998; Taniguchi et al. 2002), peptides (Iwahori et al. 1997) and rotenoid (Takashima et al. 2002). Helvolic acid (1), characterized previously from the culture broth of Cephalosphorium caerulens, shows antibiotic activity against a wide range of microorganisms including Streptococcus (MIC 6.25 lg/ml), Salmonella typhi (MIC 100.0 lg/ml), Shigella lutea (MIC 0.8 lg/ml) (Okuda 1967; Cole 1981). Furthermore, monomethylsulochrin (2), produced by the fungi belonging to the genera Aspergillus (Turner 1965; Inamori 1983), Penicillium (Mahmoodian 1964), Oospora (Curtis 1966) and Rhizoctonia (Ma et al. 2004), has been shown to inhibit eosinophils (IC50 0.3 lM), which may play important roles in allergic diseases such as asthma and atopic dermatitis (Ohashi 1999). 3b-Hydroxy-5a, 8a- epidioxy-ergosta-6,22-diene (4), widely distributed in fungi and lichens, shows potent cytotoxity (LD50 11.7 lg/ml) against mouse lymphaemia L-1210/v/ c strain, and to KB cell (LD50: 12.3 lg/ml) derived from a human epidermoid carcinoma of the mouth (Gunatilaka 1981; Matsueda 1985). In conclusion, the firsttime characterization of four anti-H. pylori metabolites, helvolic acid (1), monomethylsulochrin (2), ergosterol (3) and 3b-hydroxy-5a,8a-epidioxy- ergosta-6,22-diene (4) from a Cynodon dactylon endophyte culture highlights the possibility that some endophytes in nature could be efficient producers of anti-H. pylori and/or bacterial ulcer-treating compounds; the compounds may have clinical potential in the future.

Acknowledgements The work was co-financed by grants for RXT from the National Natural Science Foundation of China (No. 30171104) and from the Ministry of Science & Technology-National Marine 863 projects (Nos. 2003AA624010 and 2003AA 624110).

References Bae, E.A., Han, M.J. & Kim, D.H. 1999 In vitro anti-Helicobacter pylori activity of some flavonoids and their metabolites. Planta Medica 65, 442–443. Barnett, H.L. & Hunter, B.B. 1998 Illustrated Genera of Imperfect Fungi, 4th edn. pp. 94–95. Minnesota: APS Press. ISBN 0-89054192-2. Bayerdo¨rffer, E., Miehlke, S., Mannes, G.A., Sommer, W., Hochter J., Weingart, W., Helewein, H., Klann, T., Simon, W., Schmitt, E., Bastlein, A., Eimiller, R., Hatz, N., Lehn, P., Dirschedl, P. &

557 Stolte, M. 1995 Double-blind trial of omeprazole and amoxicillin to cure Helicobacter pylori infection in patients with duodenal ulcer. Gastroenterology 108, 1412–1417. Bazzoli, F., Zagari, R.M., Fossi, S., Pozzato, P., Alampi, G., Simoni, P., Sottili, S., Roda, A. & Roda, E. 1994 Short-term low-dose triple therapy for the eradication of Helicobacter pylori infection. European Journal of Gastroenterology and Hepatology 6, 773–777. Bell, G.D., Powell, K.U., Burridge, S.M., Bowden, A.F., Atoyebi, W. & Bolton, G.H. 1995 Rapid eradication of Helicobacter pylori infection. Alimentary Pharmacology and Therapeutics 9, 41–46. Carroll, G.C. 1988 Fungal endophytes in stems and leaves: from latent pathogen to mutualistic symbiont. Ecology 69, 2–9. Cole, R.J. & Cox, R.H. 1981 Handbook of Toxic Fungal Metabolites. pp. 806–807. New York: Academic Press. ISBN 0121797600. Curtis, R.F., Harries, P.C., Levi, J.D., & Phillips, D.M. 1966 The biosynthesis of phenols. Part X. Mutation and radioactive tracer studies relating to the biosynthesis of sulochrin. Journal of the Chemical Society 168–174. Cushley, R.J. & Filipenko, J.D. 1976 13C fourier transform N.M.R. XIII-reassignment of the 13C spectrum of ergosterol. Organic Magnetic Resonance 8, 308–309. Dekker, K.A., Inagaki, T., Gootz, T.D., Huang, L.H., Kojima, Y., Kohlbrenner, W.E., Matsunaga, Y., Mcguirk, P.R., Nomura, E., Sakakibara, T., Sakemi, S., Suzuki, Y., Yamauchi, Y. & Kojima, N. 1998 New quinolone compounds from Pseudonocardia sp. with selective and potent anti-Helicobacter pylori activity: taxonomy of producing strain, fermentation, isolation, structral elucidation and biological activities. The Journal of Antibiotics 51, 145–152. Frisvad, J.C. & Samson, R.A. 1990 Chemotaxonomy and morphology of Aspergillus fumigatus and related taxa. In Samson RA, Pin J I. Modern Concepts in Penicillum and Aspergillus Classification, eds. Samson, R.A., Pin, J.I. pp. 201–208. New York: Plenum Press. ISBN 0-306-43516-0. Gebert, B., Fischer, W., Weiss, E., Hoffmann, R. & Haas, R. 2003 Helicobacter pylori vacuolating cytotoxin inhibits T lymphocyte activation. Science 301, 1099–1102. Graham, D.Y., Lew, G.M., Malaty, H.M., Evans, D.J., Klein, P.D., Alpert, L.C. & Genta, R.M. 1992 Factors influencing the eradication of Helicobacter pylori with triple therapy. Gastroenterology 102, 493–496. Gunatilaka, A.A.L., Goplchand, Y., Schmitz, L. & Djerassi C. 1981 Minor and trace sterols in marine invertebrates. 26. Isolation and stracture elucidation of nine new 5a,8a-epidioxy sterols from four marine organisms. Journal of Organic Chemistry 46, 3860–3866 Hamasaki, N., Ishii, E., Tominaga, K., Tezuka, Y., Nakaoka, Y., Kadota, S., Kuroki, T. & Yano, I. 2000 Highly selective antibacterial activity of novel alkyl quinolone alkaloids from a Chinese herbal medicine, gosyuyu (wu-chu-wu), against Helicobacter pylori in vitro. Microbiology and Immunology 44, 9–15. Inamori, Y., Kato, Y., Kubo, M., Kamiki, T. & Takemoto, T. 1983 Studies on metabolities produced by Aspergillus terreus var. aureus. I. Chemical structures and antimicrobial activities of metabolites isolated from culture broth. Chemical and Pharmaceutical Bulletin 31, 4543–4548. Iwahori, A., Hirota, Y., Sampe, R., Miyano, S., Takahashi, N., Sasatsu, M., Kondo, I. & Numao, N. 1997 On the antibacterial activity of normal and reversed magainin 2 analogs against Helicobacter pylori. Biological and Pharmaceutical Bulletin 20, 805–808. Logan, R.P.H., Gummett, P.A., Schaufelberger, H.D., Greaves, R.R.F.H., Mendelson, G.M., Walker, M.M., Thomas, P.H., Baron, J.H. & Misiewicz, J.J. 1994 Eradication of Helicobacter pylori with clarithromycin and omeprazole. Gut 35, 323–326. Lu, H., Zou, W.X., Meng, J.C., Hu, J. & Tan, R.X. 2000 New bioactive metabolites produced by Colletotrichum sp., an endophytic fungus in Artemisia annua. Plant Science 151, 67–73. Ma, W.G., Li, X.C., Wang, D.Z. & Yang, C.R. 1994 Ergosterol peroxides from Cryptoporus volvatus. Acta Botanica Yunnanica 16, 196–200.

558 Ma Y.M., Li Y., Liu J.Y., Song Y.C. & Tan R.X. 2004 AntiHelicobacter pylori metabolites from Rhizoctonia sp. Cy064, an endophytic fungus in Cynodon dactylon. Fitoterapia 75, 451–456. Mahmoodian, A. & Stickings, C.E. 1964 Studies in the biochemistry of microorganisms. Journal of Biochemistry 92, 369–378. Matsueda, S. & Katsukura, Y. 1985 Antitumor-active photochemical oxidation products of provitamin D. Chemistry & Industry 12, 411. Megraud, F., Lehn, N., Lind, T., Bayerdo¨rffer, E., O’Morain, C., Spiller, R., Unge, P., Zanten, S.V.V., Wrangstadh, M. & Burman, C.F. 1999 Antimicrobial susceptibility testing of Helicobacter pylori in a large multicenter trial: the MACH 2 study. Antimicrobial Agents and Chemotherapy 43, 2747–2752. Moran, A.P. & Upton, M.E. 1986 A comparative study of the micro coccoid forms of Campylobacter jejuni ATCC 29428. Journal of Bacteriology 60, 103–110. Ohsaki, A., Takashima, J., Chiba, N. & Kawamura, M. 1999 Microanalysis of a selective potent anti-Helicobacter pylori compound in a Brazilian medicinal plant, Myroxylon peruiferum and the activity of analogues. Bioorganic and Medicinal Chemistry Letters 9, 1109–1112. Ohashi, H., Ueno, A., Nakao, T., Ito, J., Kimura, K., Ishikawa, M., Kawai, H., Iijima, H., & Osawa, T. 1999 Effects of orthosubstituent groups of sulochrin on inhibitory activity to eosinophil degranulation. Bioorganic and Medicinal Chemistry Letters 9, 1945–1948.

Y. Li et al. Okuda, S., Iwasaki, S., Sair, M.I., Inoue, A. & Tsuda, K. 1967 Stereochemistry of helvolic acid. Tetrahedron Letters 24, 2295–2302. Oxley, P. 1966 Cephalosporin P1 and helvolic acid. Journal of the Chemical Society 20, 729–730. Sharara, A.I., Chedid, M., Araj, G.F., Barada, K.A. & Mourad, F.H. 2002 Prevalence of Helicobacter pylori resistance to metronidazole, clarithromycin, amoxycillin and tetracycline in Lebanon. International Journal of Antimicrobial Agents 19, 155–158. Takashima, J., Chiba, N., Yoneda, K. & Ohsaka. A. 2002 A new rotenoid from Derris malaccensis plain and anti-Helicobacter pylori activity of its related constituents. Journal of Natural Products 65, 611–613. Tan, R.X. & Zou, W.X. 2001 Endophytes: a rich source of functional metabolites. Natural Product Reports 48, 448–459. Taniguchi, M., Nagai, K., Watanabe, M., Nimura, N., Suzuki, K.I. & Tanaka, A. 2002 YM-181741, a novel benz[a]anthraquinone antibiotic with anti-Helicobacter pylori activity from Streptomyces sp. The Journal of Antibiotics 55, 30–35. Turner, W.B. 1965 The production of trypacidin and monomethylsulochrin by Aspergillus fumigatus. Journal of the Chemical Society 6658–6660. Xie, Z.W., Fan, C.S. & Zhu, Z.Y. 1996 Atlas of National Traditional Chinese Medicinal Herbs, 2nd edn. pp. 505–506. Beijing: People’s Hygiene Press. ISBN 7-117-02185-3. Zaika, L.L. 1998 Spices and herbs: their antimicrobial activity and its determination. Journal of Food Safety 9, 97–118.

Springer 2005


Preliminary research of the RAPD molecular marker-assisted breeding of the edible basidiomycete Stropharia rugoso-annulata Pei-Sheng Yan* and Jia-Hui Jiang Institute of Applied Mycology, Laiyang Agricultural University, Laiyang, Shandong 265200, China *Author for correspondence: E-mail: [email protected] Keywords: Molecular breeding, monokaryotic parent, RAPD genetic distance, Stropharia rugoso-annulata

Summary The average RAPD molecular genetic distance was proposed as a criterion in selecting monokaryotic parents for cross breeding and predicting the performance of hybrids of the mushroom Stropharia rugoso-annulata. Three groups of cross pairs or hybrids were recognized based on the average RAPD genetic distance of the monokaryotic parental population. The RAPD-based molecular genetic distance significantly correlated with hybrid mycelial growth rate and mycelial growth heterosis, and their determination coefficients were 0.9237 and 0.8464 respectively. One of the hybrids in group I showed more vigorous mycelial growth in different pH conditions, incubation temperatures, carbon and nitrogen sources, and higher mushroom yield compared with its dikaryotic parent. These results suggested that RAPD-based molecular genetic distance of the monokaryotic parents might be a suitable criterion for selecting monokaryotic parents and predicting the performance of hybrids in mushroom cross breeding.

Introduction Stropharia rugoso-annulata (King stropharia or Wine cap) is a gorgeous, nutritional and functional mushroom with a pleasant refreshing taste of delicate fragrance, crisp and slightly sweet. The mature mushroom can grow to an enormous size, with the wine red cap of 30 cm in diameter and a weight of five pounds and more. However, the unveiled younger mushrooms are the most desirable for human consumption. King stropharia is so prolific that its mycelia can grow on raw straw materials. Even at a high temperature growing season, pasteurization of the materials for several hours is generally sufficient for successful production, which is unlike other mushrooms such as the button mushroom (Agaricus bisporus) or shiitake mushroom (Lentinula edodes) for which materials need to be fermented for more than 2 weeks or sterilized by autoclaving. Obviously, the cultivation of Stropharia rugoso-annulata will diversify world production of mushrooms, which is now gaining more and more importance because of their nutritional and functional properties. This fungus can also be used in the bioremediation of contaminated explosives (such as TNT), chlorophenols and lignin (Scheibner et al. 1997; Schlosser et al. 2000; Steffen et al. 2000). Nowadays, Stropharia rugoso-annulata is already being cultivated in some countries (Balazs 1978; Szudyga 1978; Huang 1995; Bonenfant-Magne et al. 1997, 2000; Yan & Li 2001).

However, the main problem faced by growers is the low biological efficiency. Cross breeding is routinely exploited in mushroom strain improvement and crop variety selection. Traditionally, it is thought that there is a relationship between yield or yield heterosis and genetic distance as measured by geographical distance, morphological and physiological characters and isozyme markers. Although yieldpredicting results based on these genetic distance estimates are not always consistent, breeders continue to recognize the importance of genetic distance in hybrid development programmes. Several reasons for the inconsistent association between genetic distance of parents and hybrid yield have been given. Genetic distance or diversity, as measured by geographical distance, physiological and biochemical markers, may not contribute superior cross performance or may not be linked to loci that contribute to heterosis. In addition, these markers represent only a small fraction of the genotype, and thus might not adequately reflect genetic diversity at the level required to predict performance (Smith et al. 1990). Molecular markers such as RFLP and RAPD have been used in crop cross breeding (Smith et al. 1990; Dudley et al. 1991). Smith’s results (1990) showed that genetic distance based on RFLPs accounted for 87% of the variation in F1 grain yield and 76% of the variation in grain yield heterosis, indicating a strong relationship between RFLP-based genetic distance and maize grain yield.

560 For mushroom cross breeding, there are two kinds of parents, one is the dikaryotic parent which is like the diploid in plants, and the other is the monokaryotic parent which is like the haploid in plants. Unlike the haploid (such as pollen) in plants, monokaryotic parents of mushrooms can be artificially cultured and easily preserved and recycled for future use. Therefore, their genetic diversity could be analysed before using in cross breeding without losing the materials. In conventional mushroom cross breeding, only the dikaryotic parents are usually selected and evaluated by traditional methods, such as the geographic origin, productivity, morphological and physiological characters. Nevertheless, it is the monokaryotic parents that are used directly in cross breeding. The difference among dikaryotic parents might not accurately reflect the difference among monokaryotic parents, as genetic variability might occur during the meiosis. Results have already confirmed that genetic variation had occurred in the single-spore progeny of wild Agaricus species, cultivated Agaricus bisporus and Stropharia rugoso-annulata by RAPD data (Khush et al. 1992; Calvo-Bado et al. 2000; Yan et al. 2003). As the monokaryotic parents can grow on artificial medium and be preserved for future use, it will be more accurate to use the genetic diversity or distance of monokaryotic parents as a criterion to select the parents than that of dikaryotic parents in cross breeding. From this new standpoint, we utilized the RAPD molecular genetic distance between monokaryotic parents of Stropharia rugoso-annulata as a criterion to select the monokaryotic parents for cross breeding, and investigated some biological characteristics of hybrid and its dikaryotic parent at the same time, in order to provide a simple but effective method to predict the heterosis and performance of hybrids in mushrooms.


P.-S. Yan and J.-H. Jiang Measurement of mycelial growth rate, heterosis and mushroom yield Mycelial growth rates of each hybrid of all three groups were studied by using PGP agar plate (7 cm in diameter) as the culture medium. An agar disc (5 mm diameter) containing the young mycelium was inoculated in the centre of the PGP agar plate. The inoculated plates were incubated at 25 C, and the mycelial growth was measured as it reached the edge of the Petri dish. Three repetitions were made for each hybrid. The mycelial growth heterosis of a hybrid was determined according to the formula H ¼ [(F1 ) CK)/ CK · 100], where H was heterosis, F1 was the mycelial growth rate of a hybrid, and CK was the mycelial growth rate of the dikaryotic parent. For determination of mushroom yield, the hybrid was cultivated on wheat straw substrate treated by soaking in 1% lime solution for 24 h. The moisture content of the substrate was adjusted to ca. 65%. Two beds (0.4 m2 in size for each bed) were prepared for each strain, and 10 kg of wheat straws (on dry base) that were inoculated with the corresponding spawn at a proportion of 5% (w/w) was used for each bed. The spawn run temperatures were maintained at 25 ± 1 C. When the substrates were colonized completely by the mycelium, the substrates were then covered with a loam soil casing layer to a depth of ca. 5 cm. The moisture content of the casing layer was maintained at 35–40% by regular and light watering. When mycelium was visible at the casing surface, the air temperature and relative humidity were maintained at 20–25 C and 90–95% respectively for primordia initiation and fruitbody development. The younger fruitbodies with unveiled caps were picked every day during fruiting and the fresh weight was measured (Yan & Li 2001). The biological efficiency (BE) was determined as the ratio of harvested mushroom fresh weight to substrate dry weight and expressed as a percentage (%).

Fungal strains Biological characteristics Sixteen monokaryotic parents designated as A, B, C,…, P, which were the same population used in our previous research (Yan et al. 2003), were isolated from the dikaryotic parent of strain R0 (available from authors) by singlespore isolation method. PGP medium (potato 200 g, glucose 20 g, peptone 5 g, agar 20 g, distilled water 1000 ml, pH 6.0) was used routinely for vegetative culture throughout this study. Cultures were incubated on PGP medium at 25 C and maintained on PGP slant at 4 C. Calculation of RAPD molecular genetic distance and grouping of hybrids RAPD reactions and calculation of genetic similarity coefficient (SC) between monokaryotic parents have been described previously (YAN et al. 2003). RAPD molecular genetic distance (GD) was calculated according to the formula: GD ¼ 1) SC (Nei et al. 1979).

The following parameters were investigated for their effects on mycelial growth of a hybrid and its dikaryotic parent R0: carbon sources, nitrogen sources, incubation temperatures and initial pH value. The basal medium was sucrose 50 g, NH4NO3 3 g, MgSO4 Æ 7H2O 1 g, FeSO4 Æ 7H2O 0.1 g, agar 18 g, distilled water 1000 ml, pH 6.0. For the carbon sources tested, the sucrose in the basal medium was substituted by the same amount of glucose, fructose, maltose, lactose, semilactose and starch respectively. For the nitrogen sources tested, the ammonium nitrate in the basal medium was substituted by the same amount of beef extract, peptone, yeast extract, wheat bran, soybean powder, NH4Cl, (NH4)2SO4 and (NH4)2CO3 respectively. PGP agar medium was used in temperature and pH value experiments. Seven different incubation temperatures were tested, namely 5, 10, 15, 20, 25, 30 and 35 C. Nine

Breeding of Stropharia rugoso-annulata

561

different pH values were tested, namely 4, 5, 6, 7, 8, 9, 10, 11 and 12. Different pH values in PGP medium were adjusted with 0.1 M HCl or 0.1 M NaOH before autoclaving. After autoclaving, the media were used for experiment directly. The inoculation method and measurement of mycelial growth were the same as above described. All the inoculated dishes were incubated at 25 C, except in the temperature experiment. Three replicates were performed for each parameter level.

Results and discussion Grouping of hybrids based on RAPD molecular genetic distance Genetic heterogeneity among single-spore isolates from the same fruitbody of Stropharia rugoso-annulata has been detected by RAPD in our previous research [Yan et al. (2003), where the similarity values between single-spore isolates had been presented (Table 1, p. 739)]. In order to devise a simple but effective method for breeding, the same population of single-spore isolates was used as the monokaryotic parents in cross breeding, and their RAPD molecular genetic distances were chosen as a criterion for making crosses and selecting hybrids (Table 1). According to the genetic distance between pairwise crosses, three groups of hybrids were recognized. Group I was the pairwise crosses or hybrids with RAPD genetic distances significantly higher than the average RAPD genetic distance of the monokaryotic parental population. Group II was the hybrids whose RAPD genetic distances were not significantly different from the average RAPD genetic distance. Group III was the hybrids whose RAPD genetic distances were significantly lower than the average RAPD genetic distance. As Stropharia rugoso-annulata is a tetrapolar fungus, there are only 25% fertile crossings among sibling monokaryotic parents. Therefore, 33 fertile

crossings or hybrids were obtained totally in our research. Out of these, 8 hybrids belonged to group I, 14 hybrids belonged to group II, and 11 hybrids belonged to group III (Table 2). Relationship of RAPD molecular genetic distance with mycelial growth heterosis of hybrids Mycelial growth ability has been found to be positively correlated with fruitbody yield and is an important characteristic for selection in mushroom breeding programmes (Furlan et al. 1997; Salmones et al. 1997; Larraya et al. 2002), therefore, 29 hybrids were subjected to measurement of their mycelial growth rates and determination of their heterosis. Results showed that the hyphae of all the hybrids in group I grew significantly faster than their dikaryotic parent R0 (0.368 cm/day), among which G–P cross showed the highest mycelial Table 2. Relationship of RAPD genetic distance with mycelial growth rates and heterosis of different hybridsa. Types of hybrids

Group I

Group IIb

Group III

Number of hybrids 8 14 11 RAPD Genetic distance Mean 0.448 ± 0.058 0.349 ± 0.017 0.244 ± 0.052 Range 0.556 0.391 0.368 0.333 0.300 0.130 Mycelial growth rates (cm/day) Mean Range

0.462 ± 0.048 0.371 ± 0.016 0.279 ± 0.070 0.522 0.406 0.397 0.346 0.342 0.100

Heterosis (%) Mean Range

25.4 ± 12.9% 0.71 ± 4.42% )24.1 ± 19.1% 41.8–10.3% 7.9 to )6.0% )7.1 to )72.8%

a

Mycelial growth rate of dikaryotic parent R0 was 0.368 cm/d. In group II, four hybrids were contaminated during preservation, therefore only 10 out of 14 hybrids were used in measurement of mycelial growth. b

Table 1. Matrix of RAPD genetic distance between monokaryotic parents of Stropharia rugoso-annulata. A B C D E F G H I J K L M N O P

0 0.429 0.167 0.579 0.444 0.529 0.231 0.556 0.286 0.286 0.333 0.467 0.200 0.500 0.375 0.412 A

0 0.429 0.333 0.200 0.158 0.200 0.400 0.250 0.375 0.294 0.294 0.294 0.222 0.333 0.368 B

0 0.474 0.333 0.529 0.385 0.444 0.286 0.286 0.333 0.467 0.333 0.500 0.375 0.294 C

0 0.120 0.250 0.500 0.360 0.333 0.429 0.273 0.455 0.455 0.391 0.391 0.250 D

0 0.130 0.368 0.333 0.200 0.400 0.143 0.333 0.333 0.364 0.364 0.217 E

0 0.333 0.391 0.263 0.474 0.200 0.300 0.400 0.333 0.429 0.364 F

0 0.474 0.333 0.333 0.500 0.375 0.250 0.412 0.412 0.556 G

0 0.400 0.300 0.429 0.238 0.429 0.182 0.182 0.391 H

0 0.250 0.176 0.294 0.294 0.333 0.222 0.263 I

0 0.412 0.412 0.412 0.222 0.222 0.368 J

0 0.333 0.333 0.368 0.368 0.200 K

0 0.333 0.263 0.263 0.500 L

0 0.368 0.263 0.400 M

0 0.200 0.333 N

0 0.333 N

0 P

Note: D, E, I, P were different monokaryotic parents with A1B1 mating type; B, C, F, G, N, O were different monokaryotic strains with A2B2 mating type; J, K, M were different monokaryotic strains with A1B2 mating type; A, H, L were different monokaryotic strains with A2B1 mating type.

562 growth rate (0.522 cm/day, Table 2). In group II, four hybrids were lost due to the contamination. Therefore, only 10 out of 14 hybrids were used in mycelial growth measurement. Results suggested that only the G–E cross showed significantly faster growth rate than the dikaryotic parent R0, the others had no significantly different mycelial growth rate. In contrast, in group III, all the hybrids showed significantly lower mycelial growth rate than their dikaryotic parent R0, except for H–J, C–P and C–I crosses, which had no significant differences from their dikaryotic parent R0. Correlation analysis showed that the correlation coefficients for RAPD molecular genetic distance with mycelial growth rate and mycelial growth heterosis were 0.9611 and 0.9202 respectively, and their determination coefficients were 0.9237 and 0.8464 respectively, suggesting that RAPD molecular genetic distance of monokaryotic strain is a suitable criterion for selecting cross parents and hybrids and predicting the performance of hybrids. Biological characteristics and mushroom yield of hybrid The G–P cross, which showed the fastest mycelial growth rate among all crosses, was chosen as an indicator to investigate the biological characteristics of hybrids, and thereafter it was designated as hybrid no. 1. For the temperature experiment, the hyphae of hybrid no. 1 grew faster than that of its dikaryotic parent R0 at all tested temperatures, especially for temperatures from 15 to 20oC (Figure 1). However, both hybrid no. 1 and its parent R0 could not grow at 35 C. The pH experiment showed that hybrid no. 1 grew faster than its parent R0 at pH 4–10, with no growth at pH 12 for hybrid no. 1 as well as its parent R0 (Figure 2). Hybrid no. 1 showed a tendency of growing faster when organic nitrogen sources were used, whereas the parent R0 showed a tendency of growing faster when inorganic nitrogen sources were used (Figure 3). Both hybrid no. 1 and its parent R0 could not grow when (NH4)2CO3 served as nitrogen source. There was no significant difference for mycelial growth between hybrid no. 1 and its parent R0 when different carbohydrates served as

Figure 1. Mycelial growth of hybrid no. 1 and its parent R0 at different incubation temperatures.

P.-S. Yan and J.-H. Jiang

Figure 2. Mycelial growth of hybrid no. 1 and its parent R0 at different pH value.

carbon sources, except for glucose on which parent R0 grew faster than hybrid no.1 (Figure 4). For the mushroom yield, the primary results showed that hybrid no.1 yielded 0.68 kg mushroom/m2, and the biological efficiency was 68.0%, which was significantly higher than that of the parent R0 (yield was 0.42 kg mushroom/m2, and BE was 42.0%). We are now investigating in detail the mushroom qualities, such as the cap diameter, thickness, firmness, the ratio of cap diameter to stipe length, and also investigating the mushroom yield performance of the other hybrids we obtained in this research. Thereafter, we will evaluate the yield heterosis performance of the hybrids selected, based on the RAPD molecular genetic distance of the monokaryotic parents. RAPD and RFLP markers have been widely applied in plant breeding (Smith et al. 1990; Dudley et al. 1991; Garcia et al. 1998; Dubreuil & Charcosset 1999). In this research, we primarily demonstrate the effectiveness of the RAPD marker-estimated genetic distance in inbreeding of Stropharia rugoso-annulata. Outbreeding among unrelated monokaryotic strains is more popular

Figure 3. Effects of nitrogen sources on mycelial growth of hybrid no. 1 and its parent R0.

Breeding of Stropharia rugoso-annulata

Figure 4. Effects of carbon sources on mycelial growth of hybrid no. 1 and its parent R0.

than inbreeding among sibling monokaryotic strains for heterothallic mushrooms. As the dominant RAPD markers could provide more accurate information on population genetic diversity than traditional methods, we anticipate that the RAPD molecular genetic distance based on monokaryons derived from different dikaryotic parents should also be useful for predicting hybrid performance in outbreeding of Stropharia rugoso-annulata, and perhaps also for other mushrooms.

References Balazs, S. 1978 Stropharia Growing Problems in Hungary. Report of the Vegetable Crops Research Institute, Kecskemet, Hungary. Bonenfant-Magne, M., Magne, C. & Lemoine, C. 1997 Characterization of cultivated strains of a new edible mushroom: Stropharia rugoso-annulata. II. Anatomy, mycelium development and fructification. Comptes Rendus de l’Academie des Sciences. Serie III, Sciences de la Vie 320, 917–924. Bonenfant-Magne´, M., Magne´, C. & Lemoine. C. 2000 Pre´paration d’un substrat de culture pour le strophaire (Stropharia rugosoannulata) par trempage de re´sidus ligno-cellulosiques agricoles. Canadian Journal of Botany 78, 175–180. Calvo-Bado, L., Noble, R., Challen, M., Dobrovin-Pennington, A. & Elliott, T. 2000 Sexuality and genetic identity in the Agaricus section Arvenses. Applied and Environmental Microbiology 66, 728–734. Dubreuil, P. & Charcosset, A. 1999 Relationships among maize inbred lines and populations from European and North-American origins

563 as estimated using RFLP markers. Theoretical and Applied Genetics 99, 474–480. Dudley, J.W., Saghai Maroof, M.A., & Rufener, G.K. 1991 Molecular markers and grouping of parents in maize breeding programs. Crop Science 31, 718–723. Furlan, S.A., Virmond, L.J., Miers, D.A., Bonatti, M., Gern, R.M.M. & Jonas, R. 1997 Mushroom strains able to grow at high temperatures and low pH values. World Journal of Microbiology and Biotechnology 13, 689–692. Garcia, E., Jamilena, M., Alvarez, J.I., Arnedo, T., Oliver, J.L. & Lozano, R. 1998 Genetic relationships among melon breeding lines revealed by RAPD markers and agronomic traits. Theoretical and Applied Genetics 96, 878–885. Huang, N. 1995 Classification and characterization of Stropharia rugoso-annulata. Edible Fungi 6, 11. Khush, R.S., Becker, E. & Wach, M. 1992 DNA amplification polymorphisms of the cultivated mushroom Agaricus bisporus. Applied and Environmental Microbiology 58, 2971–2977. Larraya, L. M., Idareta, E., Arana, D., Ritter, E., Pisabarro, A.G. & Ramirez. L. 2002 Quantitative trait loci controlling vegetative growth rate in the edible basidiomycete Pleurotus ostreatus. Applied and Environmental Microbiology 68, 1109–1114. Nei, M. & Li, W.H. 1979 Mathematic model for studying genetic variation between species in terms of restriction endonuclease. Proceedings of the National Academy of Sciences of the United States of America 76, 5269–5273. Salmones, D., Gaitań-Hernańdez, R., Pe´rez, R. & Guzmań, G. 1997 Studies on genus Pleurotus. VIII. Interaction between mycelial growth and yield. Revista Iberoamericana de Micologia 14, 173– 176. Scheibner, K., Hofrichter, M., Herre, A. & Michels, J. 1997 Screening for fungi intensively mineralizing 2,4,6-treinitrotoluene. Applied Microbiology and Biotechnology 47, 452–457. Schlosser, D., Grey, R., Hofer, C. & Fahr, K. 2000. Degradation of chlorophenols by basidiomycetes. In Bioremediation of contaminated soils, eds. Wise, D.L., Trantolo, D.L., Cichon, E.J., Inyang, H.I. & Stottmeister, U. pp. 393–408. New York: Marcel Dekker Inc. ISBN 0824703332. Smith, O.S., Smith, J.S.C., Bowen, S.L., Tenborg, R.A. & Wall, S.J. 1990 Similarities among a group of elite maize inbreds as measured by pedigree, F1 grain yield, grain yield, heterosis and RFLPs. Theoretical and Applied Genetics 80, 833–840. Steffen, K.T., Hofrichter, M. & Hatakka, A. 2000 Mineralisation of 14 C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi. Applied Microbiology and Biotechnology 54, 819–825. Szudyga, K. 1978 Stropharia rugoso-annulata. In The Biology and Cultivation of Edible Mushrooms, eds. Chang, S.T. & Hayes, W.A. pp. 559–571. New-York: Academic Press. ISBN 0-12-168050-9. Yan, P.-S. & Li, G.-F. 2001 High yield cultivation of Stropharia rugoso-annulata. Edible Fungi (extra issue), 19–20. Yan, P.-S., Jiang, J.-H., Li, G.-F. & Deng, C.-L. 2003 Mating system and DNA polymorphism of monokaryons with different mating type of Stropharia rugoso-annulata. World Journal of Microbiology and Biotechnology 19, 737–740.


Springer 2005

Determination of poly-b-hydroxybutyrate (PHB) production by some Bacillus spp. Mirac Yilmaz1,*, Haluk Soran1, and Yavuz Beyatli2 1 Hacettepe University, Faculty of Education, Department of Science and Mathematics Fields in Secondary Education, Ankara, Turkey 2 Department of Biology, Faculty of Science and Arts, Gazi University, Ankara, Turkey *Author for correspondence: Tel.: +90-312-297 86 00, Fax:+90-312-299 20 83. E-mail: [email protected] Keywords: Bacillus, bioplastic, isolation, PHB, soil

Summary In this study, 29 strains of the genus Bacillus were isolated from different soil samples which were taken from grasslands of Ankara, Turkey and were identified as B. brevis, B. sphaericus, B. cereus, B. megaterium, B. circulans, B. subtilis, B. licheniformis and B. coagulans. Two strains, B. sphaericus ATCC 14577 and B. subtilis ATCC 6633 were also included in this study. Poly-b-hydroxybutyrate (PHB) production by these strains was determined by the spectrophotometric method, and it was found that PHB production ranged from 1.06–41.67% (w/v) depending on the dry cell weight. The highest PHB production and productivity percentage was found in B. brevis M6 (41.67% w/v).

PHB and its copolymers have been drawing considerable industrial interest as biodegradable and/or biocompatible. They are used in packaging, medicine and agriculture for a wide range of applications. PHB is accumulated as intracellular granules by many prokaryotic organisms (including Alcaligenes spp., Bacillus spp., Azotobacter spp., Pseudomonas spp.) as they enter the stationary phase of growth, to be used later as an internal reserve of carbon and energy (Lee 1996, Braunegg et al. 1998). The aim of the present work was selection of Bacillus spp. PHB producers. In this study, the Bacillus spp. from soil were isolated and identified, and their PHB production was determined. About 15–20 g of soil samples scraped within 5–8 cm depth with a sterile spatula were collected from native grass lands in eight areas of Ankara, Turkey. The samples were placed in sterile plastic bags and stored at 4 C. Each gram of the sample was suspended in 9 ml sterile distilled water and shaken vigorously for 2 min. The samples were heated at 60 C for 60 min in water bath. Than the liquid was serially diluted in sterile distilled water, and dilutions from 10)1 to 10)7 were plated on nutrient agar medium. Plates were incubated at 30 C for 24–48 h. In the identification process, Bacillus species were initially selected based on the Gram reaction, spore morphology and the catalase test. The isolates were then characterized by their growth at various temperatures (5, 30, 40, and 65 C) and at different pH values (5.7, 6.8), tolerance of different salt levels (2, 4 and 10 g NaCl/100 ml), production of gas from glucose and reduction of nitrate. In addition esculin and starch hydrolysis, production of acid from D -glucose, D -mannitol, lactose, galactose, sucrose,

raffinose, D -xylose, L -arabinose, fructose and maltose (1 g/100 ml) were also examined. These results obtained from the tests mentioned above were compared with the standard taxonomic descriptions from Sneath (1986) and the Bacillus species were identified. The bacterial strains were cultivated in nutrient broth (NB) which contained (per l) 1 g lab-lemco powder, 2 g yeast extract, 5 g peptone and 5 g NaCl. The pH was adjusted to 6.8 with 0.01 M HCl and 0.01 M NaOH. Fermentations were carried out in 250 ml Erlenmeyer flasks containing 100 ml of culture medium. The temperature was maintained at 30 C, and the agitation was maintained at 100 rev/min. The cultures were inoculated with 2% (v/v) inocula. Determination of the amount of PHB was performed chemically. Bacteria were grown on nutrient broth medium at 30 C for 48 h on a shaker. Suspensions of cultures were centrifuged at 6000 · g for 30 min. Then the pellets were suspended in 5 ml of sterile water and homogenized, using ultrasonic treatment (5 min.). To 2 ml of the cell suspension was added 2 ml of 2 M HCl and it was heated at boiling temperature for 2 h in a water bath and the tubes were centrifuged at 6000 · g for 20 min. Five millilitre of chloroform were added to the resulting precipitate. The test tubes were left overnight at 28 C on a shaker at 150 rev/min. Then the contents of the test tubes were centrifuged at 6000 · g for 20 min, and extracted with 0.1 ml of chloroform, and were dried at 40 C. Five millilitre of concentrated sulphuric acid was added. The tubes were heated at 100 C in a water bath for 20 min. After cooling to 25 C, the amount of PHB was determined on a u.v. spectrophotometer, wavelength 235 nm

566

M. Yilmaz et al.

(Bonartseva & Myschkina 1985; Aslim et al. 1998). In order to compare the PHB amounts produced by our isolates, two test bacteria were used (B. sphaericus ATCC 14577 and B. subtilis ATCC 6633, Ankara University Department of Biology). The correlation between production of PHB and dry cell weight was determined by Spearman’s q correlation coefficient test (Conover 1971). As a result of the identification tests, 29 Bacillus spp. isolates were identified as 3 B. brevis, 1 B. sphaericus, 3 B. cereus, 5 B. megaterium, 6 B. circulans, 4 B. subtilis, 4 B. licheniformis and 3 B. coagulans. In this study, the productions of PHB by 31 Bacillus strains ranged between 0.004–0.160 g/l with a productivity of 1.06– 41.67% (w/v). The production of PHB by B. subtilis ATCC 6633 (4.07%) and B. sphaericus ATCC 14577 (6.37% w/v) used for comparison as the test bacteria were similar with some of our isolates . The highest PHB production and productivity percentage were found in B. brevis M6 (41.67% w/v) (Table 1). It was investigated whether any relationship between the dry cell weight

and PHB production existed and the correlation was found q ¼ 0.397. When this value was compared with the table value, it was seen that the relationship was significant (q ¼ 0.397>0.305). Some of the A. eutrophus strains used for commercial PHB production have a PHB concentration which is approximately 80% (w/w) of the dry cell weight (Lee 1996). Chen et al. (1991), studied PHA in 11 different Bacillus spp. and found PHB consisting 50% (w/v) of dry cell weight of the bacteria. Labuzek & Radecka (2001) similarly reported that PHB was 25% (w/v) of dry cell weight for B. cereus UW85. Mercan & Beyatli (2001) reported about 32.5% (w/v) PHB in 10 B. sphaericus strains. Aslim et al. (2002) reported the production of PHB by 40 Bacillus spp. and found the highest value of PHB was 48% (w/v) for dry cell weight. When compared to related literature, our results show a higher PHB production. On the basis of data obtained in the present work, B. brevis M6 strain capable of PHB accumulation up to 41.67% (w/v) of dry cell weight was selected, and it may be employed for industrial production after the optimization of the conditions of PHB synthesis.

Table 1. PHB production by some Bacillus species in NB medium. Bacillus species

Dry cell weight (g/l)*

PHBa (g/l)*

Yield of PHBb (%)

B. brevis M2 B. brevis M4 B. brevis M6 B. sphaericus M3 B. sphaericus ATCC 14577 B. cereus M5 B. cereus M10 B. cereus M15 B. coagulans M8 B. coagulans M25 B. coagulans M35 B. megaterium M14 B. megaterium M21 B. megaterium M22 B. megaterium M26 B. megaterium M28 B. circulans M16 B. circulans M18 B. circulans M23 B. circulans M31 B. circulans M32 B. circulans M34 B. subtilis M17 B. subtilis M24 B. subtilis M29 B. subtilis M33 B. subtilis ATCC 6633 B. licheniformis M19 B. licheniformis M20 B. licheniformis M27 B. licheniformis M30

0.035 0.295 0.060 0.305 0.690

± ± ± ± ±

0.005 0.055 0.010 0.015 0.140

0.005 0.059 0.025 0.040 0.044

± ± ± ± ±

0.002 0.002 0.005 0.005 0.003

14.28 20.00 41.67** 13.11 6.37

0.345 1.535 0.580 0.190 0.370 0.445 1.195 0.630 0.430 0.655 0.425 0.460 0.375 1.000 0.435 0.450 0.535 0.480 0.845 0.470 0.535 0.415 1.010 1.310 0.410 0.445

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.115 1.005 0.050 0.010 0.020 0.065 0.205 0.000 0.020 0.265 0.035 0.030 0.025 0.640 0.015 0.020 0.015 0.050 0.475 0.070 0.035 0.015 0.320 0.540 0.040 0.055

0.095 0.059 0.097 0.046 0.032 0.064 0.087 0.078 0.052 0.036 0.047 0.033 0.036 0.021 0.038 0.084 0.042 0.066 0.050 0.032 0.072 0.016 0.054 0.060 0.005 0.004

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.430 0.010 0.031 0.010 0.004 0.001 0.006 0.001 0.004 0.005 0.019 0.013 0.015 0.000 0.015 0.021 0.001 0.026 0.008 0.003 0.026 0.006 0.006 0.025 0.000 0.000

27.53 3.84 16.72 24.21 8.90 14.5 7.28 12.41 12.31 5.57 11.14 7.35 9.61 2.12 8.88 18.83 7.95 13.93 6.01 6.92 13.47 4.07 5.37 4.64 1.26 1.06

* Values are the means ± standard deviations of duplicate measurements. a Determined at dry cell weight. b According to dry cell weight. ** The highest PHB production.

Acknowledgements This research has been supported by Hacettepe University BAB.

References Aslim, B., Caliskan, F., Beyatli, Y. & Gunduz, U. 1998 Poly-bhydroxybutyrate production by lactic acid bacteria. FEMS Microbiology Letters 159, 293–297. Aslim, B., Yuksekdag, Z.N. & Beyatli, Y. 2002 Determination of PHB growth quantities of certain Bacillus species isolated from soil. Turkish Electronic Journal of Biotechnology Special Issue, 24–30. Bonartseva, G.A. & Myskina, V.L. 1985 Fluorescence intensity of strains of nodule Bacteria (Rhizobium melliloti, R. phaseoli) differing in activity, grown in the presence of the lipophilic vital stain phosphine 3R. Microbiology (Engl. Transl. of Mikrobiologiya) 54, 4, 535–541. Braunegg, G., Lefebvre, G. & Genser, K.L. 1998 Polyhydroxyalkanoates, biopolyesters from renewable resources: Physiological and engineering aspects. Journals of Biotechnology 65, 127–161. Chen, G.Q., Ko¨nig, K.H. & Lafferty, R.M. 1991 Occurrence of polyD(-)-3- hydroxyalkanoates in the genus Bacillus. FEMS Microbiology Letters 84, 174–176. Conover, W.J. 1971 Practical Nonparametric Statistics. New York: John Wiley and Son. Inc. ISBN 0471168521. Labuzek, S., & Radecka, I. 2001 Biosynthesis of PHB tercopolymer by Bacillus cereus UW85. Journal of Applied Microbiology 90, 353– 357. Lee, S.Y. 1996 Bacterial polyhydroxyalkanoates. Biotechnology and Bioengineering 49, 1–14. Mercan, N. & Beyatli, Y. 2001 Production of poly-b-hydroxybutyrate (PHB) by Bacillus sphaericus strains. Journal of Biotechnology 25, 2, 1–7. Sneath, P.H.A. 1986 Endospore-forming Gram-positive rods and cocci, In Bergey’s Manual of Systematic Bacteriology. eds. Sneath, P.H.A., Mair, N.S., Sharpe, M.E. & Holt, J.G. Vol.2. pp. 1104– 1139. Baltimore: Williams and Wilkins. ISBN 0-68307-893-3.

Springer 2005


Negative effects of oil spillage on beach microalgae in Nigeria J.P. Essien* and S.P. Antai Environmental Microbiology and Biotechnology Unit, Department of Microbiology, University of Calabar, P. M. B. 1115, Calabar, Nigeria *Author for Correspondence: E-mail: [email protected] Keywords: Beach, epipsammic microalgae indicator, oil spill

Summary In a concerted effort to apply epipsammic microalgae indices as a biological indicator of crude oil pollution and natural remediation in a tropical estuarine environment, the direct effect of a recent oil spill on the abundance of microalgae in the coastal shore of the Qua Iboe Estuary was investigated. A significant negative effect of ) 2 contamination on the salinity, acidity and nutritive salts (CO2 3 , Cl , and SO4 ) levels of the sandy beach soil was observed. The Biological Index of Pollution (BIP) of the beach soil was raised from the previous slightly polluted level (18%) to 75, 88, 45 and 41% after contamination, at sampling distances of 5.5, 9.5, 11.5 and 15 m from the barrier used for pollution control. These corresponded with increases in the density of microalgae with distance from the barrier. This implies that the effect of oil pollution was more severe on microalgal cells that are close to the barrier. The overall effect was a distance-influenced reduction in the regeneration capabilities of the epipsammic microalgae. Some microalgal species, particularly the cyanobacterial species of Aphanizomenon flos-aquae, Lyngbya majusculata, and a centric diatom Actinoptychus undulatus may have been exposed to contamination levels exceeding normal homeostasis and compensation. They lost their existence in the sandy beach, and their absence is recommended for use as an indicator of the short term effect of oil pollution in coastal sandy beaches in a tropical estuarine environment.

Introduction Microalgae are of great importance to coastal processes including nutrient and oxygen cycling, they are an important component of the estuarine food web, fed upon by fish and birds. Recent researches have determined that microalgae have a larger effect on estuarine fisheries than previously thought, juveniles of many fish species consume microalgae in tidally flooded marshes (Green et al. 1992; Galvao 1997). For several reasons, phytoplankton are good environmental indicators. Their relative immobility means they are continuously exposed to any pollutant bound to beach sediment and sand. Estuaries such as the Qua Iboe Estuary are complex and constantly changing ecosystems. The main characteristic of estuarine zones is the high variability of environmental factors (i.e high temperature, salinity, acidity and nutrients) affecting growth and survival of organisms (Ukpong 1991, 1995; Peres-llorens et al. 2003,) Thus organisms that inhabit the estuarine ecosystem must have mechanisms to acclimate to, or otherwise survive, significant environmental stress. Recently Ubom & Essien (2003) have reported the rich epipsammic microalgae (algae found in sandy

beaches) community of Ibeno beach located at the mouth of the Qua Iboe Estuary. The response of the microalgal community (predominated by pinnate diatoms, and including cyanobacteria, chlorophyta, chrysophyta and few species of centric diatoms) found in the sandy beach of the estuary to a recent oil spill is a subject for investigation. The study here represents the first concerted attempt to apply epipsammic microalgae indices as a biological indicator of oil pollution and natural remediation in a tropical estuarine beach environment.

Material and methods Study area The area under investigation is a fine, sandy recreational coastal beach ridges covering about 560 km and located at Mkpanak in Ibeno, an oil-producing community of the Niger Delta Region of Nigeria. (Figure 1). The region has a humid tropical climate, the annual rainfall is 4021 mm with a peak (733 mm) in July–August. Least rainfall occurs in December–February (39 mm). An average relative humidity of 80% and mean minimum

568

J.P. Essien and S.P. Antai

Figure 1. (a) Ibeno beach at the mouth of Qua Iboe Estuary, showing the sampling locality (XX); (b) The Niger Delta region of Nigeria showing the location of the Qua Iboe Estuary.

and maximum temperatures of 22 and 30 C, respectively, are often experienced in the zone (Ukpong 1995). The beach is situated at the mouth of a mesotidal estuary. Tidal currents which are strong at the mouth of the estuary but weak along its upper reaches and creeks play an important role in biota distribution, including the distribution of microalgae in the coarse sandy recreational beach. The beach recently experienced a third tier spillage, which occurred on 22 November, 2003 from a leakage in the facility of an oil company located close (about 40 m) to the ‘beach’ environment. A boom (oil pollution control barrier) was induced at the beach for the cleanup exercise, and this study was conducted around the boom (Figure 2). Sample collection Sampling was carried out, precisely 1 week after the spillage, in three transects (T1, T2 and T3) established outwards from the boom, located at about 25 m from the low tide level. Eight beach soil samples were obtained at boom site and at 2 m intervals per transect giving a total of 24 samples. Also samples were obtained from apparently flooded (as a result, of tidal currents) sections of the beach. The designated points of collec-

tion, A, B, C and D were 5.5, 9.5, 11.6 and 15 m, respectively, from the boom. Samples from the flooded section were used for the determination of the biological index of pollution (BIP). Beach soils were also obtained from flooded and unflooded beach sites located at about 100 km from the crude oil boom site to serve as control. During sampling the top sand layer 5 cm deep containing the epipsammic algae was carefully scooped using a hand trowel from 5 cm · 5 cm area (at each sampling point) into clean 100 ml beakers. Physicochemical analysis of beach soil Soil samples from the various sampling points were mixed (based on the distance of sampling points (e.g. 2 m samples from T1 + T2 + T3) and the composite soil samples from the three transects were analysed using standard procedures. Soil extracts were prepared by rotating upside down 100 g of the beach soil in 25 ml of deionized water for 30 min; followed by centrifuging at 6000 · g for 10 min. The pH of the soil was measured by a Beckman pH metre. From the soil extract the organic carbon was determined by the Walkley Black method and total nitrogen by the microkjeldahl method (AOAC 1975; Page et al 1982; Jakobsen 1992). The soil particle size distribution was determined by the

569

Oil spillage effects on beach microalgal

Figure 2. A sketch of the oil boom site showing the sampling points at Ibeno Beach. T =transect, S ¼ sampling point, ABCD ¼ flooded sample points.

hydrometer method using Calgon as the displacing agent (AOAC 1975; Juo 1979). The exchangeable bases were extracted with 1 M ammonium acetate. Potassium and sodium in the extracts were determined by flame photometry, while calcium and magnesium were determined by an EDTA filtration method (Black et al. 1965). The salinity of the soil sample was determined from silver thiourea (AgTu) extracts and AgNO3 (0.1 M) titration using potassium chromate as indicator and calculated as total soluble salts (chlorides + sulphates). The oil content of the beach soil was determined by Soxhlet extraction (Page et al. 1982; Essien & Udosen 2000). The nutrient salts ) 2 (CO2 3 ,Cl and SO4 ) were determined according to the procedures described elsewhere (APHA 1998).

of epipsammic alga was estimated per gram of the soil sample using the formula below: D¼

m 1000 a

where D, is the density of each species per hectare, a, is the area of beach soil sample (5 cm · 5 cm) and m, is the number of individual species under the microscope. The enumerations of microalgae in the contaminated beach soil were repeated every 7 days (with samples obtained at 2 m intervals from the boom) to assess the ability of the microalgae to recover from the stress and regenerate. The percent regeneration rate of epipsammic microalgae was estimated using the formula: regeneration rate (%) ¼

Estimation of density of microalgae Beach soil samples meant for plankton analysis were ‘scooped’ into beakers containing 50 ml of physiological saline to avoid desiccation and, then preserved with 2.0 ml of 37% formaldehyde (Yakubu et al. 1998; Essien & Ubom 2003; Ubom & Essien 2003).This was followed by the addition of three drops of Lugols iodine solution and left to stand for 30 min which allowed the algae to settle. The samples were then reduced to 10 ml before decanting the supernatant aliquot. The number of algae was estimated using a 1.0 ml counting chamber filled with the concentrated phytoplanktonic sample and examined under a compound microscope equipped with a haemocytometer. The epipsammic algae observed were identified using the illustrations of freshwater (Woodhead & Tweed 1960; Han 1978; Carmichael 1981) and marine (Moore 1981a, b) algae. The average density per hectare of each species

D1 100 D2

where D1, is the density of microalgae in oil contaminated beach soil (on day 28) D2, is the density of microalgae in uncontaminated (control) beach soil.

Calculation of BIP The flooded beach soil samples obtained from points A, B, C, D of the clean-up site (Figure 2) and from the control site were used to calculate the BIP resulting from the oil spill. The procedure recommended, by WHO (1971) for the examination of water quality was adopted; but with modification. In the modified method 50 g of flooded beach soil (soil plus water) was treated with 100 ml of physiological saline to avoid desiccation and immediately reduced to 20 ml before decanting the

570


supernatant aliquot. The number of chlorophyll-bearing plankton (microalgae) designated A - and non-chlorophyll-bearing plankton (zooplankton) designated B were enumerated as previously described. The pollution of the flooded beach soil was estimated using the formula: BIP ¼

3B 100 AþB

Using the following values the pollution level of the crude oil contaminated beach was extrapolated. BIP value 0–8 8–20 20–60 60–100

Interpretation Clean Slightly polluted Polluted Heavily polluted

Results and discussion A previous study by Ubom & Essien (2003) revealed that the epipsammic habitat of the Qua Iboe Estuary is characterized by sandy sized soil particles, and the pH, salinity, organic carbon and nutritive salts (CO2 3 , Cl) and SO2 ) values recorded for the different locations are 4 usually close. The salinity of the beach soil is typical for those of a brackish water ecosystem with a high concentration of nutritive salts. However the amount of salts seems to be adequate for the growth of microalgae. In the present study there is remarkable variation in the physicochemical properties between the oil-polluted beach soil and soil from the ‘control’ site. Even at the polluted site, the beach soil exhibited noticeable but insignificant variation in properties between sampling distance from the oil boom location

(Table 1). However the variation between soil parameters was significant at P ¼ 0.001. At P ¼ 0.01, the high levels of oil content in polluted soil correlated positively with increase in the salinity, and nutritive salts (r ¼ 0.65 ) 2 for CO2 3 , for Cl and r ¼ 0.95 for SO4 ) levels of the beach soil (Table 2). On the other hand a negative correlation (r ¼ )8.88) was established between the oil content and pH levels of the beach soil. This implies that increase in oil content resulted in a decrease in the pH value of the soil, meaning an increase in soil acidity. The nitrogen and phosphorus levels of the contaminated soil were comparatively very low. These are an indication of an estuarine soil that is heavily contaminated with hydrocarbons. High levels of acidity and carbon concentration are often associated with oil-contaminated tropical soils (Odu 1981). Similarly, Rhykerd et at. (1995) noted that nitrogen and Phosphorus are in relatively short supply in oil-contaminated soils and are needed to complement the carbon supply for development of microbial biomass (ljah & Antai 2003). Responses to stress in algae are often indicated at the level of proteins. While stressful environmenta1 condition can induce synthesis of specific proteins (Fitzgerald et al. 1978) they can also affect protein stability and turnover by increasing the rate of proteolysis of specific proteins (Thiel 1990). For example in cyanobacteria, proteases have been implicated in the degradation of phycobiliproteins during photoacclimation and nutrient starvation, (Grossman 1993; Collier & Grossman 1994). The net effect is either a bloom or a reduction in density as a result of plasmolysis. In response to the oil spill in the beach environment, many microalgal species, particularly the cyanobacterial species of Aphanizomenon flos-aque, Lygnbya majusculata, Microcystis sp, Nodularia spumigena, Oscillatioria

Table 1. Some physicochemical properties of the oil-polluted beach soil. Parameters

pH Organic Carbon (%) Total nitrogen (%) Available P (mg/kg) Exchangeable Ca (mg/kg) Mg Na K Salinity (%) Particle size distribution Sand (%) Silt (%) Clay (%) Nutritive salts (mg/kg) Co2 3 Cl) SO2 4 Oil content (%)

Sampling distance from boom 100 km (control)

0m (boom)

2m

4m

6m

8m

10 m

12 m

7.13 0.19 0.03 3.98 96.5 24.8 8.11 12.81 3.6

5.9 21.12 0.009 1.03 88.3 23.4 11.31 11.41 10.4

6.4 22.1 0.007 1.28 82.11 24.4 9.88 12.01 8.6

6.4 20.10 0.008 1.49 89.21 25.5 10.11 11.71 7.3

6.4 13.42 0.01 2.11 94.31 24.6 10.41 10.91 6.8

6.8 10.3 0.02 2.18 91.29 24.5 9.77 12.61 6.6

7.1 8.10 0.03 3.10 94.5 23.3 8.22 13.01 5.4

7.2 6.12 0.02 3.21 93.6 24.1 8.66 12.91 5.2

98.1 1.04 0.94

98.2 1.04 0.94

98.1 1.05 0.4

97.8 1.10 0.91

98.1 1.05 0.94

98.2 1.06 0.92

97.8 1.22 0.98

98.2 1.03 0.95

0.28 506 26.5 2.1

13.21 718 61.3 48

9.62 688 54.5 31

11.21 54.9 48.13 23

10.21 710 44.21 10.8

8.31 688 38.21 7.7

6.12 621 33.11 5.8

11.28 588 31.12 5.1

Note: Values are mean of duplicate determinations. No significant effect of distance on the physicochemical properties but significant effect (P = 0.001) occurred amongst the parameters.

571

Oil spillage effects on beach microalgal Table 2. Correlation between oil content and nutritive salts of crude oil-contaminated beach soil. Parameters

Co2 3 (mg/kg) )

Cl (mg/kg) So2 4 (mg/kg) pH salinity (%)

Oil content (%) 48 (0 m)

31 (2 m)

23 (4 m)

10.8 (4 m) 7.7 (8 m)

5.8 (10 m)

5.1 (12 m)

r at P = 0.01

13.21 718 61.3 5.9 10.4

9.62 688 45.5 6.4 8.6

11.21 547 48.13 6.4 7.3

10.21 710 44.4 6.4 6.8

6.12 621 38.21 7.1 5.4

11.28 588 13.12 7.2 5.2

r r r r r

8.31 688 38.21 6.8 6.6

= = = = =

0.65 ns 0.35 ns 0.95 ns )0.88 ns 0.97 ns

Values in parenthesis are sampling distances at which the oil content levels were derived. S – significant; ns – not significant.

Table 3. Distance influenced impact of oil spill on the density (organisms/ha) of epipsammic algae at lbeno beach. (samples collected 7 days after spillage). Microalgae Species

Bacillariophyta Actinoptychus undulatus Cymbella lanceolata Cymatopleura solea Coceoneis pediculus Navicula rhynocephala Navicula radiosa Rhoicosphenia curvata Cyanobacteria Aphanizomenon flos-aquae Lyngbya majusculata Microcystis sp Nodularia spumigena Oscillatoria nigroviridis Chrysophyta Chromulina globosa Chlorophyta Astasis fustis Euglena intermedia Urceolus cyclostomus Total Abudance

Order

Sampling Distance 0m

2m

4m

6m

8m

10 m

Centrales Pennales Pennales Pennales Pennales Pennales Pennales

0 0 0 0 0 0 0

0 0 0 0 0 0 0

0 0 0 0 0 0 0

0 0 0 0 0 0 0

0 0 0 0 0 0 0

0 0 0 0 0 0 0

0 3 2 1 1 2 1

0 8 2 4 5 8 5

33 17 16 14 21 18 21

Blue–Green Blue–Green Blue–Green Blue–Green Blue–Green

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

0 0 0 0 0

9 4 3 6 7

Ochromonadales

0

0

0

0

0

0

0

11

38

Euglenales Euglenales Euglenales

0 0 0

0 0 0

0 0 0

0 0 0

0 0 0

0 0 0

0 0 0

14 1 1

38 43 9

0

0

0

0

0

0

10

59

297

nigroviridis and the usually predominant epipsammic centric diatom Actinoptychus undulatus (Ubom & Essien 2003) disappeared from the beach soil within the vicinity, up to’ 14 m away from the boom (Table 3). The pinnate diatoms, Cymbella lanceolata, Cymatopleura solea, Cocconeis pediculus, Navicula rhynocephala, N. radiosa and Rhoicosphenia curvata, although also seriously affected, exhibited variable levels of incidence at 12 m from the boom. Also detected at 12 m from the oil boom were a few cells of Astasia fustis and Euglena intermedia (both of the order Euglenales), and Chromulina globosa (Ochromonadales). The density of the epipsammic algae in contaminated beach soil ranged from 1 to 3 organisms/ha and 1 to 14 organisms/ha in sample collected at 12 and 14 m, respectively from the boom. This is incomparable to 3–38 organisms/ha recorded for the control sample obtained at 100 km from the boom. The reduction in the number epipsammic algae encountered in the polluted

12 m

14 m

100 km (control)

beach is an indication that the pollution level exceeded the normal homeostasis and compensation required for their survival. The direct effects of chemical contamination were observed to decrease with increase in distance of sampling points from the oil boom. The implication is that the density of the microalgae decreases with closeness to the boom. The existence of non-diatoms at distances where the highly, fortified and protective siliceous-walled diatoms were detected is an indication of the influence of factors other than distance from the boom, on the distribution of microalgae. This is attributable to the complex interplay of tidal currents and other intrinsic uninvestigated parameters which may affect microalgal growth in the epipsammic habitat. The number of microalgae recorded in the oil-polluted sandy beach is quite low compare to the number recorded by Yakubu et al. (1998) for the surface water

572


Table 4. Pollution level of the crude oil contaminated beach soil. Point of sampling

Distance from oil boom

Phytoplankton Zooplankton BIP (A) (B)

A B C D Control

5.5 m 9.5 m 11.5 m 15 m 100 km

3 12 34 63 94

1 5 6 10 6

75% 88% 45% 41.8% 18%

Table 5. Regeneration rate (%) of epipsammic microalgae in oil contaminated beach after 28 days of exposure. Sampling distance

Duration (days) 7

Om (at the boom) 2m 4m 6m 8m 10 m 12 m 14 m 100 km (control)

14 0

0

Regeneration Loss in micro rate (%) algae abudance (%) 21

28 0

8

2.6%

97.4%

21.4% 19.7% 24.1% 27.1% 28.72% 44.8% 64.5% 100%

77.4% 79.6% 80.3% 85.9% 72.9% 71.39 35.2 –

Conclusion A current limit of bioindicators or biomarkers concerns the relations between individual response; and ecological effect of a contaminant. This depends on whether or not the organism has been exposed to contamination levels exceeding their capacity to maintain community stability and integrity in a changing environment. In this investigation, cyanobacteria, specifically Aphanizomenon flos-aque, Lyngbya majusculatia, and a centric diatom Actinoptychus undulatus, were the most directly affected epipsammic microalgae by the crude oil pollution of the Qua Iboe Estuary. These microalgae species are recommended for use as indicators of short term effect of oil pollution in coastal sandy beaches of an estuarine environment. References

0 0 19 64 0 7 36 59 0 13 34 72 0 14 21 87 0 42 71 86 10 28 72 134 60 78 120 193 297 283 301 299

of the lower reaches of the Nun river in Delta state, and much lower that values recorded by Ubom & Essien (2003) and Essien & Ubom (2003), respectively, for the epipsammic and epipellic habitats of the Qua Iboe Estuary. The smaller number of epipsammic microalgae recorded for the polluted beach may be ascribed to the near terrestrial conditions of the sandy beach, complicated by crude oil-induced changes in the intrinsic growth parameters, particularly the acidity and salinity levels of the epipsammic habitat. The BIP of the beach soils (Table 4) from the control site indicate that the beach had been slighty polluted (18%), plausibly from previous incidents of contamination (Asuquo 1991; Antia 1993). However, due to the oil spill, the index of pollution at the time of sampling was raised to 75, 88, 45 and 41%, respectively in samples obtained at 5.5, 9.5, 11.6 and 15 m from the boom. This corresponded with the rates of microalgal regeneration over time. A slow microalgal regeneration rate was observed in soils close to the boom, while a much faster regeneration rate was established in soil sample beyond 12 m from the boom. This may be ascribed to reduction in the direct effect of the pollutant on the algae and the diluting influence of tidal currents. This notwithstanding, 97.4, 77.4, 79.6, 80.3, 65.9, 72.9, 71.3 and 55.2% loss in microalgae abundance were recorded for beach soil collected respectively at boom site (0 m) and from 2, 4, 6, 8, 10, 12 and 14 m sampling locations from the boom (Table 5).

Antia, E.E. 1993 A morphodynamic model of sandy beach susceptibility of tar pollution and self cleaning of the Nigerian coast. Journal of Coastal Resources 9, 1065–1071. AOAC 1975 Methods of Soil Analysis,12th edn. Washington, DC: Association of Official Analytical Chemist. APHA 1998 Standard Methods for the Examination of Water and Waste Water? 20th edn. American Public Health Association. ISBN 0-87553235-7. Asuquo, F.E. 1991 Tarballs in Ibeno-Okposo beach of South Eastern Nigeria. Marine Pollution Bulletin 22, 150–151. Black, C.A., Evans, D.D., White, J.L., Ensminger, L.B. & Clerk, F.E. 1965. Methods of Soil Analysis, 2. Chemical and Microbiological Properties, Madison: American Society of Agronomy. Carmichael, W.W. 1981 The Water Environment:Algal Toxins and Health. pp. 161–172. New York: Plenum Press. ISBN 0-306-40756-6. Collier, J.L. & Grossman, A.R. 1994 A small polypeptide triggers complete degradation of light harvesting phycobiliproteins in nutrient deprived cyanobacteria. EMBO Journal 13, 1039–1047. Essien, J.P. & Ubom, R.M. 2003 Epipellic algae profile of the mixohaline mangrove swamp of Qua Iboe River Esturay (Nigeria). The Environmentalist 23, 323–328. Essien, J.P. & Udosen, E.D. 2000 Distribution of actinomycetes in oil contaminated ultisol of the Niger Delta (Nigeria). Journal of Environmental Sciences 12, 296–302. Fitzgerald, M.P., Husain, A. & Rogers, L.J. 1978 A constitutive flavodoxin from a eukaryotic alga. Biochemical and Biophysiological Research Communication 81, 630–635. Galvao, H.M. 1997 Microbial Ecology of a Brackish Water System (Western Baltic). Universidale to Algarve, Gambelas, 8000, Faro, Portugal. Green, A.M., Osborn, P., Chai, J., Lin, C., Loeffler, A., Morgan, P. Rubec, S. Spanyers, A., Walton R.D., Slack, D., Gawlik, D., Harpole, J., Thomas, E., Schmidt, R., Zimmerman, D., Harper, D., Hinkley, T. & Walton, A. 1992 Status and trends of selected living resources in the Galveston Bay system. Galveston Bay National Estuary Program Publication GBNEP-19 Webster, Texas. Grossman. A.R., Schaetder, M.R., Cliang, G.G., Collier. J.L. 1993 The phycobilisome, a light-harvesting complex responsive to environmental conditions. Microbiological Reviews 57, 725–749. Han, M. 1978 Illustrations of Fresh Water Plankton, 85 pp. London: Academic press. ISBN 13144-211. Ijah, U.J.J. & Antai, S.P. 2003 The potential use of chicken-drop microorganisms for oil spill remediation. The Environmentalist 23, 89–95. Jakobsen, S.T. 1992 Chemical reaction and air change during the decomposition of organic matter Resources Conservation and Recycling 6, 529–399.

Oil spillage effects on beach microalgal Juo, A.S.R. 1979 Selected Methods for Soil and Plant Analysis Manual Series, 70 pp. Ibadan: International Institute of Tropical Agriculture (IITA). Moore, R.E. 1981a Toxins and marine blue-green algae. In The Water Environment: Algal Toxins and Health. ed. Carmichael, W.W. pp: 15–23 New York: Plenum Press. ISBN 0-306-40756-6. Moore, R.E. 1981b Constituents of blue green algae. In Marine Natural Products: Chemical & Biological Perspectives. ed. Scheuer, P.J., vol. 4., pp.1–52. London: Academic press. ISBN 0-12-624003-5. Page, A.L., Miller, R.H. & Keeney, D.R. 1982 Methods of Soil Analysis. Part 2: Chemical and Microbiological Properties, 2nd edn. p. 1159. ISBN 0-89118-072-9(Pt.2). Perez-llorens, J.L., Benitez, E.,Vergara, J.J. & Beryes, J.A. 2003 Characterization of proteolytic enzyme activities in macroalgae. European Journal of Phycology 38, 55–64. Rhykerd, R.L., Weaver, R.W. & Mclnnes, K.J. 1995 Influence of salinity on bioremediation of oil in soil. Environmental Pollution 90, 127–130. Thiel, T. 1990 Protein turn over and heterocyst differentiation in the cyanobacterium Anabaena variabilis. Journal of Phycology 26, 50–54.

573 Ubom, R.M & Essien, J.P. 2003 Distribution and significance of epipsammic algae in the coastal shore (Ibeno Beach) of Qua Iboe River Estuary, Nigeria. The Environmentalist 23, 109– 115. Ukpong, I.E. 1991 The performance and distribution of species along soil salinity gradients of mangrove swamps in Southeastern Nigeria. Vegetatio 95, 63–70. Ukpong, I.E. 1995 Vegetation and soil acidity of a mangrove swamp in Southeastern Nigeria. Soil Use and Management 11, 141–144. WHO 1971. International Standards for Drinking water. Geneva: World Health Organisation. Woodhead, N. & Tweed, R. 1960 A Second checklist of tropical West African algae (fresh and brackish water) Hydrobiologia 15, 225–286. Yakubu, A. F., Sikori, F.D. & Horesfall, M Jr. 1998 An Investigation into the physicochemical conditions and planktonic organisms of the lower reaches of the Nun River, Nigeria. Journal of Applied Science and Environmental Management 1, 38– 42.

Springer 2005


Production of alkali-tolerant cellulase-free xylanase by Pseudomonas sp. WLUN024 with wheat bran as the main substrate Zheng-Hong Xu1,2, Yun-Ling Bai1, Xia Xu1, Jing-Song Shi1 and Wen-Yi Tao1,2,* 1 School of Biotechnology, Southern Yangtze University, 170 Huihe Road, Wuxi 214036, P. R. China 2 The Key Laboratory of Industrial Biotechnology, Ministry of Education, Southern Yangtze University, 170 Huihe Road, Wuxi, 214036, P.R. China *Author for correspondence: Tel.: +86-510-5862412, Fax: +86-510-5806493, E-mail: [email protected] Keywords: Alkali-tolerant cellulase-free xylanase, fermentation conditions, Pseudomonas sp., wheat bran, xylo-oligosaccharides Summary An alkali-tolerant cellulase-free xylanase producer, WLI-11, was screened from soil samples collected from a pulp and paper mill in China. It was subsequently identified as a Pseudomonas sp. A mutant, WLUN024, was selected by consecutive mutagenesis by u.v. irradiation and NTG treatment using Pseudomonas sp. WLI-11 as parent strain. Pseudomonas sp. WLUN024 produced xylanase when grown on xylosidic materials, such as hemicellulose, xylan, xylose, and wheat bran. Effects of various nutritional factors on xylanase production by Pseudomonas sp. WLUN024 with wheat bran as the main substrate were investigated. A batch culture of Pseudomonas sp. WLUN024 was conducted under suitable fermentation conditions, where the maximum activity of xylanase reached 1245 U ml)1 after incubating at 37 C for 24 h. Xylanase produced by Pseudomonas sp. WLUN024 was purified and the molecular weight was estimated as 25.4 kDa. Primary studies on the characteristics of the purified xylanase revealed that this xylanase was alkali-tolerant (optimum pH 7.2–8.0) and cellulase-free. In addition, the xylanase was also capable of producing high quality xylo-oligosaccharides, which indicated its application potential in not only pulp bio-bleaching processes but also in the nutraceutical industry.

Introduction Hemicellulolytic microorganisms play important roles in nature by recycling hemicellulose, one of the key components of plant polysaccharides and the second most abundant renewable resource in the world. The major group of hemicellulose is xylan, which has a linear backbone of b-1,4-linked xylopyranose residues (Whistler & Richards 1970). Xylan can be hydrolysed to xylo-oligosaccharides and xylose residues by xylanase (b-1,4-D -xylan xylanohydrolase, EC 3.2.1.8) produced by hemicellulolytic microbes. Pre-treatment of Kraft pulp by xylanase prior to bleaching effectively minimizes the use of the conventional bleaching agent, chlorine (Kulkarni et al. 1999). Xylanase has been, since then, attracting worldwide research interests over the past two decades due to its great potential in industrial applications, especially in the pulp and paper industries. Many microorganisms which produce xylanase simultaneously produce cellulase. The presence of minor activity of cellulase in xylanase preparations could damage the cellulose fibre of pulp during bio-bleaching, making the pulp less suitable for paper industries. In

addition, the bleaching process is usually carried out under alkaline conditions. Therefore, it is desirable to screen for microorganisms capable of producing alkaline or alkali-tolerant cellulase-free xylanase. The importance of such xylanases has been well documented (Subramaniyan & Prema 2000; Techapun et al. 2003). To date, the alkaline or alkali-tolerant and cellulase-free xylanase producers have mainly been found in the genera Aspergillus, Penicillium, Streptomyces, Thermoactinomyces, Clostridium, and Bacillus (Subramaniyan & Prema 2000; Duarte et al. 2003; Techapun et al. 2003). Here we report an alkali-tolerant cellulase-free xylanase producer, Pseudomonas sp., which was newly isolated from the effluent of a pulp and paper mill in China. To our knowledge, this is the first report describing the production of alkali-tolerant cellulase-free xylanase by Pseudomonas sp. In addition, this xylanase was found to be able to degrade xylan into xylo-oligosaccharides effectively, 80% of which were xylobiose and xylotriose. As xylan can be prepared cost-effectively from agricultural by-products (i.e. wheat bran, bagasse, corn core) only by alkali hydrolysis, this xylanase also displays a potential to be used in the production of nutraceuticals, for example, oligosaccharides.

576 Materials and methods

Z.-H. Xu et al. Determination of fermentation conditions for producing xylanase by mutant WLUN024

Microorganisms and culture conditions Pseudomonas sp. WLI-11 and its mutant WLUN024 were screened and stored in our laboratory. The enrichment medium contained: hemicellulose (10 g l)1), peptone (5 g l)1), NaCl (5 g l)1). Screening medium contained: hemicellulose (10 g l)1), KNO3 (1 g l)1), MgSO4 (0.5 g l)1), NaCl (5 g l)1), K2HPO4 (0.5 g l)1). Pre-culture medium contained: glucose (10 g l)1), peptone (5 g l)1), NaCl (5 g l)1). The basic culture medium contained: wheat bran (40 g l)1), peptone (5 g l)1), K2HPO4 (5 g l)1). The initial pH of all media was adjusted to 8.5 before autoclave. Hemicellulose was prepared from bagasse as described previously (Breccia et al. 1995). Screening for bacterial strains capable of producing alkali-tolerant xylanase The soil samples were collected from the effluent of a pulp and paper mill in China. One gram of each sample was put in a 250 ml Erlenmeyer flask containing 30 ml enrichment medium and mixed well. The cultures were incubated on a rotary shaker at 220 rev min)1 for 2–3 days. A portion (0.5 ml) of the enriched culture was spread onto a screening medium agar plate, and incubated at 220 rev min)1 for 48 h. Those bacteria that formed clear halos around their colonies were picked up and stored on pre-culture medium agar slants. The culture from a slant was inoculated into a 250 ml Erlenmeyer flask containing 30 ml screening medium, incubated at 220 rev min)1 for 48 h. The supernatant of the culture broth was used to measure xylanase activity, after which the best xylanase producing bacterium was selected. All cultivations were conducted at 37 C. 16S rDNA sequence amplification and sequencing Genomic DNA of strain WLI-11 was isolated according to the standard method (Sambrook et al. 1989). Polymerase chain reaction (PCR) was performed in a total volume of 50 ll. The final reaction mixture contained 5 ll 10 · reaction buffer, 5 ll 20 mM MgCl2, 5 ll 2 mM each of dNTP, 5 ll 2 lM of each primer, 0.5 ll Taq polymerase (Takara, 5 U/ll), 50 ng of genomic DNA and sterile distilled water. Primers used were forward (1F; 5¢-AGAGTTTGATCCTGGCTCAG-3¢) and reverse (2R; 5¢-GGTTACCTTGTTACGACTT-3¢). These are primers known to amplify 16S rDNA from a broad range of taxonomically different bacterial strains (Suzuki & Giovannoni 1996). PCR was carried out under the following conditions: (1) 94 C, 2 min; (2) 94 C, 1 min; 55 C, 1 min; 72 C, 3 min; 28 cycles; (3) 72 C, 10 min. The PCR product was purified and sequenced by the Shanghai Centre of Biotechnology, China Academy of Science (Shanghai, China).

Pseudomonas sp. WLUN024 was derived from strain WLI-11 by mutagenesis using u.v. irradiation and NTG treatment (Zhuge & Wang 1994). The determination of fermentation conditions for producing xylanase was performed based on the basic culture medium. To investigate the effect of individual nutritional factors such as carbon source, the corresponding compound was replaced by a different one. Unless indicated, batch fermentations were carried out in 250 ml Erlenmeyer flasks containing 30 ml culture media, incubated on a rotary shaker at 220 rev min)1 at 37 C for 24 h. Determination of cell growth Since wheat bran was used as the main substrate, the viable cell count method was used to measure the growth of bacteria. Samples were aseptically withdrawn from the fermentation broth, spread on pre-culture medium plates (20 g l)1 agar) at different dilutions. Colony count results were expressed as means for three plates incubated at 37 C for 24 h. Assay of xylanase activity Fermented broth was centrifuged at 4000 · g, at 4 C for 10 min and the supernatant was used for analysis or preparation of crude enzyme (shown below). Xylanase activities were determined by measuring the reducing sugars liberated from 10 g oat spelt xylan (Sigma) l)1 suspended in 40 mM sodium barbitone buffer (pH 7.6) (Bailey et al. 1992). One unit (U) was defined as the quantity of enzyme required to liberate 1 lmol of xylose equivalent per minute at 50 C. The results were means of duplicate determination on triple independent measurements. Carboxymethylcellulase (CMCase) and FPase assays CMCase and FPase of the supernatant were assayed under the same conditions described above using carboxymethylcellulose (CMC) and filter paper as substrates, respectively. Purification of xylanase Solid (NH4)2SO4 was gradually added to the culture supernatant up to 60% saturation followed by a mild stir at 4 C for 1 h. The solution was centrifuged at 10,000 · g for 30 min and the supernatant was discarded. The precipitate was re-dissolved in distilled water and dialysed against 40 mM sodium barbitone buffer (pH 7.6), after which a crude enzyme solution was obtained. Crude enzyme was purified consecutively by chromatography on CM-Sephadex, SephadexG-100 and SephadexG-75 to get a pure band on SDS-PAGE.

577

Alkali-tolerant cellulase-free xylanase Effect of pH on xylanase activity and stability The purified xylanase was dissolved in different buffers (pH ranging from 3.3 to 12) to achieve an initial activity of 1000 U ml)1 and stored at 4 C for 24 h, after which the residual activity was measured to assess the pH stability. The buffers used were citric acid–NaOH–HCl (pH 3.3, 4.3, and 5.3), sodium barbitone–HCl (pH 6.8, 7.2, 7.6, 8.0, 8.8, and 9.6) and glycine–NaOH (pH 10.4 and 12). To investigate the effect of different pH on xylanase activity, the protocol for measuring xylanase activity was followed except that sodium barbitone buffer (pH 7.6) was replaced by other buffers with different pH. Effect of temperature on xylanase activity and stability Purified xylanase was dissolved in 40 mM sodium barbitone buffer (pH 7.6) to achieve an initial activity of 1000 U ml)1. It was divided into four aliquots and treated individually at 28, 37, 50 and 55 C. Samples were removed periodically and the residual xylanase activity was measured as described in the standard assay to assess thermal-stability. To check the effect of temperature on xylanase activity, the same procedure described in studying the effect of pH was applied, except that different temperature was tested instead of different pH. Procedure for preparing oligosaccharides Crude xylanase produced by Pseudomonas sp. was added to a 40 mM sodium barbitone buffer (pH 7.6) containing 50 g xylan l)1 (Oat spelt, Sigma) with a ratio of 800 U xylanase per gram of xylan. The mixture was incubated at 45 C for 12 h with mild agitation. It was then boiled for 10 min to inactivate the xylanase. After centrifuging at 10,000 · g for 10 min, the supernatant was subjected to HPLC to analyse the concentrations of xylobiose and xylotriose. Xylo-oligosaccharides were determined by using a Waters 600 HPLC equipped with a Waters 2410 differential refractive index detector. A Hypersil NH2 column (5 lm) was used, with 75% (v/v) acetonitrile in water as the mobile phase. The column temperature was kept at 30 C and the injection volume was 10 ll. The flow rate was maintained at 1 ml min)1.

24 h incubation, was selected and designated as WLI11. The 1F and 2R primers were used to amplify a partial 16S rDNA sequence from strain WLI-11. Comparative analyses of the sequence obtained and those available from GenBank showed strain WLI-11 to be most closely related to the genus Pseudomonas. Together with its morphological properties and taxonomic characteristics, strain WLI-11 was identified as Pseudomonas sp. Mutagenesis of Pseudomonas sp. WLI-11 Strain WLI-11 was treated by u.v. irradiation for 60 s with a lethal rate of 80%. After u.v. mutagenesis, a mutant WLUV-15 that produced 250 U ml)1 of xylanase in basic culture medium was obtained. Strain WLUV-15 was further mutated by NTG treatment, after which an excellent xylanase-producing mutant WLUN024 was selected. This strain produced 354 U ml)1 xylanase, it was therefore chosen as a working strain in following studies. Effect of carbon sources on xylanase production by strain WLUN024 The effect of different carbon sources on xylanase production was shown in Table 1. Strain WLUN024 grew well on all carbon sources except cellobiose (data not shown), but the production of xylanase were rather poor when glucose, sucrose, starch and cellobiose were used as a sole carbon source, respectively. High levels of xylanase production were observed when xylosidic materials, such as xylan, hemicellulose and wheat bran, were used as carbon sources, suggesting that the production of xylanase could be induced by xylosidic material. Since wheat bran is an abundant and very cheap agricultural residue, it was chosen as a sole carbon source for further study. To determine a suitable concentration of wheat bran, the effect of various concentrations on xylanase production was investigated. Figure 1 shows that the yield of xylanase increases enormously along with the increase of wheat bran concentrations. The highest xylanase

Table 1. Effect of various carbon sources on xylanase production by Pseudomonas sp. WLUN024.a

Results

Carbon sources

Enzyme activity (U ml)1)

Screening, isolation and identification of bacteria

Hemicellulose Xylan (Sigma) Xylose Wheat bran Starch Cellobiose Sucrose Glucose

118.7 190.2 32.2 31.2 1.2 0.5 1.4 2.0

Fifteen soil samples collected from the effluent of a pulp and paper mill were enriched and screened. About 600 bacterial strains, which formed clear halos around their colonies on the screening plates, were picked up. These bacteria were grown on basic culture medium, and rescreened by measuring xylanase activity. A bacterium strain, which produced 170 U ml)1 of xylanase upon

a b

± ± ± ± ± ± ± ±

5.8 4.3 1.2 1.0 0.3 0.3 0.4 0.3

b

The concentration of each carbon source is 10 g l)1. Mean value ± standard deviation.

578

Z.-H. Xu et al. decrease of xylanase production in the presence of excessive amount of (NH4)2SO4. From the economical point of view, 8 g l)1 of (NH4)2SO4 was chosen as the optimal concentration of nitrogen source.

-1

Xylanase activity (U ml )

500 400 300

Effect of phosphorus concentration on xylanase production by strain WLUN024

200 100 0

0

20

40

60

80

100

-1

Wheat bran concentration (g l )

Figure 1. Effect of wheat bran concentration on xylanase production by Pseudomonas sp. WLUN024.

activity, 450 U ml)1, was achieved at a wheat bran concentration of 70 g l)1, which was approximately 15 times higher than that of using 10 g wheat bran l)1. Effect of nitrogen sources on xylanase production by strain WLUN024

600

11

500

10

400

9

300 8

200 100

7

0

6 60

0

10

20

30

40

50

Final pH

-1

Xylanase activity (U ml )

The effect of various nitrogen sources on xylanase production was studied in the same way as described above. The production of xylanase by strain WLUN024 grown on inorganic nitrogen compounds was better than that on organic nitrogen substances (data not shown), indicating this strain had strong capability of assimilating inorganic nitrogen. Among the inorganic nitrogen sources tested, (NH4)2SO4 was the best candidate. Furthermore, the effect of various concentrations of (NH4)2SO4 on xylanase production was investigated (Figure 2). When the concentration of (NH4)2SO4 was increased from zero to 8 g l)1, the yield of xylanase increased by 20%. When the concentration of (NH4)2SO4 was further increased from 8 to 30 g l)1, the yield of xylanase kept at a relatively stable level. The yield of xylanase decreased, however, when the concentration of (NH4)2SO4 exceeded 30 g l)1. The final pH of the fermentation broth decreased continuously when increasing the concentration of (NH4)2SO4, which could partly explain the

The effect of various concentrations of K2HPO4 on xylanase production was studied. Since no significant effect was observed on xylanase production by strain WLUN024, 4 g K2HPO4 l)1 was chosen for further experiments. Effects of some other factors on xylanase production by strain WLUN024 Metal ions were generally considered as important factors affecting microbial enzyme production. Each metal ion (5 mM) was added to the basic culture medium prepared by distilled water, after which the effect of metal ions on xylanase production by strain WLUN024 was investigated. It was found that several metal ions, such as Ca2+, Mg2+ and Ba2+, had no effect or a little promotion effect on xylanase production, while the others (i.e. Zn2+, Co2+, Cu2+, Fe3+) inhibited xylanase production significantly. The effects of inoculum size and medium volume in flask were also investigated. The results showed that the optimal inoculum size and the optimal medium volume were 5–10% (v/v) and 20 ml medium in 250 ml flask, respectively. Batch production of xylanase by strain WLUN024 under optimal conditions An optimized medium for xylanase production, consisted of 70 g wheat bran, 8 g (NH4)2SO4 and 4 g K2HPO4 l)1, was developed based on the above investigations. A batch fermentation process was carried out with the optimized production conditions, where the highest yield of xylanase reached 1245 U ml)1 at 24 h of cultivation (Figure 3). Crude xylanase was extracted from the culture supernatant. Neither CMCase nor FPase activity was detected in the crude xylanase produced by strain WLUN024. Furthermore, the crude xylanase was purified consecutively by chromatography on CM-Sephadex, SephadexG-100 and SephadexG-75. The molecular weight of this xylanase was estimated as 25.4 kDa (data not shown). Effects of pH and temperature on the activity and stability of xylanase produced by strain WLUN024

-1

(NH4)2SO4 concentration (g l )

Figure 2. Effect of (NH4)2SO4 concentration on xylanase production by Pseudomonas sp. WLUN024. Relative xylanase activity (n), final pH (m).

The xylanase produced by strain WLUN024 was stable in the pH range of 5.3–10.4 when storing at 4 C for 24 h (Figure 4), while the optimum activity was observed in the pH range of pH 7.2–8.0 (Figure 5),

579

Alkali-tolerant cellulase-free xylanase 1.0E+10

1200 1.0E+09

1000 800

1.0E+08 600 400

1.0E+07

200 0

Colony forming per unit (ml-1)

Xylanase activity (U ml-1) Reducing sugar concentration (mg l -1)

1400

1.0E+06 0

5

10

15

20

25

30

35

40

Time (h)

120

120

100

100

Relative xylanase activity (%)


Figure 3. Time-course of xylanase production (s), reducing sugar concentrations (n) and viable cells (lgN, m) of Pseudomonas sp. WLUN024 in flask culture. The inoculum size, the medium content and the initial pH were 5%, 20 ml medium in 250 ml flask and 8.5 (adjusted by NaOH solution), respectively.

80 60 40 20

80 60 40 20

0 0

6

4

2

8

10

12

0 20

pH

Figure 4. Effect of pH on xylanase stability. Xylanase activity assay was conducted at 50 C.

30

40

50 T (˚C)

60

70

80

Figure 6. Effect of temperature on xylanase activity. Xylanase activity assay was conducted at pH 7.6. 120

100 80 60 40 20 0 3

4

5

6

7

8

9

10

11

12

pH

Residual relative xylanase activity (%)


120

100 80 60 40 20 0

Figure 5. Effect of pH on xylanase activity. Xylanase activity assay was conducted at 50 C.

conceiving that this xylanase can be used to treat alkaline pulp. In addition, the maximum activity of xylanase from strain WLUN024 was observed at 50 C (Figure 6). Thermal-stability studies of this xylanase showed that the temperature of higher than 50 C inactivated the enzyme quickly: the residual activity of xylanase incubated at 50 C for 40 min was only 40% of that at 28 C (Figure 7).

0

20

40

60

80

100

120

Time (min)

Figure 7. Effect of temperature on xylanase stability. Xylanase activity assay was conducted at pH 7.6. Symbols represent temperature: 28 C (m), 37 C (n), 50 C (d), and 55 C (s).

Preparation of xylo-oligosaccharides by crude xylanase produced by strain WLUN024 The alkali-tolerant cellulase-free xylanase produced by Pseudomonas sp. WLUN024 can also be used to prepare high quality xylo-oligosaccharides from

580 xylan, since 80% of the hydrolysates were xylobiose and xylotriose, while the content of xylose was less that 5%.

Discussion In the present study, an alkali-tolerant cellulase-free xylanase producer Pseudomonas sp. WLUN024 was screened. Under a suitable fermentation conditions, a high level production of xylanase, 1245 U ml)1, was achieved at 24 h of cultivation with wheat bran and (NH4)2SO4 as the sole carbon and nitrogen source, respectively (Figure 3). Preliminary studies on the purified enzyme showed that this xylanase was alkali-tolerant and exhibited neither CMCase nor FPase activities. All above results demonstrated that Pseudomonas sp. WLUN024 was an alkali-tolerate cellulase-free xylanase producer compared to the other xylanase-producing strains described previously (Subramaniyan & Prema 2000; Beg et al. 2001). Xylan was found to be the best substrate for xylanase production by Pseudomonas sp. WLUN024 (Table 1), which might be ascribed to xylan having a strong inducing effect for xylanase production, as reported in many microorganisms (Sunna & Antranikian 1997). However, it is not practical to use pure xylan as a substrate for xylanase production on an industrial scale due to its high cost. Interestingly, similar levels of xylanase activity were obtained on xylose and wheat bran. Xylose has been found to be an important inducer for xylanase production by Bacillus sp. BP-7 (Lopez et al. 1998), but the use of wheat bran as a substrate for xylanase production by Pseudomonas sp. has never been reported. Wheat bran contains many nutritional compounds, which not only provide carbon source and trace nutrition factors for cell growth, but also serve as an inducer for xylanase production due to its high xylan content (up to 30%). Wheat bran might also have some unknown factors that enhanced the production of xylanase by strain WLUN024. More importantly, wheat bran is an abundant and very cheap agricultural residue, which makes the development of a cost-effective medium for commercial production of xylanase possible. The production of xylanase by Pseudomonas sp. WLUN024 was a partially growth-associated characteristic (Figure 3), suggesting that the xylanase from Pseudomonas sp. WLUN024 was produced in an inducible manner. Xylanase activity was very low at the beginning of fermentation (0–10 h), which might be due to that the xylan in wheat bran cannot be transported into the bacterial cell to induce the production of xylanase. During this phase, however, the strain might be able to produce, constitutively, a minor amount of xylanase to hydrolyse xylan into xylo-oligosaccharides and xylose. These oligosaccharides would then be subsequently taken up by the bacteria to enhance cell growth and to induce xylanase production. Along with the production of xylanase, the amount of the

Z.-H. Xu et al. hydrolysed xylan increased continuously to provide nutrition for cell growth and inducers for xylanase production. This cycle would not stop until the formation and the consumption of the hydrolysates catalysed by xylanase reached an equilibration. This hypothetical mechanism could be partly supported by the evidence that the concentration of the reducing sugar increased at the beginning of fermentation, but then decreased and remained at a constant level afterwards (Figure 3). Similar regulation mechanisms for xylanase production have been reported previously (Bastawde 1992 Kulkarni et al. 1999). More importantly, the xylanase from Pseudomonas sp. WLUN024 has a unique property of hydrolysing xylan mainly into xylo-oligosaccharides. Xylo-oligosaccharides, especially xylobiose and xylotriose, have been found to have a stimulatory and regulatory effect on the selective growth of human intestinal Bifidobacteria to maintain a healthy microflora (Okazaki et al. 1990; Degnan & Macfarlane 1991; Va´zquez et al. 2000). Although currently genetic engineering can be easily used to increase xylanase activity, the traditional mutagenesis approach, which could increase the xylanase activity, is still powerful. This is because naturally isolated or mutagenesis-derived xylanase producers would be more favourable for nutraceutical production due to considerations of bio-safety. In conclusion, the discovery of Pseudomonas sp. WLUN024 capable of producing xylanase expands the biodiversity of xylanase producers. Furthermore, the alkali-tolerant cellulase-free characteristics and the capability of preparing high quality xylo-oligosaccharides indicate great potential of this xylanase in both the pulp bio-bleaching process and in the nutraceutical industry. Acknowledgements This work was supported by a Grant from the State High Technology R&D Project (863) of China (No. 2001AA214101), and a Grant from the National 10th Five Year Plan Special Research Programs of China (No. 2001BA708B04-02).

References Bailey, M., Biely, P. & Poutanen, K. 1992 Interlaboratory testing of methods for assay of xylanase activity. Journal of Biotechnology 23, 257–270. Bastawde, K. 1992 Xylan structure, microbial xylanases, and their mode of action. World Journal of Microbiology and Biotechnology 8, 353–368. Beg, Q., Kapoor, M., Mahajan, L. & Hoondal, G. 2001 Microbial xylanases and their industrial applications: a review. Applied Microbiology and Biotechnology 56, 326–338. Breccia, J., Castro, G., Baigori, M. & Sineriz, F. 1995 Screening of xylanolytic bacteria using a colour plate method. Journal of Applied Bacteriology 78, 469–472. Degnan, B. & Macfarlane, G. 1991 Comparison of carbohydrate substrate preferences in eight species of Bifidobacteria. FEMS Microbiology Letters 68, 151–156.

Alkali-tolerant cellulase-free xylanase Duarte, M.C.T., da Silva, E.C., Gomes, I.M.D., Ponezi, A.N., Portugal, E.P., Vicente, J.R. & Davanzo, E. 2003 Xylan-hydrolysing enzyme system from Bacillus pumilus sp. CBMAI 0008 and its effects on Eucalyptus grandis kraft pulp for pulp bleaching improvement. Bioresource Technology 88, 9–15. Kulkarni, N., Shendye, A. & Rao, M. 1999 Molecular and biotechnology aspects of xylanases. FEMS Microbiology Reviews 23, 411– 456. Lopez, C., Balanco, A. & Pastor, F. 1998 Xylanase production by a new alkali-tolerant isolate of Bacillus. Biotechnology Letters 20, 243–246. Okazaki, M., Fujikawa, S. & Matsumoto, N. 1990 Effect of xylooligosaccharides on growth of Bifidobacterium. Journal of Japanese Society of Nutrition and Food Science 43, 395–401. Sambrook, J., Fritsch, E.F. & Maniatis, T. 1989 Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. ISBN 0-87969-309-6. Subramaniyan, S. & Prema, P. 2000 Cellulase-free xylanases from Bacillus and other microorganisms. FEMS Microbiology Letters 183, 1–7.

581 Sunna, A. & Antranikian, G. 1997 Xylanolytic enzymes from fungi and bacteria. CRC Critical Reviews in Biotechnology 17, 39–67. Suzuki, M.T. & Giovannoni, S.J. 1996 Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR. Applied and Environmental Microbiology 62, 625–630. Techapun, C., Poosaran, N., Watanabe, M. & Sasaki, K. 2003 Thermostable and alkaline-tolerant microbial cellulase free xylanases produced from agricultural wastes and the properties required for use in pulp bleaching bioprocess: a review. Process Biochemistry 38, 1327–1340. Va´zquez, M.J., Alonso, J.L., Domı´ nguez, H. & Parajo´, J.C. 2000 Xylooligosaccharides: manufacture and applications. Trends in Food Science Technology 11, 387–393. Whistler, R. & Richards, E. 1970 Hemicelluloses. In The Carbohydrates, ed. Pigman, W. & Horton, D. pp. 447–769 New York: Academic Press. ISBN 0125563027. Zhuge, J. & Wang, Z. 1994 Experimental Methods of Industrial Microbiology (in Chinese). pp. 335–393. Beijing: China Light Industry Press. ISBN 7-5019-1584-9/TSÆ1034.

Ó Springer 2005


Studies on antagonistic marine actinomycetes from the Bay of Bengal Sujatha Peela*, VVSN Bapiraju Kurada and Ramana Terli Department of Biotechnology, College of Science and Technology, Andhra University, Visakhapatnam 530003, India *Author for correspondence: Tel.: +91-891-2734821, Fax: +91-891-2734821, E-mail:[email protected] Keywords: Actinomycetes, antimicrobial activity, multi-drug resistant pathogens, pigmentation production, sporophore morphology, Streptomyces

Summary Screening of 26 marine sediment samples near 9 islands of the Andaman Coast of the Bay of Bengal resulted in the isolation of 88 isolates of actinomycetes. On the basis of sporophore morphology and structure of the spore chain, 64 isolates were assigned to the genus Streptomyces, 8 isolates to the genus Micromonospora, 5 to the genus Nocardia, 7 to the genus Streptoverticilium and 4 to the genus Saccharopolyspora. Among 64 Streptomyces spp., 44 isolates showed antibacterial activity and 17 isolates showed antifungal activity. Three isolates showed very promising antagonistic activities against multi-drug resistant pathogens.

Introduction The screening of microbial natural products continues to represent an important route to the discovery of novel chemicals, for development of new therapeutic agents and for evaluation of the potential of lesser-known and/or new bacterial taxa (Kurtboke & Wildman 1998). It has been estimated that approximately two-third of the thousands of naturally occurring antibiotics have been isolated from actinomycetes (Takizawa et al. 1993). Indeed, the Streptomyces species produce about 75% of commercially and medically useful antibiotics (Miyadoh 1993). In the present investigation an effort was made to screen different marine sediments of the Andaman coast of the Bay of Bengal, India, which is large, diverse and largely unscreened ecosystem, for the isolation of potent antibiotic-producing actinomycetes. Materials and methods

1996) using starch casein agar medium (g/l: starch 10, casein 0.3, KNO3 2, NaCl 2, K2HPO4 2, MgSO47H2O 0.05, CaCO3 0.02, FeSO47H2O 0.01 and agar 18). The starch–casein agar medium containing 50% seawater was supplemented with rifampicin 2.5 lg/ml and fluconazole 75 lg/ml to inhibit bacterial and fungal contamination respectively. Characterization of isolates from the Andaman Islands Purified isolates of actinomycetes were identified up to the genera level by comparing the morphology of sporebearing hyphae with the entire spore chain and structure of the spore chain with the actinomycetes morphologies as described by Bergey (1989). This was done by using cover-slip method in which individual cultures were transferred to the base of coverslips buried in starch–casein agar medium. Colours of spores were visually estimated by using a colour chart.

Sampling procedure

Characterization of Streptomyces isolates

In the course of screening for bioactive actinomycetes, altogether 26 marine sediment samples were collected from a depth of 10–40 m in Bay of Bengal near 9 different islands of Andaman coast using a core sampler.

Streptomyces colonies were characterized morphologically and physiologically following the methods given in the International Streptomyces project (ISP) (Shirling & Gottlieb 1966). The micro-morphology of strains was observed by light microscopy after incubation at 28 °C for 2 weeks. The pigmentation of aerial mycelium and structure of sporophores which are highly characteristic and useful in the classification of streptomycetes were observed by cultivating the strains on different ISP media (ISP-2, ISP-3, ISP-4 and ISP-5).

Isolation of actinomycetes colonies from the marine sediments Isolation and enumeration of actinomycetes were performed by the soil dilution plate technique (Ellaiah et al.

584

S. Peela et al.

Screening of antibiotic-producing strains Preliminary screening for antibiotic production was done by the conventional cross-streak method. Subsequent screening of promising isolates was done under submerged fermentation conditions. Mature slant cultures of actinomycete strains were inoculated into 250 ml Erlenmeyer flasks, each containing 50 ml of the production medium having the composition (g/l): glucose 10, soyabean meal 10, NaCl 10 and CaCO3 1. The cultures were incubated on a rotary shaker (220 rev/min) at 27 °C for 4 days and the clear supernatant broth samples were tested for their antimicrobial activities. Antimicrobial activity was determined by the agar-diffusion method (Barry & Thornsberry 1985), employing nutrient agar for bacteria and yeast extract-malt extract agar for fungi and yeasts and expressed as diameter (mm) of the inhibition zone. The antimicrobial activity was observed after 24 h incubation at 37 °C for bacteria and 48 h incubation at 28 °C for fungi and yeast. Multi-drug resistant pathogens like Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans were also used as test organisms. Staphylococcus aureus strain resistant to antibiotics like methicillin, oxacillin, tetracycline and penicillin was procured from the American Type Culture Collection (ATCC 33591). Pseudomonas aeruginosa strain resistant to antibiotics like streptomycin, minocycline, gentamycin and ciprofloxacin was recovered from a clinical sample taken from the intensive care burn unit of King George Government Hospital, Visakhapatnam, India and a Candida albicans strain resistant to antibiotics like fluconazole, nystatin and amphotericin B was recovered from a clinical sample collected from medical ward of King George Government Hospital, Visakhapatnam, India. The antibiotic resistance of multi-drug resistant pathogenic strains was determined by the agar-diffusion method employing 50 ll (1 mg/ml concentration) of respective antibiotics.

Results and discussion In the course of screening for novel antibiotics, 88 actinomycete strains were isolated from marine

sediments, collected near nine islands of the Andaman coast of the Bay of Bengal. The occurrence and distribution of different actinomycete genera in different marine sediment samples is shown in Table 1. Out of 88 actinomycetes, 64 isolates were identified as belonging to the genus Streptomyces, family Streptomycetaceae (spore chain with coiling and branching); 8 as Micromonospora, family Micromonosporaceae (clusters of spore chain, single conidia on substrate mycelia); 5 as Nocardia (morphology ranging from fugacious substrate mycelium only to Streptomyces-like); 4 as Saccharopolyspora (very long chains of conidia on the aerial mycelium) and 7 as Streptoverticilium (whorls of straight chain of conidia formed). In a similar study, Takizawa et al. (1993) demonstrated a diverse actinomycete community in the Chesapeake Bay. Actinomycetes in marine sediments have not been extensively investigated, although their ubiquitous presence in the marine sediments has been well documented (Jensen et al. 1991; Takizawa et al. 1993; Moran et al. 1995). The cultural characteristics (Pigment production), morphological characteristics and antimicrobial activities of the different Streptomyces isolates are presented in Table 2. Out of 64 Streptomyces isolates, 29 produced melanin, 18 showed distinctive reverse side pigment and 11 produced soluble pigments. With reference to the morphology of spore-bearing hyphae, most isolates (47%) show spiral sporophores followed by straight sporophores (28%), flexous (17%) and retinaculum apertum (8%). Forty four percent of the isolates showed antibacterial activity and 17% isolates showed antifungal activity. The antimicrobial activity of the three most promising isolates against multi-drug resistant pathogens is presented in Table 3. As indicated in the table, Streptomyces sp. BT 606 showed antimicrobial activity against all the three multi-drug resistant pathogens, S. aureus, P. aeruginosa and C. albicans while Streptomyces sp. BT 624 showed inhibitory activity against C. albicans and Streptomyces sp. BT 652 against S. aureus and P. aeruginosa. In a similar investigation, Thorne & Alder (2002) reported the in vitro antibacterial activity of Daptomycin, a natural product derived from the fermentation of S. roseosporus against methicillin-resistant Staphylococcus aureus, meth-

Table 1. Occurrence and distribution of actinomycetes in different marine sediment samples. Location

No. of actinomyctes isolated

No. of Streptomycetes isolated

No. of rare actinomycetes isolated Micromonospora

Nocardia

Saccharopolyspora

Streptoverticilium

Ross island Viper island Cinque island I Cinque island II Red skin island Jolly buoy island Barren’s island Haveloc island Portblair island

22 8 11 4 11 7 8 7 10

16 5 8 2 9 4 6 5 9

3 1 1 0 1 0 1 0 1

1 0 1 1 0 1 0 1 0

0 1 0 0 1 1 1 0 0

2 1 1 1 0 1 0 1 0

Total

88

64

8

5

4

7

585

Studies on antagonistic actinomycetes Table 2. Sporophore morphology, pigment production and antimicrobial activity of Streptomyces isolates. Character

No. of isolates (%)

Sporophore morphology Straight Spiral Flexous Retinaculum apertum Total (%) Pigment production Melanin Reverse colour Soluble colour Isolates showing pigmentation Total isolates (%) Antibacterial activity Isolates Active isolates Staphylococcus aureus (ATCC 12600) Bacillus subtilis (ATCC 6633) Escherichia coli (ATCC 26) Pseudomonas aeruginosa (ATCC 27853) Antifungal activity Isolates Active isolates Aspergillus niger (ATCC 9642) Candida albicans (ATCC 10231) Saccharomyces cerevisiae (ATCC 10275)

18 30 11 5 64

(28) (47) (17) (8) (100)

Acknowledgement Financial assistance from University Grants Commission, New Delhi to P. Sujatha (JRF) is gratefully acknowledged.

29 (45) 18 (28) 11 (17) 58 (91) 64(100) 64 28 10 15 9 5

(100) (44) (16) (23) (14) (8)

64 11 5 4 2

(100) (17) (8) (6) (3)

References

(): Percentage of isolates.

Table 3. Antimicrobial activity of selected Streptomyces isolates against multi-drug resistant pathogens. Streptomyces isolates

Streptomyces sp. BT-606 Streptomyces sp. BT-624 Streptomyces sp. BT-652

It is anticipated that the current effort for the isolation, characterization and the study on marine actinomycetes of Andaman coast of Bay of Bengal can be a milestone for the discovery of novel antibiotics effective against multi-drug resistant pathogens.

Inhibition zone diameter (mm) S. aureus

P. aeruginosa

C. albicans

18 – 14

15 – 17

12 16 –

icillin-resistant Staphylococcus epidermidis, vancomycinresistant enterococci (VRE), and penicillin-resistant Streptococcus pneumoniae.

Barry, A.L. & Thornsberry, C. 1985 Susceptibility tests: diffusion test procedure. In Manual of Clinical Microbiology, 4th edn., eds. Ballows, E.A., Hawsler, W.J. Jr. & Shadomy, H.I. pp. 978–987. Washington DC: American Society of Microbiology. ISBN 0914826-65-4. Bergey, D.H. 1989 Bergey’s Manual of Systematic Bacteriology, Vol. 4. Baltimore, USA: Williams & Wilkins Company. ISBN 0-68309061-5. Ellaiah, P., Kalyan, D., Rao,V.S. & Rao, B.V. 1996 Isolation and characterization of bioactive actinomycetes from marine sediments. Hindustan Antibiotics Bulletin 38, 48–52. Jensen, P.R., Dwight, R. & Fenical, W. 1991 Distribution of actinomycetes in near shore tropical marine sediments. Applied and Environmental Microbiology 57, 1102–1108. Kurtboke, D.J. & Wildman, H.G. 1998 Accessing Australian biodiversity towards an improved detection of actinomycetes – an activity report. Actinomycetes 9, 1–2. Miyadoh, S. 1993 Research on antibiotic screening in Japan over the last decade: a producing microorganisms approach. Actinomycetologica 9, 100–106. Moran, M.A., Rutherford, L.T. & Hodson, R.E. 1995 Evidence for indigenous Streptomyces populations in a marine environment determined with a 16s rRNA probe. Applied and Environmental Microbiology 61, 3694–3700. Shirling, E.B. & Gottlieb, D. 1966 Methods for characterization of Streptomyces species. International Journal of Systemic Bacteriology 16, 313–340. Takizawa, M., Colwell, R.R. & Hill, R.T. 1993 Isolation and diversity of actinomycetes in the Chesapeake Bay. Applied and Environmental Microbiology 59, 997–1002. Thorne, G.M. & Alder, J. 2002 Daptomycin: a novel lipopeptide antibiotic. Clinical Microbiology Newsletter 24, 33–40.

Springer 2005


Protein fingerprinting profiles in different strains of Aeromonas hydrophila isolated from diseased freshwater fish Basanta Kumar Das*, Surya Kanta Samal, Biswa Ranjan Samantaray and Prem Kumar Meher Central Institute of Freshwater Aquaculture (CIFA), P. O. Kausalyaganga, Bhubaneswar, 751002, Orissa, India *Author for correspondence: Tel.: 91+(0674) 2465446*228/235(O), 2350756 (R), Fax : 91+(0674) 2465407, E-mail: [email protected] Keywords: Aeromonas hydrophila, molecular weight in kDa, SDS-PAGE, whole cell protein

Summary Aeromonas hydrophila (Ah) strains isolated from diseased fish in India were studied for protein profiling using the SDS-PAGE protein fingerprinting profile pattern of whole cells of 12 local strains of A. hydrophila and one reference strain (MTCC 646). Variability among the strains was observed. The average similarity between the 12 strains of A. hydrophila ranged from 0.272 to 0.916. Proteins with molecular mass of 55.6 and 14.67 kDa in Ah1, Ah2 and Ah3, 28.5 and 27.9 kDa in Ah4, Ah5 and Ah6, 21.4 and 19.5 kDa in Ah7, Ah8, Ah9 and 72.9, 91.5 and 71.3 kDa in Ah10, Ah11 and Ah12 were common. The protein polypeptide bands from 19.5 to 86.2 kDa were common in both local strains and reference strain of A. hydrophila. The protein fingerprinting study showed that there is genetic similarity between strains of A. hydrophila and reference strain (MTCC 646). These protein markers may be useful for further strain differentiation in epidemiological study.

Introduction Aeromonas bacteria are common Gram-negative, chemorganotrophic microorganisms widely distributed throughout the world (Ho et al. 1990). A. hydrophila is considered to be one of the major fish pathogens and causes mortalities to aquaculture system (Austin & Austin 1993; Angkra et al. 1995; Das & Mukherjee 1997). It causes haemorrhagic septicaemia, epizootic ulcerative syndrome (EUS) and abdominal dropsy to fishes (Frerichs 1989; Das 1991; Nayak 1993; Das & Mukherjee 1998). A. hydrophila has been reported to be associated with epizootic ulcerative syndrome in South East Asian countries (Roberts et al. 1986) and India (Karunasagar et al. 1986; Pal 1996; Das and Mukherjee 1997, 1998; Nayak et al. 1999). A wide variety of A. hydrophila strains are available in India (Nayak et al. 1999). The classical identification relies mainly on morphological, biochemical and physiological criteria, but this approach is time-consuming and often gives ambiguous results (Sorheim et al. 1989). Due to this fact, the development and use of new methods that improve the identification and detection of these microbes is advisable. Genotypic techniques including Ribotyping, Randomly amplified polymorphic DNA techniques and SDS-PAGE of cell free extracts (so called protein fingerprinting techniques) are also used in microorganism classification (DeParrasis & Roth 1990; Peter &

Bretz 1992; Hertel et al. 1993; Mc Dermott et al. 1994; Tsakolidou et al. 1994; Hartung 1998). However, no such protein based fingerprinting techniques are available for A. hydrophila. The study was carried out for the first time among twelve strains of A. hydrophila isolated from various disease conditions in order to standardize and develop protein based markers for easy and quick diagnosis of diseases due to this bacterium.

Materials and methods The whole cell protein lysates of 12 strains of A. hydrophila isolated from skin lesion, liver, kidney and intestine of mrigal, cat fish, goldfish and murrels were taken as materials for present study (Table 1). The antigens (whole cell protein, WCP) of different strains of A. hydrophila were prepared by the heat killed method. Mass cultures of A. hydrophila strains were done in brain heart infusion broth (Himedia, India) for 24 h in an orbital shaking incubator (Remi, India) at 37 C. Then, the cultures were centrifuged at 10,000 · g at 4 C for 10 min and pellets were collected and washed three times with phosphate buffer saline (PBS: NaCl, 8 g; Na2HPO4, 1.15 g; KH2PO4, 0.2 g; KCl, 0.2 g; distilled water to 1000 ml, pH 7.2). Finally, the pellets were resuspended in PBS (2% of the initial volume) and heat killed in a waterbath at 60 C for 1.5 h. Samples were then stored at )20 C. The samples (WCP) of 12 strains

588

B.K. Das et al.

Table 1. Isolation of Aeromonas hydrophila from different sources. Sl.No.

Isolate Code

Fish/Prawn

Organs

Area of collection

1 2

30 31

Cirrhinus mrigala Channa punctatus

Skin lesion Skin lesion

3

32

Channa punctatus

Skin lesion

4 5 6 7 8 9 10 11 12

33 34 40 42 43 46 51 53 56

Channa punctatus Channa punctatus Catfish Gold fish Gold fish Channa punctatus Channa marulius Channa species Channa marulius

Liver Skin lesion Skin lesion Kidney Intestine Kidney Skin lesion Skin lesion Skin lesion

CIFA* Pond Commercial fish farm, Puri District, India Commercial fish farm, Puri District, india CIFA wet laboratory CIFA wet laboratory CIFA- catfish unit CIFA-Aquarium unit CIFA-Aquarium unit CIFA wet laboratory Andhra Pradesh CIFA wet laboratory Andhra Pradesh

*CIFA –Central Institute of Freshwater Aquaculture.

of A. hydrophila were subjected to SDS-PAGE (Lammeli 1970) using 12% separating gel and 4% stacking gel and 1.5 mm thick slab gels with Tris/HCI buffer (pH 8.3). Samples were diluted in an equal volume of sample buffer (2% w/v SDS, 10% v/v, glycerol, 5% v/v, bmercaptoethanol, 0.002% bromophenol blue, 0.02 M Tris/HCl) and boiled for 5 min at 100 C in water bath shaker (Remi, India). After electrophoresis (180 min, 60 v) gels were stained with Coomassie brilliant blue (R250). The different protein bands were compared with protein standard markers (SM0431, MBI Fermentas), including b-galactosidase (116.0 kDa), bovine serum albumin (66.2 kDa), ovalbumin (45.0 kDa), lactate dehydroginase (35.0 kDa), REB sp 981 (25.0 kDa), blactoglobulin (18.4 kDa) and lysozyme (14.4 kDa). The bands were further characterized by designating them as Dark (D) and Light (L) and their staining intensities were recorded by + sign, one + indicating one unit. The average similarities, S, between two strains was calculated according to Lamont et al. (1986) as follows. Average similarityðSÞ ¼

Number of average bands 2 Total number of bands in both strains

Data analysis Using similarity values, genetic distances between isolates were worked out and a distance matrix was created. Further cluster analysis was performed using this matrix in the SAS program to create a dendrogram. Results and Discussion On 12% SDS-PAGE electrophoresis, 12 strains of A. hydrophila (Ah1–Ah12) and the reference strain (MTCC 646) yielded 6–13 polypeptide bands stained with Coomassie brilliant blue (R-250). The clear distinct bands as 16.2 and 14.67 kDa in Ah1; 27.9, 21.4 and 15.2 kDa in Ah2; 32.4 and 14.67 kDa in Ah3; 28.5 and 27.9 kDa in Ah4; 32.4 and 14.67 kDa in Ah5, 41.2 kDa

in Ah6; 86.2, 68.2 and 41.2 kDa in Ah7; 86.2, 55.6 and 21.4 kDa in Ah8; 86.2, 68.2, 55.6 and 21.4 kDa in Ah9, 72.9, 71.3, 47.6 and 23.5 kDa in Ah10; 91.5, 72.9, 71.3 and 23.5 kDa in Ah11 and 91.5, 72.9, and 71.3 kDa in Ah12, which were unique and different from each other are tabulated (Table 2). Representative photographs of each strain of A. hydrophila, showing gel electrophoretic band profiles are also shown in Figures 1 and 2. A. hydrophila reference strain (MTCC 646) yielded 15 clear and distinct polypeptide bands of molecular weight ranged from 19.5 to 99.2 kDa (Figure 3). Proteins of molecular mass 19.5, 23.5, 25.6, 32.4, 36.1, 41.2, 65.6, 71.3, 72.9 and 86.2 kDa were common in both the reference strain and in the local strains of A. hydrophila. Proteins of molecular weight of 91.5, 72.9 and 71.3 kDa were common in Ah10, Ah11 and Ah12 and this confirmed that strains 10 to 12 are isolated from a common species i.e. Channa species. The average similarity between Ah1 and Ah2 was 0.272, Ah2 and Ah3 was 0.375; Ah3 and Ah4 was 0.834; Ah4 and Ah5 was 0.916; Ah5 and Ah6 was 0.916; Ah7 and Ah8 was 0.454; Ah8 and Ah9 was 0.445; Ah9 and Ah10 was 0.476; Ah10 and Ah11 was 0.761 and Ah11 and Ah12 was 0.667, respectively. From our observations, it appears that there are minor variations in respect of the band numbers, intensity of bands and other properties of staining and electrophoretic mobilities in the whole cell proteins of the different strains of A. hydrophila. Tabouret et al. (1992) concluded that 42 and 50 kDa bands appear to be common to all species of Listeria monocytogenes during SDS-PAGE of SDS extracted proteins of L. monocytogenes. We conclude here that there are 6 to 13 polypeptide bands in 12 strains of A. hydrophila. Out of them 55.6 and 14.07 kDa bands in Ah1, Ah2 and Ah3; 28.5 and 27.9 kDa bands in Ah4, Ah5 and Ah6; 21.4 and 19.5 kDa bands in Ah7, Ah8 and Ah9; 91.5,72.9 and 71.3 kDa bands in Ah10, Ah11 and Ah12 are common. Zarhowski et al. (2001) described, SDS-PAGE of all free protein extracts of different strains of Pseudomonas at similarity levels ranging from

Protein fingerprinting profiles in different strains of Aeromonas hydrophila

589

Table 2. Showing the molecular weight of the various polypeptide bands of Aeromonas hydrophila strains (Ah1–Ah12) and RS (Ah13). Sl No. Ah1 Ah2 Ah3 Ah4 Ah5 Ah6 Ah7 Ah8 Ah9 Ah10 Ah11 Ah12 RS Ah13

MW X MW X MW X MW X MW X MW X MW X MW X MW X MW X MW X MW X MW X

in kDa in kDa in kDa in kDa in kDa in kDa in kDa in kDa in kDa in kDa in kDa in kDa in kDa

1

2

3

4

5

6

7

8

9

10

11

12

86.2 L 62.1 L+ 62.1 L 68.5 L+ 62.1 L 62.1 L 97.1 L+ 86.2 D+ 86.2 D 91.5 L 91.5 D 91.5 D+ 99.2 L

62.1 L+ 55.6 L 55.6 L 32.4 L 32.4 L 41.2 D+ 86.2 D+ 68.2 L 68.2 D+ 72.9 D+ 72.9 D+ 72.9 D 86.2 L

55.6 L 32.4 L 32.4 D+ 28.5 L 28.5 L+ 28.5 L 68.2 D 55.6 D 55.6 D+ 71.3 D 71.3 D 71.3 D+ 72.9 D+

41.2 L 27.9 D+ 28.5 L+ 27.9 D+ 27.9 L+ 27.9 L+ 55.6 L 47.6 L+ 48.32 L 53.5 L+ 48.32 L+ 53.5 L 71.3 L

36.5 L 25.67 L 23.5 L 23.5 L 23.5 L 25.57 L 48.32 L 31.3 L 41.2 L+ 48.32 L 43.51 L+ 43.51 L+ 70.2 L

32.4 L+ 23.5 L+ 14.67 D 14.67 L+ 14.67 D+ 14.67 L+ 41.2 D+ 28.5 L+ 31.3 L 47.6 D+ 31.3 L 39.6 L 69.7 L+

27.9 L 21.4 D+

23.5 L+ 18.7 L

21.4 L 15.12 D

16.2 D+ 14.67 L

15.34 L

14.67 D

36.1 L 22.1 L 22.12 L+ 41.2 L 27.9 L 28.5 L 55.6 D+

32.4 L+ 21.4 D+ 21.4 D 38.7 L 23.5 D+ 21.4 L+ 44.3 L

28.5 L 19.5 L+ 19.5 L 31.3 L+ 16.2 L 17.7 L+ 41.2 L+

27.9 L

23.5 L

21.4 L+

28.5 L

23.5 D

16.2 L

36.1 D+

34.1 D+

32.4 D

13

14

15

23.5 L+

19.5 L+

19.5 L

25.6 D+

NB: MW, Molecular Weight; X, Characteristics of bands; Ah, Aeromonas hydrophila; RS, Reference Strain (MTCC 646).

Figure 1. SDS-PAGE analysis of whole cell lysates of A. hydrophila strains. Lanes (R-L); M, molecular weight marker (14.4–116.0 kDa), 2–7, WCP of A. hydrophila strains (Ah1–Ah6).

Figure 2. SDS-PAGE analysis of whole cell lysates of A. hydrophila strains. Lanes (R-L); M, molecular weight marker (14.4–116.0 kDa), 2–7, WCP of A. hydrophila strains (Ah7–Ah12).

Figure 3. SDS-PAGE analysis of whole cell lysates of A. hydrophila reference strain (MTCC 646). Lanes (L-R); M, molecular weight marker (14.4–116.0 kDa), 2–3, WCP of A. hydrophila reference strain (MTCC 646).

18 to 100% of the maximum distance by computer assisted numerical processing of the patterns using cluster analysis with Euclidean distances. We conclude that the average similarity between the strains of A. hydrophila ranges from 0.272–0.916. The average similarity between the strain Ah4, Ah5 and Ah6 was maximum 0.916 and between Ah1 and Ah2 was minimum 0.272. The clear and distinct bands such as 16.2, 14.67, 15.2, 72.9, 71.3, 91.5, 68.2 and 47.6 kDa in different strains of A. hydrophila, which are unique and differ from each other may be suitable as molecular markers for identification and determination of molecular weight of the various polypeptide bands of different

590

B.K. Das et al.

Figure 4. Dendrogram of the cluster analysis based on protein profiles of twelve strains of A. hydrophila (Ah1–Ah12) and reference strain (Ah13).

strains of A. hydrophila. A dendrogram of the cluster analysis based on protein profiles of the 12 strains of A. hydrophila is shown in Figure 4. From, the dendrogram analysis, it was concluded that Ah1 and Ah12 strains are closely similar and isolated from the same source i.e. skin lesions of mrigal and Channa species. Ah12 and Ah10 isolates of A. hydrophila are also very similar, as these belong to same species of isolation (Channa marulius) and produce the same fingerprinting profile. Ah1, Ah9 and Ah10 strains are distantly related as these strains belong to different sources of isolation i.e. mrigal and different Channa species. Ah3 and Ah4 and Ah5 strains are similar as they belong to the same Channa punctatus. Ah3, Ah4, Ah5, Ah12, Ah9 and Ah2 isolates of A. hydrophila are distantly related as these strains belong to different sources of isolation i.e. Channa punctatus and Channa marulius. Ah7, Ah13 and Ah11 strains are closely related as these isolates originated from a different species i.e. gold fish and Channa species. Ah6, Ah7 and Ah8 strains were distantly related as these isolates belong to different sources i.e. gold fish and catfish as observed from the different polypeptide bands on SDS-PAGE. Ah6 and Ah11 strains are distantly related as these strains were isolated from catfish and Channa species. Ah2, Ah9 and Ah13 isolates were not closely related, as these belong to the different source of isolation i.e. Channa punctatus and Channa marulius and hence the percentage of relatedness between these strains varies to a greater extent. Further work needs to be done to study the characterization and immunogenicity of the above antigenic proteins of A. hydrophila.

Acknowledgements This work was supported by Lal Bahadur Shastri Young Scientist Award grant from the Indian Council

of Agricultural Research to the senior author. Acknowledgement is also due to Director, CIFA, and Bhubaneswar for providing all necessary facilities for conducting experimental trials.

References Angkra, S.L., Lam, T.J. & Sin, Y.M. 1995 Some virulence characteristics of Aeromonas hydrophila walking cat fish (Clarias gariepinus). Aquaculture 130, 103–112. Austin, B. & Austin, D.A. 1993 Bacterial pathogens Diseases in Farmed and Wild Fish. 2nd ed. Chichester. Ellis Horwood. Das, B.K. 1991 Pathobiology studies in fry and fingerlings of rohu, Labeo rohita (Ham). M. F. Sc. Dissertation, Orissa University of Agriculture and Technology, Bhubaneswar. Das, B.K. & Mukherjee, S.C. 1997 Pathology of Aeromonas infection in rohu, Labeo rohita (Ham) fingerlings. Journal of Aquaculture 5, 89–94. Das, B.K. & Mukherjee, S.C. 1998 Pathology of black Spot disease in fry and fingerlings of rohu; Labeo rohita (Ham). Geobioscience 25, 102–104. DeParrasis, J. & Roth, D.A. 1990 Nucleic acid probes for identification of phytobacteria: Identification of genus-specific 16S RNA sequences. Phytopathology 80, 618–621. Frerichs, G.N. 1989 Bacterial diseases of marine fish. The Veterinary Record 125, 315–318. Hartung, J.S. 1998 Molecular probes and assays useful to identify plant pathogenic fungi bacteria, and marked biocontrol agents. In G.J. Boland, and L.D. Kuykeendall (ed), Plant Microbe Interactions and Biological Control. Marcel Dekker Inc., New York, 393– 413 ISBN. Hertel, C., Ludwig, W., Pot, B., Kerster, K. & Schleifer, K.H. 1993 Differentiation of lactobacilli occurring in fermented milk products by using oligonucleotide probes and electrophoretic protein profiles. Systematic and Applied Microbiology 16, 463–467. Ho, A., Mietzner, S.Y., Smith, A.J. & Scholnik, G.K. 1990 The pili of Aeromonas hydrophila. Identification of an environmentally regulated ‘‘mini pilin’’. Journal of Experimental Medicine 172, 795–806. Karunasagar, I., Ali, P.K. M.M., Jeyasekaran, G. & Karuanasagar, I. 1986 Ulcerrative from A. hydrophila infection of Catla catla. Current Science 1994–1995. Laemmli, U.K. 1970 Nature 227, 680–685.

Protein fingerprinting profiles in different strains of Aeromonas hydrophila Lamont, R.J., Retire, D.T., Meluin, W.T. & Postlethwaite, R. 1986 An investigation of the taxonomy of Listeria species in comparison of electrophoretic patterns 1985–86, In Listeriose, Listeria, Listeriosis, eds. Courtiuuie, A.L., Espaze, L. & Rehaud, A.E. Nantes: Universite de Nantes. pp 41–46 ISBN. McDermott, J.M., Brandle, U., Dutly, F., Haemmerli, U.A., Keller, S., Muller, K.E. & Wolfe, M.S. 1994 Genetic variation in powdery mildew of barley. Development of RAPD, SCAR, and VNTR markers. Phytopathology 84, 1316–1321. Nayak, K.K., Mukherjee, S.C. & Das, B.K. 1999 Observation on different strains of Aeromonas hydrophila from various diseased fishes. Indian Journal of Fisheries 46(3), 245–250. Pal, J. 1996 The fish disease, Epizootic Ulcerative Syndrome. The present state of research and its impact in North Bengal, In Proceedings of the National Workshop on Fish and Prawn Diseases, Epizootics and Quarantine Adoption in India. Central Inland Capture Research Institute, Barrackpore. pp 95–98. Peter, O. & Bretz, A.G. 1992 Polymorphism of outer surface proteins of Borrelia burgdorferi as a tool for classification. Zentralblatt fu¨r Bakteriologie 277, 28–33.

591

Roberts, R.J., Macintosh, D.J., Tonguthai, K., Boonyaratpalin, S., Tayaputch, N. & Phillips, M.J. 1986 Field and Laboratory investigations into Ulcerative fish diseases in the Asia-Pacific region. Bangkok: F. A. O. ISBN-92-5-1044724. Sorheim, R., Torsvik, V.L. & Goksoyr, J. 1989 Phenotypical divergences between populations of soil bacteria isolated on different media. Microbial Ecology 17, 181–192. Tabouret, M., De Rycke, J. & Dubray, G. 1992 Analysis of surface proteins of Listeria in relation to species, serovar and pathogenicity. Journal of General Microbiology 138, 743–753. Tsakolidou, E., Manopoulou, E., Kabaraki, E., Zoidou, E., Pot, B., Kersters, K. & Kalantzopoulos, G. 1994 The combined use of whole cell protein extracts for the identification (SDS-PAGE) and enzyme activity screening of lactic bacteria isolated from traditional Greek diary products. Systematic and Applied Microbiology 17, 444–458. Zarhowski, R., Eichel, J., Lewicka, T., Rozyoki, H. & Pietr, S.J. 2001 Protein fingerprinting as a complementary tool of Pseudomonas bacteria. Cell Molecular Biology Letter 6, 913–923.


Springer 2005

Application of response surface methodology in medium optimization for spore production of Coniothyrium minitans in solid-state fermentation Xin Chen1,*, Yin Li 1,2, Guocheng Du1 and Jian Chen1,2,* 1 Laboratory of Environmental Biotechnology, School of Biotechnology, Southern Yangtze University, Wuxi 214036, P.R. China 2 Key Laboratory of Industrial Biotechnology, Ministry of Education, Southern Yangtze University, Wuxi 214036, P.R. China *Authors for correspondence: Tel./Fax: +86-510-5888301, E-mail: [email protected] Keywords: Coniothyrium minitans, optimization, response surface methodology, solid-state fermentation, spore production

Summary Spore production of Coniothyrium minitans was optimized by using response surface methodology (RSM), which is a powerful mathematical approach widely applied in the optimization of fermentation process. In the first step of optimization, with Plackett–Burman design, soluble starch, urea and KH2PO4 were found to be the important factors affecting C. minitans spore production significantly. In the second step, a 23 full factorial central composite design and RSM were applied to determine the optimal concentration of each significant variable. A second-order polynomial was determined by the multiple regression analysis of the experimental data. The optimum values for the critical components for the maximum were obtained as follows: soluble starch 0.643 (36.43 g. l)1), urea )0.544 (3.91 g l)1) and KH2PO4 0.049 (1.02 g l)1) with a predicted value of maximum spore production of 9.94 · 109 spores/g IDM. Under the optimal conditions, the practical spore production was 1.04 · 1010 spores/g IDM. The determination coefficient (R2) was 0.923, which ensure an adequate credibility of the model.

Introduction In recent years, with the environmental contamination caused by the excessive use of chemical pesticides becoming worse and worse, substitution of biopesticides for chemical pesticides to control plant pests and diseases has received increasing interest. The fungus Coniothyrium minitans is a potential biopesticide against Sclerotinia sclerotiorum, a widespread soil-born plant pathogen affecting more than 360 plant species such as oilseed rape, celery, lettuce, beans and potatoes, etc. (Campbell 1947; Whipps et al. 1991; Whipps & Gerlagh 1992; Boland & Hall 1994; Roger et al. 1998). For the commercial application of this biopesticide, large numbers of spores or conidia are required, and solid-state fermentation (SSF) is a cost-effective system for the sporulation of C. minitans (McQuilken & Whipps 1995; McQuilken et al. 1997; McQuilken & Whipps 1997). Several researches on spore production of C. minitans by SSF have been carried out on defined culture media (Oostra et al. 1998; Ooijkas et al. 1998, 1999). Although the use of defined media with an inert carrier could give a good reproducibility, it was relatively expensive and very difficult to be scaled up in the way of SSF. In our research, wheat bran was chosen as a

cost-effective basal medium for the spore production. Although previous work has given satisfactory results, the effects of additional nutrients on the enhancement of the quantity of spores are not clear. Determination of the optimal cultivation conditions for the conidia production of C. minitans is also very important for commercial practice, especially for the decrease of mass production cost. Conventionally, fermentation medium is optimized with the one-variable-at-a-time method, in which all variables but one is held at a constant level, and then the optimum level of the testing variable is determined. Although this method is simple, it is laborious and timeconsuming when there are many factors to be determined. Moreover, it works if, and only if there is no interaction between variables. Response surface methodology (RSM) is a powerful and efficient mathematical approach widely applied in the optimization of fermentation process, e.g. media components on enzyme production (Adinarayana & Ellaiah 2002; Park et al. 2002; Suamant et al. 2002), production of other metabolites (Zhang et al. 1996; Sunitha et al. 1998; Sadhukhan et al. 1999; Hujanen et al. 2001), spore production (Yu et al. 1997) and biomass production optimization (Lhomme & Roux

594 1991). It can give information about the interaction between variables, provide information necessary for design and process optimization, and give multiple responses at the same time. The present work was aimed at optimization of medium components, which have been found to play a very important role in enhancing the sporulation of fungus (Larroche 1996; Ooijkas et al. 1999), with the aid of RSM. In the preliminary step of optimization, six carbon sources, five inorganic nitrogen sources and six organic nitrogen sources were evaluated to determine optimal carbon and nitrogen source. Then, a Plackett– Burman design was used to identify which components of the media had significant effects on spore production. Subsequently, a central composite design was employed to optimize the factors, which had significant influence on spore production. The results were analyzed by response surface analysis.

Materials and methods Microorganism and inoculum preparation Coniothyrium minitans (CBS 14896) was used in this study. A spore suspension was obtained as follows: C. minitans was grown on an isolated potato dextrose agar (PDA) in Petri dishes at 20 C for 7 days. The conidia were harvested from the surface by adding 0.85% (w/v) sterile saline solution and scraping with a sterile spatula. The spore suspension obtained was counted by using a Neubauer counting chamber, adjusted to approximately 106 spores ml)1. The spore suspension was used to inoculate the subsequent fermentation immediately. C. minitans was routinely maintained on PDA slants at 4 C by regular sub-cultivation (no longer than 3 months). Solid-state fermentation Wheat and wheat bran were purchased from local market and used as the solid substrates in the experiments. All fermentation substrates were autoclaved at 121 C for 20 min. The experiments were performed in 250-ml Erlenmeyer flask with 5 g of autoclaved substrate, covered with a cotton plug. All fermentations were carried out at 20 C for 7 days under various conditions as described in the following parts of this paper. To protect the substrate from drying out, a metal plate filled with water was placed in the incubator to maintain the relative humidity at ca. 0.98 inside the incubator. Assessment of conidia yield A 5-g sample was ground in a mortar and then mixed with 100 ml distilled water containing 0.1% (v/v) Tween 80 in a laboratory blender for 2 min at the maximum speed to separate the spores from the substrate thor-

X. Chen et al. oughly. Spore suspension was obtained after this step, and the spore suspension was diluted appropriately to a proper density that could be identified under the counting conditions. The spores were counted by using a haemocytometer under 400 · magnification in a bright field microscope. Spore yield was expressed as spores per g initial dry matter (IDM). The results were the means of duplicate determination of two independent samples. Experimental designs and data analysis Determination of optimal carbon and nitrogen sources To select the suitable carbon and nitrogen source, in the preliminary step of optimization, six carbon sources (starch, dextrin, glucose, maltose, galactose and sucrose), six organic nitrogen sources (yeast extract, corn steep liquor, beef extract, arginine, peptone and glycine) and five inorganic nitrogen sources (ammonium nitrate, ammonium chloride, urea, ammonium sulphate and sodium nitrate) were evaluated (Tables 1–3). These nutrients were respectively added into the flasks with wheat bran as basal medium. The initial moisture content of the media was adjusted to 40%. After sterilization and cooling to ambient temperature, 5 ml inoculum was inoculated in the flasks. The final moisture content then was maintained at 140%. The spore production of C. minitans was calculated after 7 days of incubation at 20 C. Plackett–Burman design In many cases, there are a large number of factors, which needed to be identified for their importance to the Table 1. Effect of supplementary carbon source on the spore production of C. minitans in SSF. Supplentary nutrients Concentration (w/v)

Spore production (*109/g IDM)

Starch Dextrin Glucose Maltose Galactose Sucrose Control

8.50 8.01 7.45 7.49 7.43 7.56 6.50

1% 1% 1% 1% 1% 1% –

± ± ± ± ± ± ±

0.60 0.42 0.30 0.14 0.21 0.29 0.20

0.5 % (w/v) of urea was used as the nitrogen source.

Table 2. Effect of supplementary organic nitrogen source on the spore production of C. minitans in SSF. Supplentary nutrients Concentration (w/v)

Spore production (*109/g IDM)

Yeast extract Corn steep liquor Beaf extract Arginine Peptone Glycine

6.45 8.09 6.17 7.75 6.33 7.49

0.5% 0.5% 0.5% 0.5% 0.5% 0.5%

± ± ± ± ± ±

0.02 0.44 0.26 0.13 0.21 0.08

1.0% (w/v) of soluble starch was used as the carbon source.

Coniothyrium minitans spore production

595

Table 3. Effect of supplementary inorganic nitrogen source on the spore production of C. minitans in SSF. Supplentary nutrients Concentration (w /v) Spore production (*109/g IDM) NH4NO3 NH4Cl Urea (NH4)2SO4 NaNO3

0.5% 0.5% 0.5% 0.5% 0.5%

7.63 7.01 8.40 7.39 8.28

± ± ± ± ±

0.35 0.04 0.50 0.57 0.72

1.0% (w/v) of soluble starch was used as the carbon source.

dependent variable of interest. The most intuitive approach would be to vary those factors in a full factorial design, that is, to try all possible combinations of settings. Full factorial designs require 2N (N denotes numbers of factors) experiments. This would work fine, except that the number of necessary runs in the experiment (observations) will increase geometrically. In our case, seven variables have to be examined, it requires 27(128) experiments, which is a very large number and time-consuming. Plackett–Burman design is a very useful tool used to screen ‘n’ variables in just ‘n+1’ number of experiments (Plackett & Burman 1946; Rama et al. 1999; Ghanem et al. 2000). There will be a tremendous decrease in total experiments. In this part, the selected carbon (soluble starch) and nitrogen sources (corn steep liquor and urea) were further optimized together with other four variables: KH2PO4, CaCl2 Æ 2H2O, MgCl2 Æ 6H2O and trace elements. The design was shown in Table 4. The design matrix (Table 4) was developed using an SAS package (version 8.01). Each variable was set at two levels, that is, high level and low level. The high level of each variable was set far enough from the low level to identify which ingredients of the media have significant influence on the spore production. The trace elements stock solution consisted of (g l)1): EDTA 1, ZnSO4 Æ 7H2O 0.2, FeSO4 Æ 7H2O 0.5, Na2MoO4 Æ 2H2O 0.02, CuSO4 Æ 5H2O 0.02, CoCl2 Æ 6H2O 0.04 and MnCl2 Æ 4H2O 0.1. Central composite design The CCD is one of response surface methodologies (Chakravarti & Sahia 2002). After the identification of

the components affecting the spore production significantly, a CCD was adopted to optimize the major variables (soluble starch, urea and KH2PO4), which were selected through Plackett–Burman design. A 23 full factorial central composite experimental design with six star points (a ¼ 1.285), six replicates at the centre points and resulting in a total of 20 experiments was used to investigate the three chosen variables of the medium for the spore production of C. minitans by SSF. The experiment was designed by using the SAS package, version 8.01. The central composite design was presented in Table 5. The experiments were performed in duplicate and the mean values were taken for the analysis. A second order polynomial, Equation (1), which includes all interaction terms, was used to calculate the predicted response: Y ¼ b0 þ

X

bi xI þ

X

bii x2i þ

X

bij xi xj

ð1Þ

Table 5. CCD for three variables. Run order

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Coded level

Spore production (lnY)

Soluble Urea (g/l) starch (g/l)

KH2PO4 (g/l)

20 40 20 40 20 40 20 40 17.15 42.85 30 30 30 30 30 30 30 30 30 30

1.5 0.5 0.5 1.5 0.5 1.5 1.5 0.5 1 1 1 1 0.358 1.643 1 1 1 1 1 1

3 3 7 7 3 3 7 7 5 5 2.43 7.57 5 5 5 5 5 5 5 5

22.9876 22.7259 22.8100 22.8335 22.7700 22.9140 22.7043 22.8167 22.7596 22.9251 23.0465 22.8677 22.9260 22.9370 23.0171 23.0233 23.0171 23.0233 23.0171 23.0233

Table 4. Plackett–Burman design of seven variables. Run I

1 2 3 4 5 6 7 8

Variable

Spore production (ln Y)

Starch (g/l)

Urea (g/l)

Corn steep KH2PO4 (g/l) liquor (ml/l)

CaCl2 Æ 2H2O (g/l)

MgCl2 Æ 6H2O Trace elements (g/l) (ml/l)

30 30 30 10 10 10 10 30

15 5 5 15 15 5 5 15

5 15 5 15 5 15 5 15

0.025 0.1 0.1 0.1 0.025 0.025 0.1 0.1

2.5 10 2.5 2.5 10 2.5 10 10

1 1 4 1 4 4 1 4

20 5 5 5 5 20 20 20

22.3707 22.5603 22.4149 22.3058 22.2996 22.3311 22.4121 22.3120

596

X. Chen et al.

where Y represents response variable, b0 is the interception coefficient, bi, coefficient of the linear effect, bii, the coefficient of quadratic effect and bij, the coefficient of interaction effect. Where xi and xj denote the coded levels of variable Xi and Xj investigated in experiments. The variable Xi was coded as xi according to the Equation (2): xi ¼

Xi X0 DXi

ð2Þ

where xi is (dimensionless) coded value of the variable Xi, X0 is the real value of Xi at the center point (zero) level, and the DXi is the step change value. Media consisting of 5 g wheat bran as a basal medium from the same batch, was dispensed into a 250-ml Erlenmeyer flask and supplemented with the nutrients for optimization. The spore production of C.minitans was expressed in natural logarithm value. An SAS package, version 8.01, was used for multiple regression analysis of the experimental data obtained. The F-test was employed to evaluate the statistical significance of the quadratic polynomial. The multiple coefficients of correlation R and the determination coefficient of correlation R2 were calculated to evaluate the performance of the regression equation. Results and discussion Determination of optimal carbon and nitrogen sources In the preliminary step of optimization, the selected nutrients were added to wheat bran separately. Compared with the control, the supplementary nutrient could really increase spore number of C. minitans (Tables 1–3). Soluble starch, dextrin, glucose, maltose, galactose, and sucrose were examined to select a suitable carbon source. As can be seen from Table 1, of the six carbon sources investigated, soluble starch and dextrin were relatively favourable to the spore production of C. minitans. However, glucose gave the poorest result. It may be caused by hydrolysis of starch to glucose and the rate is very slow compared with that of glucose uptake (Ooijkas et al. 1998). The influence of various nitrogen sources on the spore production of C. minitans is presented in Tables 2 and 3, corn steep liquor and urea were found to be the best organic and inorganic nitrogen sources. It has also been reported that urea was a kind of preferred inorganic nitrogen source for the sporulation of C. minitans. Plackett–Burman design A Plackett–Burman design was performed when the suitable carbon and nitrogen source supplemented had been determined. From Table 6, it can be seen that with the increase in the concentration of soluble starch,

Table 6. Ranking of the variables investigated in the Plackett–Burman design. Variable Component

Ex,i

Absolute value of Ex,i

Ranking

A B C D E F G

0.2228 )0.3522 )0.0916 )0.2041 )0.0178 0.0697 )0.0634

0.2228 0.3522 0.0916 0.2041 0.0178 0.0697 0.0634

2 1 4 3 7 5 6

Starch Urea Corn steep liquor kh2PO4 CaCl2 Æ 2H2O MgCl2 Æ 6H2O Trace elements

MgCl2 Æ 6H2O and corn steep liquor all have positive effects on spore production. An increase in the levels of urea, KH2PO4, CaCl2 Æ 2H2O, or trace elements have negative effects on spore production. With the help of relative ranking of Ex,i, soluble starch, urea and KH2PO4 within the tested limits were selected for further optimization, which had the most significant effects on spore production. The positive effects of starch were, maybe, caused by the requirement of a large quantity of substrate to synthesize spores. Starch was a preferred substrate to synthesize macromolecules (e.g. carbohydrates), which was related to sporulation and germination. Therefore, high starch concentrations would lead to higher spore production, which agreed with the results of Ooijkaas et al. (1999). Urea at high concentration would negatively enhance spore production of C. minitans. This result coincided with the cases of some other fungi (Smith & Galbraith 1971). Low urea level was more advantageous than high urea level for spore production. McQuilken et al. (1997) reported that the sporulation of C. minitans is inhabited at low initial pH. It is possible that the high concentration of KH2PO4 could cause acidification of the culture, resulting in low spore production. The Plackett–Burman design was proved to be a powerful tool to determine the effects of medium constituents on spore production of C. minitans rapidly. However the optimal concentrations of medium components that significantly affect spore production could not be obtained. Further work needed to be done to find out this information. Central composite design This is a very useful tool to determine the optimal level of medium constituents and their interaction. Based on the Plackett–Burman design, where soluble starch, urea and KH2PO4 were selected for their significant effects on the spore production, a central composite was used for further optimization. The concentrations of those major nutrients tested were presented in Table 5. Other nutrients concentrations were set at their centre point tested in the Plackett–Burman design. Spore count after 7 days cultivation could reach 1.04 · 1010 spores per g IDM. Regression analysis of log-transformed experimental data was performed by an SAS package to obtain the

Coniothyrium minitans spore production

597

Table 7. Analysis of variance (ANOVA) for the three factorial design. Source

Sum of squares

Degrees of freedom

Mean square

Model Error Total

0.2248 0.0187 0.2435

9 10 19

0.0250 13.3477 0.00187

F-value

P>F

0.00018

following second-order polynomial, which accounts for the natural logarithm of the spore production. Y ¼ 23:0503 þ 0:02035X1 0:0409X2 þ 0:0293X3 0:1078X12 0:0383X22 0:0538X32 þ 0:0317X1 X2 0:0618X2 X3 þ 0:0116X1 X3

ð3Þ

where Y is the response value, that is, the spore production, and X1, X2 and X3 are the coded levels of soluble starch, urea and KH2PO4, respectively. The goodness of fit of the regression equation was evaluated by the coefficient of correlation (R) and the determination coefficient (R2). In this case, the value of R (0.9608) indicates a high agreement between the experimental and predicted values. The value of determination R2 (0.9232) indicates that the response model can explain 92.23% of the total variations. The value of adjusted determination coefficient (R2Adj ¼ 0:8540) was also high enough to indicate the significance of the model. The corresponding analysis of variance (ANOVA) is given in Table 7. The F value is a measure of the variation of the data about the mean. Generally, the calculated F value should be several times greater than the tabulated F value if the model is a good prediction of the experimental results and the estimated factor effects are real. In this case, the ANOVA of the regression model demonstrates that the model is highly significant, as is evident from the calculated F value (= 13.3447) and a very low probability value (P > F ¼ 0.00018). The computed F value (= 13.3447) is also much greater than the tabulated F value (F9,10 ¼ 4.94) at 0.01 level, which indicates that the second-order polynomial is highly significant. The three dimensional response surfaces plots were employed to determine the interaction of the medium components and the optimum levels of the components supplemented into the basal medium, which have significant effects on the spore production of C. minitans. The response surface plots are shown in Figures 1–3, which illustrate the relationship between response and the experimental data. As can be seen from Figures 1 and 2, the spore production was predominantly affected by the urea concentration. With increase of the urea concentration, the spore production was inhibited. This result quite conformed to the information obtained from our Plackett–Burman design. Figure 3 showed the effects of starch concentration and KH2PO4 concentration on spore

Figure 1. Effects of starch (X1) and urea (X2) and their interactive effect on the spore production (Y1) with other nutrient set at centre level.

Figure 2. Effects of urea (X2), KH2PO4 (X3) and their interactive effect on the spore production (Y1) with other nutrients set at centre level.

Figure 3. Effects of starch (X1) and KH2PO4 (X3) and their interactive effect on the spore production (Y1) with other nutrients set at centre level.

598

X. Chen et al.

Table 8. Comparison of spore production of C. minitans of this paper with the same reported in literatures. Substrate

Harvest time

Cultivation

Spore production (conidia/g IDM)

Source

Wheat bran Dry oats Hemp impregnated with a glucose/yeast extract solution Chemically defined solid medium

7–8 days 18–19 days 18 days

Erlenmeyer flask, 250 ml, Scraped-drum reactor, 1.6 l Packed-bed reactor, 15 l

1.04 · 1010 conidia/g IDM 5 · 109 conidia/g IDM 9 · 1014 conidia/m3 PBR

This paper Oostra et al. (2000) J.Weber et al. (1999)

31 days

Petri dish (9 cm)

3 · 1010 conidia/ dish

Ooijkaas et al. (1999)

production when urea was held at zero level. It can be observed an increase of spore production with increased starch concentration vs. KH2PO4 concentration. The predicted optimum levels of the tested variables, namely, soluble starch, urea and KH2PO4 were obtained by applying regression analysis of Equation (3) using SAS package software, version 8.01. The optimal levels were as follows: X1 ¼ 0.643 (36.43: g l)1), X2 ¼ )0.544 (3.91 g l)1), X3 ¼ 0.049 (1.02 g l)1) with the corresponding Y ¼ 23.020 (9.94 · 109 spores/g IDM). Verification of the predicted values was conducted by using optimal conditions in inoculation experiments. The practical corresponding response was 1.04 · 1010 spores/g IDM. This result corroborated the validity and the effectiveness of this model. The spore production of 1.04 · 1010 spores/g IDM, compared with that reported in literature (Table 8) also justified our present work.

Conclusions The RSM was performed to optimize the medium components for spore production of C. minitans. A high significant quadratic polynomial obtained by the central composite design was very useful to determine the optimal concentrations of constituents that have significant effects on spore production. The optimal supplementary nutrient solution (per litre) consisted of: soluble starch 36.43 g, urea 3.91 g, KH2PO4 1.02 g, Corn steep liquor 10.0 ml, CaCl2 Æ 2H2O 0.05 g, MgCl2 Æ 6H2O 5.0 g, and trace elements 10.0 ml. And its final pH was adjusted to 6.0. Under the optimal condition, 9.94 · 109spores/g IDM could be produced in theory and 1.04 · 1010 spores/g IDM in practical experiment. References Adinarayana, K. & Ellaiah, P. 2002 Response surface optimization of the critical medium components for this production of alkaline protease by a newly isolated Bacillus sp. Journal of Pharmacy and Pharmaceutical Science 5, 272–227. Boland, G.J. & Hall, R. 1994 Index of plant hosts of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology 16, 93–108. Campbell, W.A. 1947 A new species of Coniothyrium parasitic on sclerotia. Mycologia 39, 190–195. Chakravarti, R. & Sahai, V. 2002 Optimization of compactin production in chemically defined production medium by Penicillium citrinum using statistical methods. Process Biochemistry 38, 481–486. Ghanem, N.B., Yusef, H.H. & Mahrouse, H.K. 2000 Production of Aspergillus terreus xylanase in solid-state cultures: application of

the Plackett–Burman experimental design to evaluate nutritional requirements. Bioresource Technology 73, 113–121. Hujanen, M., Linko, S., Linko, Y.Y. & Leisola, M. 2001 Optimization of media and cultivation conditions for L (+)(S)-lactic acid production by Lactobacillus casei NRRL B-441. Applied Microbiology and Biotechnology 56, 126–130. Larroche, C. 1996 Microbial growth and sporulation behaviour in solid-state fermentation. Journal of Scientific and Industrial Research 55, 408–423. Lhomme, B. & Roux, J.C. 1991 Utilization of experimental designs for optimization of Rhizopus arrhizus culture. Bioresource Technology 35, 301–312. McQuilken, M.P. & Whipps, J.M. 1995 Production, survival and evaluation of solid-substrate inocula of Coniothyrium minitans against Sclerotinia sclerotiorum. European Journal of Plant Pathology 101, 101–110. McQuilken, M.P., Budge, S.P. & Whipps, J.M. 1997 Effects of culture media and environmental factors on conidial germination, pycnidial production and hyphal extension of Coniothyrium minitans. Mycological Research 101, 11–17. McQuilken, M.P. & Whipps, J.M. 1997 Production, survival and evaluation of liquid culture-produced inocula of Coniothyrium minitans against Sclerotinia sclerotiorum. Biocontrol Science and Technology 7, 23–26. Oostra, J., Tramper, J. & Rinzema, A. 1998 Biomass estimation of Coniothyrium minitans in solid-state fermentation. Enzyme and Microbial Technology 22, 480–486. Oostra, J., Tramper, J. & Rinzema, A. 2000 Model-based bioreactor selection for large-scale solid-state cultivation of Coniothyrium minitans spores on oats. Enzyme and Microbial Technology 27, 652–663. Ooijkas, L.P., Chin-Joe, I., Tramper, J. & Buitelaar, R.M. 1998 Spore production of Coniothyrium minitans on different nitrogen sources with glucose or starch as carbon source. Biotechnology Letters 20, 785–788. Ooijkas, L.P., Wilkinson, E.C., Tramper, J. & Buitelaar, R.M. 1999 Medium optimization for spore production of Coniothyrium minitans using statistically based experimental designs. Biotechnology and Bioengineering 64, 92–100. Park, Y.S., Kang, S.W., Lee, J.S., Hong, S.I. & Kim, S.W. 2002 Xylanase production in solid state fermertation by Aspergillus niger mutant using statistical experimental designs. Applied Microbiology and Biotechnology 58, 761–766. Plackett, R.L. & Burman, J.P. 1946 The design of optimum multifactorial experiments. Biometrika 33, 305–325. Rama Mohan Reddy, P., Reddy, G. & Seenayya, G. 1999 Production of thermostble b-amylase and pullulanase by Clostridium thermosulfurogenes SV2 in solid-state fermentation: Screening of nutrients using Plackett–Burman design. Bioprocess Engineering 21, 175–179. Roger, H., Willians, J.M. & Cooke, R.C. 1998 Role of soil mesofauna in dispersal of Coniothyrium minitans: Transmission to sclerotia of Sclerotinia sclerotiorum. Soil Biology and Biochemistry 30, 1929– 1935. Sadhukhan, A.K., Ramana Murthy, M.V., Ajaya Kumar, R. Mohan, E.V.S., Vandana, G., Bhar, C. & Venkateswara Rao, K. 1999 Optimization of mycophenolic acid production in solid-state fermentation using response surface methodology. Journal of Industrial Microbiology and Biotechnology 22, 33–38.

Coniothyrium minitans spore production Smith, J.E.& Galbraith, J.C. 1971 Biochemical and physiological aspects of differentiation in the fungi. Advances in Microbial Physiology 5, 45–134. Suamant, P., Qasim, K.B. & Rani, G. 2002 Optimization of alkaline protease from Bacillus sp. by response surface methology. Current Microbiology 44, 286–290. Sunitha, I., Subba Rao, M.V. & Ayyanna, C. 1998 Optimization of medium constituents and fermentation conditions for the production of L -glutamic acid by the co-immobilized whole cells of Micrococcus glutamicus and Pseudomonas reptilivora. Bioprocess Engineering 18, 353–359. Webber, F.J., Tramper, J. & Rinzema, A. 1999 A simplified material and energy balance approach for process development and scaleup of Coniothyrium minitans conidia production by solid-state cultivation in a packed-bed reactor. Biotechnology and Bioengineering 65, 447–458.

599 Whipps, J.M. & Gerlagh, M. 1992 Biology of Coniothyrium minitans and its potential for use in disease biocontrol. Mycological Research 96, 897–907. Whipps, J.M., Grewal, S.K. & Van der Goes, P. 1991 Interactions between Coniothyrium minitans and Sclerotia. Mycological Research 95, 295–299. Yu, X., Hallet, S.G., Sheppard, J. & Watson, A.K. 1997 Application of the Plackett–Burman experimental design to evaluate nutritional requirements for the production of Colletotrichum coccodes spores. Applied Microbiology and Biotechnology 47, 301–305. Zhang, J., Marcin, C., Shifflet, M.A., Salmon, P., Brix, T., Greasham, R., Buokland, B. & Chartrain, M. 1996 Development of a defined medium fermentation process for physotigmine production by Streptomyces griseofuscus. Applied Microbiology and Biotechnology 44, 568–575.


Springer 2005

Cultivation of oyster mushrooms (Pleurotus spp.) on various lignocellulosic wastes Q.A. Mandeel*, A.A. Al-Laith and S.A. Mohamed Department of Biology, College of Science, University of Bahrain, P.O. Box 32038, Isa Town Campus, Kingdom of Bahrain *Author for correspondence: Tel.: +973-876417, Fax: +973-876519, E-mail: [email protected] Keywords: agriculture waste, bagging systems, fungi, lignocellulosic, oyster mushroom, Pleurotus, spawn Summary Cultivation of speciality mushrooms on lignocellulosic wastes represents one of the most economically and costeffective organic recycling processes. Three species of Pleurotus, namely P. columbinus, P. sajor-caju and P. ostreatus were experimentally evaluated on untreated organic wastes including chopped office papers, cardboard, sawdust and plant fibres. Production studies were carried out in polyethylene bags of about 1 kg wet weight with 5% spawning rates of substrate fresh weight in a custom-made growth room especially designed for spawn run and cropping. The conversion percentage from dry substrate weight to fresh mushroom weight (biological efficiency) was determined. The highest biological efficiency was noted with P. columbinus on cardboard (134.5%) and paper (100.8%), whereas P. ostreatus produced maximum yield on cardboard (117.5%) followed by paper (112.4%). The overall yield of P. sajor-caju was comparatively low (range 47–78.4%). The average number of sporophore flushings ranged between 5 and 6 times. The findings that P. columbinus and P. ostreatus are superior to P. sajor-caju are consistent with previous reports elsewhere. Further evaluation of P. columbinus alone on different bagging systems containing partially pasteurized office papers as a growing substrate revealed that polyethylene bags resulted in 109.4% biological efficiency in contrast to pottery (86%), plastic trays (72%) or polyester net (56%). The above findings reveal an opportunity for commercial implication of oyster mushroom especially P. columbinus for utilization of different feasible and cheap recyclable residues.

Introduction Pleurotus species, commonly known as oyster mushrooms, are edible fungi cultivated worldwide especially in south east Asia, India, Europe and Africa. The genus is characterized by its high protein content (30–40% on dry weight basis) (Sharma & Madan 1993) and gourmet food quality, thus surpassing many other foods. Medically, Pleurotus ostreatus is reported to decrease cholesterol levels in experimental animals (Bobek et al. 1995; Bobek et al. 1998; Hossain et al. 2003). Unlike other mushroom species, oyster mushrooms are the easiest, fastest and cheapest to grow, require less preparation time and production technology. Also, the first flush is usually large, without the need for compost, manure, limestone, casing or temperature shocks. With more than 100% biological efficiency, coupled with its distinctive flavour, aroma and excellent drying and preservation qualities, it is assured a unique status as a delicacy. Bioconversion of lignocellulosic residues through cultivation of Pleurotus species offers the opportunity to utilize renewable resources in the production of edible, protein-rich food that will sustain food security for people in developing countries (Sanchez et al. 2002). Cultivation of edible mushrooms is one of the most economically

viable processes for the bioconversion of lignocellulosic wastes (Bano et al. 1993; Cohen et al. 2002). The technology can also limit air pollution associated with burning agriculture wastes as well as to decrease rodents, pests and deleterious fungal inoculum populations. Various agricultural by-products are being used as substrates for the cultivation of the oyster mushroom. Some of these wastes include banana leaves, peanut hull and corn leaves, mango fruits and seeds, sugarcane leaves, wheat and rice straw (Cangy & Peerally 1995). The widely used substrate for cultivation of the oyster mushroom in Asia is rice straw (Thomas et al. 1998). It is also considered the best substrate in terms of yield and high protein content. In Europe, wheat straw is used, while in South East Asian countries sawdust is more common. The majority of these substrates can be used as animal feed. However, their low digestibility, low protein content and high lignin content render them unpopular and unacceptable. Moreover, due to an increased demand on these substrates for biogas production, composting and non-availability in some areas, it becomes necessary to find cheap alternative sources. In Bahrain, cultivation of the date palm results in the accumulation of large quantity of by-product leaves which are rich in lignin and cellulose and are available

602 without any cost throughout the year not only in farms but also in private gardens and homes. Groof is the flower spathe of the date palm. This part is locally used to produce ‘Luqah water’, a popular and favourite local cold drink during the flowering season in spring. Solid waste of Groof is produced as a result of simple distillation process and finds no further use except dumping. Several distillation plants are seasonally involved in this practice at a national level, but no available data is available with regards to the amount of Groof waste produced annually. Saw chips from carpentry factories and waste office papers are also available free all the year round. The cultivation of Pleurotus spp. has been tested in different bagging systems like trays, cylindrical containers, wooden or polystyrene racks, blocks and plastic bags (Quimio et al. 1990). Cultivation in plastic bags were reported to yield more harvest than other types with less contamination level (Zadrazil & Kurtzman 1982). In Europe, growers uses mainly large black perforated bags while in Asian countries they prefer smaller ones where inoculation and harvesting is managed at one end of the bag. The present investigation was undertaken with a view to finding the feasibility of utilizing several locally available lignocellulosic by-products as potential substrates for the cultivation of three species of oyster mushrooms and determination of their optimum yield.

Materials and Methods

Q.A. Mandeel et al. Graminae) and white sawdust were used as substrates for cultivation of Pleurotus spp. The papers and cardboard were shredded in an office-shredding machine, while plant fibres were chopped manually into 3–5 cm in length with hand scissors. All air-dried substrates (337 g) were soaked in hot tap water (60 C) overnight. The excess water was allowed to drain off through large-holed sieves. The wet substrate was mixed with a fresh supplement of chicken manure at a ratio of 5:1 on dry weight basis to provide a nitrogen source and 5 g dry oats. To maintain the pH, 2% CaCO3 + CaSO4 were added to the substrate. Three replicates of each substrate per strain were prepared. The dry weights of these substrates were used to calculate the biological efficiency. The substrate mixture was properly mixed, moisture content adjusted to 65%, placed in 18 · 32.5 cm autoclavable polyethylene bags (75 lm thickness) and plugged with cotton wool. Bags of substrate were placed in stainless steel baskets and autoclaved for 1 h at 15 psi at 121 C and allowed to cool for 3 h to room temperature before aseptically inoculated. A multilayered spawning method was followed using 5% wet spawn culture per bag. In this method, a layer of sterilized substrate was spread to a height of about 5 cm at the bottom of the polyethylene bag. Later, a layer of spawn of about 10 cm was spread on the substrate until the final consisted of spawn. About 25 holes measuring 3 mm in diameter were made into each bag for proper aeration. The spawned bags were kept in a well ventilated room at a temperature of 22 ± 2 C in total darkness with >90% relative humidity.

Strains and spawn Spawn run Stock cultures of three species of Pleurotus namely P. columbinus (strain 250), P. sajor-caju (strain 290) and P. ostreatus (strain 200) on millet grains were obtained from Comet Mushroom Service Co., Cairo, Egypt. The spawn was kept at 5 C until inoculation. Pure culture lines were maintained on potato dextrose agar (PDA, Difco Laboratories). The spawn used in this study were prepared on whole grains of barely. One kilogram of grains were soaked overnight in water, rinsed three times in distilled water and boiled for 25–30 min. The excess of water was drained off and 2% w/w CaCO3 + CaSO4 in addition to 5% dry oats (Quaker Oat Co., USA) were added. The ingredients were thoroughly mixed and distributed equally into 500-ml wide-neck autoclavable glass jars at the rate of 250 g seeds per jar and sterilized at 15 psi for 45 min. Each of these jars was inoculated with one agar plugs of 8-days-old mycelium and incubated in the dark for 20 days at 20 ± 2 C until the substrate became fully colonized. Cultivation method Four different waste materials, unsorted office paper, cardboard, plant fibres (Bromus fasciculatus, family;

The spawn run and cropping were performed in a custom-made growth room of 6.6 m length · 3 m breadth · 3 m height with waterproof gloss paint walls and ceiling and ceramic tile-covered floor. A cool-air humidifier was calibrated to provide 90% relative humidity and a table fan allowed cross ventilation on all sides of the room. Cool fluorescent lights (20–50 lux) were adjusted to afford 12 h photoperiod daily. The temperature was centrally maintained at 21–22 C. Prior to each experiment the room was disinfected with 10% formaldehyde. The incubated bags were placed randomly 20 cm apart on a aluminium shelf unit 1 m above the floor. Cropping After a complete spawn run, the bags were opened after 2 weeks in case with paper and cardboard, 3 weeks for fibre and 4 weeks for sawdust, when the mycelium had completely covered the substrate. The compact mass of the substrate and mycelium was watered daily with distilled sterilized water from the second day of opening of the bags. Within 7–8 days of opening, pin head fruiting bodies (4–5 cm in diameter) appeared on all

Cultivation of Pleurotus spp. on waste

603

sides of the bag. These young mushrooms attained the normal size in about 2–3 days when the first crop was harvested from each of the bags. Mature fruiting bodies were harvested at different periods and the fresh weight recorded immediately after the harvest. The time taken for the appearance of pin heads was also recorded. Biological efficiency (BE) was calculated as percentage yield of fresh mushroom fruiting bodies in relation to dry weight of the substrate. It was necessary to calculate percentage BE because certain substrates were denser than others.

Biological efficiency% ¼

of compact mass for fruit body development. In an experiment designed to examine the effect of addition of NH4Cl as an external source of nitrogen, three trays were essentially prepared and treated as above. An amount of 0.00, 0.265 and 2.650 g of NH4Cl were incorporated into each tray containing 1 kg of the substrate. Chemical analysis The moisture content was determined by drying the fruiting bodies to a constant weight in a conventional

Weight of fresh mushroom fruiting bodies 100 Weight of dry substrate

Effect of bagging system Four different containers were used to evaluate the yield of P. columbinus on paper byproducts. These consisted of polyethylene bags, plastic trays, pottery dishes and polyester net bags. Polyethylene bags were 60 · 45 cm (75 lm thickness) transparent, heat-resistant, high-density and perforated sacks with 15 holes of 2 cm diameter. Plastic trays measured 34 cm length · 24 cm width · 4.5 cm height. Pottery dishes were 25 cm in diameter with 5.5 cm height custom-made containers made up of local clay soil. Polyester net bags were autoclavable custom-made similar in size to polyethylene bags with 3 mm in diameter holes. All the four substrates were filled in their respective containers with shredded office paper, covered by sterilized polyethylene bags as above and partially pasteurized at 80 C for 3 h. After cooling at room temperature, 1 kg of each of the substrates were inoculated with P. columbinus grain spawn at the rate of 5% per container type and incubated for 2 weeks at 22 C and ambient relative humidity at total darkness in a well ventilated room. The covering bags were opened and removed when the mycelium had colonized the substrate to allow for fruiting to take place. The spawn run and cropping were performed as previously described. Groof colonization Groof was obtained either as a fresh material from local farmers or after the distillation process as a waste normally employed to produce Luqah water. Groof spathes were cut into small pieces (5–6 cm long · 2–3 cm wide). The by-products were soaked in fresh water for 2 h after air-drying. Excess water was allowed to drain off for 5 h. One kilogram of each substrate was placed in plastic trays, covered with two layers of aluminium foil and autoclaved for 45 min at 121 C and 15 psi. After overnight cooling at room temperature, the substrate was inoculated with 2% inoculum of P. sajor-caju by a multilayered spawning method. The trays were kept in the dark at room temperature (20 C ) for 2 weeks. Later, aluminium foil were removed, exposing the surface area

oven at 105 C for 24 h. Later, fruiting bodies were powdered and analysed for organic constituents. Total nitrogen content was determined by near infrared spectroscopy (Foss, Denmark). The factor 6.25 was used to calculate the crude protein. Total carbohydrates were estimated by the anthrone reaction. Three replicates were maintained for each treatment.

Results Lignocellulosic residue colonization and yield All the three Pleurotus spp. colonized the different substrates within a period of 3 weeks of spawn run. The compact mass of whitish and cottony growth was formed due to complete impregnation of mycelium into the substrate. Mycelial ramification was comparatively more condensed and vigorous in substrates colonized by P. columbinus followed by P. ostreatus compared to P. sajor-caju. Moreover, paper and cardboard were heavily colonized in a short time as indicated by their incubation time (Table 1), followed by fibre whereas hyphal growth on sawdust was quite slow and less profuse than other substrates. The first pin heads (primordia) started appearing in all substrates within about 4–5 days after exposing the polyethylene bags to the atmosphere. The first flush (mature fruiting bodies) was harvest on cardboard 18 days after incubation, and 20 days on paper and fibre, whereas for sawdust it was not matured before 35 days. Consequent flushes were usually intervened by 6–7 days, except for sawdust was about 10 days. The cardboard cultivated by P. sajorcaju and sawdust by P. ostreatus encountered the lowest number of flushes (Table 1). Overall, sporophores produced on sawdust substrate were small, irregularly distributed on bags and of inferior quality and low yield per bag compared to the other substrates. The average yield (g) and biological efficiency (%) of P. columbinus, P. ostreatus and P. sajor-caju cultivated under controlled condition on various lignocellulosic residues using the polyethylene bag method is presented in Table 1. The cultivation was continued for about

604

Q.A. Mandeel et al.

Table 1. Comparative yield analysis of Pleurotus spp. on various lignocellulosic substrates. Pleurotus spp.

Substrate

Mushroom yield Incubation time (weeks)

No. of flushing

Biologicala Efficiency (%)

Harvestbyeild (g)

P. columbinus

Paper Cardboard fibre Sawdust ANOVA F ratio

2 2 3 4

6 5 5 3

± ± ± ±

0.577 1.154 1.527 0.5773

100.8 134.5 87.7 66.4

± ± ± ±

12.982 10.793 15.253 4.791

339.6 ± 453.4 ± 295.4 ± 223.8 ± 18.085*

43.750a 36.372b 51.393c 16.145ac

P. sajor-caju


2 2 3 4

3 2 3 3

± ± ± ±

0.5773 0.000 1.1547 1.1547

47.0 77.9 78.4 47.2

± ± ± ±

6.549 13.509 8.058 12.253

158.4 ± 262.7 ± 264.1 ± 158.9 ± 4.274*

22.073a 12.924b 27.157a 41.291b

P. ostreatus


2 2 3 4

5 6 4 2

± ± ± ±

1.1647 1.000 0.5773 0.000

112.4 117.5 95.3 59.6

± ± ± ±

8.680 7.485 8.365 10.930

378.8 ± 29.269a 395.9 ± 25.225a 321 ± 28.1901b 200.7 ± 36.835c 25.666*

a

Dry weight (g) of the substrate is 337 g. Means in column followed by the same superscripts are not statistically different at P< 0.05 according to Duncan’s multiple range test. * Statistically significant at P< 0.05. b

53–55 days, during which an average of 4–5 crops were harvested. The maximum average yield of fruit bodies (>50%) was obtained in the first two flushes on all the substrates used under experimental conditions. Among the four substrates tested, maximum biological efficiency of 134.5% was obtained on cardboard cultivated by P. columbinus per bag of »1000±12 g wet substrate in a total of five flushes with an average yield of 90.6 g per flush. Consequently, a BE of 117.5% was yielded by P. ostreatus growing on cardboard in six harvests but with much lower average of 66 g per flush. Shredded office paper and plant fibres inoculated with P. ostreatus resulted in 112.4 and 95.3% BE in five and four sporophore harvest, respectively. Nonetheless, similar substrates colonized by P. columbinus had a BE of 100.8 and 87.7% in six and five harvest, in that order. The average BE of sawdust among all the oyster fungi evaluated was only 57.7%. Comparatively, P. sajor-caju attained a lower BE than the other fungi and ranged from as low as 47% in office paper to as high as 78% in plant fibres. The data clearly reveal that incubation time is inversely correlated while harvest numbers are proportionally correlated with biological efficiency. Effect of bagging system The effect of four bagging systems on growth and yield of P. columbinus on partially sterilized shredded paper substrate at 5% spawning rate is presented in Table 2. The oyster mushroom P. columbinus was chosen on the basis of its fast growth rate, short incubation time and BE on paper. Harvest yield and BE of mushroom production varied in different container type 2 weeks after removal of the polyethylene bags. Shredded office papers placed in polyethylene bags attained the highest

Table 2. Effect of bagging P. columbinus on paper. Container type

system

yield

production

by

Mushroom yield Incubation No. of time flushing (weeks)

Polyethylene bags Plastic trays Pottery trays Polyster net bags ANOVA F ratio

on

Biologicala efficiency (%)

Harvestb yield (g) 145 ± 13.099a

2

4 ± 2.081 109.4 ± 9.963

2

3 ± 1.527 71.9 ± 26.245 95.3 ± 34.77b

2

3 ± 0.577 86.1 ± 27.714 114 ± 36.726c

2

3 ± 1.527 56.1 ± 38.095 74.4 ± 50.500d 134.878*

a

Dry weight (g) of the substrate is 132.5 g. Means in column followed by the same superscripts are not statistically different at P< 0.05 according to Duncan’s multiple range test. * Statistically significant at P< 0.05.

b

BE of 109.4% in four harvests with a total of 145 g fresh edible biomass of mushroom. BE of the remaining systems had only three cropping and can be arranged in the magnitude of order into pottery, plastic and polyester net bags with 86.1, 71.9 and 56.1%, respectively. Moreover, bagging in polyethylene bags was superior than others in term of sporophore quality, total yield of mushrooms per bag and reduced contamination level. Protein and carbohydrates content Protein and carbohydrate contents of mature sporophores of three Pleurotus spp. cultivated on different lignocellulosic substrates are shown in Table 3. P. sajor-

Cultivation of Pleurotus spp. on waste

605

Table 3. Chemical contents of fruiting bodies of Pleurotus spp. cultivated on various lignocellulosic substrates. Pleurotus spp.

Substrate

Moisture content (%)

Chemical contentb Crude Protein (%)

Total Carbohydrate (%)

P. columbinus

Paper Cardboard Fibre Sawdust ANOVA F ratio

88.1 91.2 90.2 89.5

± ± ± ±

0.984 0.814 1.000 1.135

21.13 ± 15.70 ± 23.71 ± 19.46 ± 3.773Ns

0.550 0.424 2.920 2.311

42.5 ± 2.471a 39.0 ± 1.896a 31.5 ± 1.661b 28.5 ± 2.150b 29.834*

P. sajor-caju


86.3 89.7 89.4 88.8

± ± ± ±

2.891 1.571 1.386 2.302

23.30 ± 27.80 ± 29.40 ± 18.03 ± 19.469*

3.421a 0.702b 0.556b 1.890c

29.5 ± 2.541a 36.0 ± 3.372b 27.5 ± 1.472ac 23.5 ± 1.549c 14.452*

P. ostreatus


86.6 89.8 87.9 87.9

± ± ± ±

2.302 1.167 1.607 0.529

22.13 ± 0.907 24.36 ± 3.555 20.90 ± 2.961 NDa 1.250Ns

47.0 ± 1.755a 40.5 ± 2.726b 36.0 ± 0.475c 32.5 ± 0.756d 41.885*

a

ND is not determined. Means in each column followed by the same superscripts are not statistically different at P< 0.05 according to Duncan’s multiple range test. * Statistically significant at P< 0.05.; Ns, not significant. b

caju fruiting bodies produced on plant fibre possessed the highest protein content of 29.4% on a dry weight basis followed by cardboard with 27.8%. The average protein content of P. ostreatus is 21.3% with sporophores grown on cardboard being the highest (24.36%). Crude protein content of P. columbinus varied from 23.7% in sporophores cultivated on plant fibre to 19.46% in sawdust. Sawdust had always the lowest protein content among all byproducts. The highest total carbohydrates were obtained on paper by P. ostreatus (47%) followed by P. columbinus (42.5%). Cardboard followed by plant fibre also yielded appreciable level of carbohydrates compared to sawdust. P. sajor-caju fruiting bodies produced on different substrates generally were less in carbohydrates content than other species. Groof colonization When P. sajor-caju was spawn in sterile Groof and kept in dark at room temperature, a normal white fluffy hyphal mat was observed. The hyphal filaments extensively colonized the stalk surface and filled the space between the Groof stalks. At the end of this period (12– 15 days), the entire surface was covered with the mycelial mat, and the trays were exposed to a 12 h photoperiod of white fluorescent light. Development of first fruit bodies (sporophores) was detected after 8 days. The fruiting bodies attained maximum size of about 7 cm in diameter and new harvests continued to appear for a period of about 12 days. Effect of the addition of NH4Cl

hyphal growth was greatly reduced compared with the former. More growth inhibition was observed in substrate containing 2.65 g/kg Groof. The latter was also characterized by weak hyphal mat after almost 30 days of incubation. Furthermore, when trays were exposed to light, the first pin heads of sporophores appeared after 4 days which became fully matured within 10 days in control treatments. However, in substrates containing 0.265 g/kg Groof, the fruiting bodies started to appear after 19 days of exposure to light and the number of sporophores were considerably less. No fruiting bodies appeared on substrates containing 2.65 g/kg Groof after 20 days. The mycelial mat started to collapse within this period. No difference in hyphal growth was observed between fresh or waste Groof byproduct.

Discussion Commercial production of oyster mushrooms is largely determined by the availability and utilization of cheap materials of which agricultural lignocellulosic wastes represents the ideal and most promising substrates for cultivation. The by-products used in this study can be considered practical and economically feasible due to their availability throughout the year at little or no cost in large quantities. Office paper and cardboard are currently exported for recycling into low quality products, while sawdust is used as floor bedding in poultry houses. Utilization of these by-products for the production of oyster mushrooms could be more economically and ecologically practical. Groof colonization

Hyphal growth was normal and appeared earlier in culture containing no NH4Cl as a nitrogen source. In culture incorporating 0.265 g/kg Groof, the rate of

The chemical composition of Groof is not yet known. However, it is expected to show some similarity with

606 most agriculture wastes, and hence Groof may present a potential substrate for the cultivation of P. sajor-caju and other species. Our preliminary studies revealed that chopped Groof pieces can be efficiently colonized by these fungi. During the incubation period, mycelial growth proceeded normally and upon exposure to the atmosphere, produced normal sporophores within the anticipated period of time. However, the maximal size attained was within the lower range of the expected diameter reported by other investigators (between 5 and 15 cm) (Ahmed 1994). Allowing the sporophores to grow for longer duration did not improve the situation. With regard to the effect of NH4Cl addition, it was clear that NH4Cl had an inhibitory effect on early hyphal colonization of the Groof. Increasing the concentration of the NH4Cl to 0.265 g/kg resulted in remarkable decrease in the rate of hyphal growth (19 days compare to 4 days with control). Further increase in NH4Cl to 2.65 g/kg have led to poor mycelium ramification accompanied by an absolute sporophore repression. Substrate supplementation with an external source of nitrogen is recommended for enhancing the oyster mushroom yield of Pleurotus spp. (Azizi et al. 1990). According to Kurtzman (1994) Pleurotus spp. have a very low requirement for nitrogen in its initial substrate colonization. Ammonia and nitrates are toxic to sporophores developments and contribute to low yield. The acceptable nitrogen is, however, always present in a bound form. Thus, it may be useful if carbon sources are added to the substrates on which Pleurotus spp. grow without the addition of nitrogen. Singh (1998) reported that supplementation of straw bed with extra nitrogen sources while spawning did not have any favourable effect on growth and in some cases led to contamination. Thus, mushroom beds were supplemented with nitrogen source after the spawn run. Sharma & Madan (1993) found that nitrogen-fixing substrates (leguminous) were superior to non-leguminous in both yield performance and sporophore quality. Lignocellulosic residue colonization and yield Comparing the four lignocellulosic residues as substrates for the cultivation of Pleurotus spp. Shows that shredded cardboard pieces and office paper supported best growth of P. columbinus and P. ostreatus as evidenced by complete and heavy colonization of substrates forming a compact white mass of mycelium within 2 weeks of inoculation. Furthermore, the quantity of fresh edible sporophore (g/bag) harvest was higher in cardboard and paper than plant fibre and sawdust. The performance of the two substrates was also evident by their elevated biological efficiency values with 134.5% BE on cardboard by P. columbinus and 117.5% by P. ostreatus whereas on paper the BE was 112.4% by the latter fungus in 53–55 days of mushroom cropping (Table 1). The time required for sporophore harvest on cardboard always preceded paper by 2 days and the intervals between the appearance of flushes after

Q.A. Mandeel et al. the first harvest is relatively short. The finding that P. columbinus and P. ostreatus are better than P. sajor-caju are consistent with those reported by Cangy & Peerally (1995) while comparing the growth rate and yield of different Pleurotus spp. on sugar-cane bagasse. They also showed that exposing P. columbinus, in particular, toa cool temperature regime resulted in higher average (23.9%) yield compared to P. sajor-caju (18.37%). P. ostreatus and P. columbinus require a low temperature (18–20 C) as compared to P. sajor-caju (23–25 C). The overall low yield of P. sajor-caju could be attributed to the slightly low temperature (21–22 C) during the spawning period. According to Zadrazil (1982), P. sajorcaju converts maximally 25% of the organic matter lost into fruit bodies. P. ostreatus and P. columbinus produces relatively higher economical yield of coefficient (yield of fruit bodies/loss of organic matter) than that of P. sajor-caju (Sharma & Madan 1993). Reports on cultivation of the oyster mushroom on similar by-products have manifested variable levels of BE. These variations are mainly related to spawn rate, fungal species used and supplement added to the substrate. Remtulla (1993), for example, compared various lignocellulosic residues such as wheat straw, mixed paper, newsprint, pulp sludge and wood chips for cultivation of P. sajor-caju and concluded that the latter resulted in 34% BE. Patil & Jadhav (1991) reported fresh mushroom yield of 583 g per kg dry weight of coconut. Some of the elevated BE of Pleurotus spp. on commonly used substrates varied from 58.9% in coconut palm leafstalk (Thomas et al. 1998), sugarcane residue 71.5% (Singh 1998), sugarcane bagasse 146.7% (Soto-Velazco & Alvarez 1995), rice straw 85.5% (Mehta et al. 1990), leguminous plants 103.8% (Sharma & Madan 1993) and shiitake spent 79% (Royse 1992). Our trial indicates that the bagging system has an effect on the yield as well as on the quality and number of the harvest (Table 2). Bagging in polyethylene bags resulted in a maximal yield of 145 g per kg on wet substrate basis with four flushes during a cropping period of 30–34 days after removal of polyethylene bags followed by 95.3 g using plastic trays with only three flushes. Polyethylene bags retained higher water in the substrate, the contamination level was contained and sporophore quality were superior, due to the full expansion of the pileus. Pleurotus spp. are known to produce a wide range of hydrolytic and oxidative enzymes that enable them to successfully colonize, degrade and bioconvert many lignocellulosic substrates (Bano et al. 1993; Bajpai 1997). Such degradation of lignocellulosic materials results from the concerted and synergistic action of many enzymes: endoglucanases, exoglucanases, laminarinases, b-glucosidases, xylanases, laccases and polyphenol oxidases (Saxena & Rai 1992; Buswell et al. 1996). Analysis of mushroom sporophores for protein and carbohydrate content varied with the lignocellulosic residue used (Table 3). Data, in general, revealed that P. sajor-caju contain higher protein contents than

Cultivation of Pleurotus spp. on waste P. columbinus and P. ostreatus, especially on plant fibres and cardboard. These findings are consistent with studies reported elsewhere (Remtulla 1993; Sharma & Madan 1993), but on different substrates. Sharma & Madan (1993) compared the protein contents of various lignocellulosic residues and concluded that the nitrogen content in fruit bodies was higher in leguminous plant substrates than non-leguminous ones. The protein content usually ranges between 30–40% on a dry weight basis. Substrates rich in usable nitrogen after spawn run may be a factor in enhancing the mushroom yield and quality, in addition to the mushroom species in bioconversion and bioaccumulation efficiency. In this study, the addition of fresh supplement of chicken manure could, in part, accounted for the protein content. In conclusion, the results presented in this preliminary study confirm the previous findings that P. columbinus and P. ostreatus are superior oyster mushrooms to P. sajor-caju as evidenced by their growth characteristics and biological efficiency. Cultivation on shredded office paper and cardboard by these fungi yielded more edible sporophore biomass than other lignocellulosic residues. Also, bagging of shredded office paper colonized by P. columbinus in polyethylene bags resulted in a maximum of 109.4% BE compare to other container systems. Further work is in progress to improve growing conditions of spawning and increase the yield of P. columbinus on more feasible and cheap recyclable residue. Acknowledgement The authors are grateful to Deanship of Scientific Research, University of Bahrain for funding the project. The authors would also like to thank Dr. Hashim AlSayed for his help in statistical analysis.

References Ahmed, M.A. 1994 Cultivation of Oyster Mushroom, 1st ed. Cairo, Egypt, Comet Co., 63 Azizi, K.A., Shamala, T.R. & Sreekantiah, K.R. 1990 Cultivation of Pleurotus sajor-caju on certain agro-industrial wastes and utilization of the residues for cellulose and D -xylanase production. Mushroom Journal for the Tropics 10, 21–26. Bajpai, P. 1997 Microbial xylanolytic enzyme system: properties and applications. Advances in Applied Microbiology 43, 141–194. Bano, Z., Shasirekha, M.N. & Rajarathnam, S. 1993 Improvement of the bioconversion and biotransformation efficiencies of the oyster mushroom (Pleurotus sajor-caju) by supplementation of its rice straw with oil seed cakes. Enzyme and Microbial Technology 15, 985–989. Bobek, P., Ozdin, O. & Mikus, M. 1995 Dietary oyster mushroom (Pleurotus ostreatus) accelerates plasma cholesterol turnover in hypercholesterolaemic rats. Physiological Research 44, 287–291.

607 Bobek, P., Ozdin, L. & Galbavy, S. 1998 Dose- and time-dependent hypercholesterolaemic effect of oyster mushroom (Pleurotus ostreatus) in rats. Nutrition 14, 282–286. Buswell, J.A., Cai, Y.J., Chang, S.T., Peberdy, J.F., Fu, S.Y & Yu, H.S. 1996 Lignocellulolytic enzyme profiles of edible mushroom fungi. World Journal of Microbiology and Biotechnology 12, 537–542. Cangy, C. & Peerally, A. 1995 Studies of Pleurotus production on sugarcane bagasse. African Journal of Mycology and Biotechnology 3, 67–79. Cohen, R., Persky, L. & Hadar, Y. 2002 Biotechnological applications and potential of wood degrading mushrooms of the genus Pleurotus. Applied Microbiology and Biotechnology 58, 582–594. Hossain, S., Hashimoto, M., Choudhury, E., Alam, N., Hussain, S., Hasan, M., Choudhury, S. & Mahmud, I. 2003 Dietary mushroom (Pleurotus ostreatus) ameliorates atherogenic lipid in hypercholesterolaemic rats. Clinical and Experimental Pharmacology and Physiology 30, 470. Kurtzman, Jr. R.A. 1994 Nutritional needs of mushrooms and substrates. In Advances in Mushroom Biotechnology, eds. Nair, M.C., Gopalapalan, G. & Lulu, D. pp. 106–110. Jodhpur, India: Scientific Publishers. ISBN 8172330804. Mehta, V., Gupta, J.K. & Kaushal, S.C. 1990 Cultivation of Pleurotus florida mushroom on rice straw and biogas production from the spent straw. World Journal of Microbiology and Biotechnology 6, 366–370. Patil, B.D. & Jadhav, S.W. 1991 Yield performance of Pleurotus sajorcaju on various substrates. In Indian Mushrooms. Proceedings of National Symposium on Mushrooms. pp. 84–86. Thiruvanathapuram, India: Kerala Agricultural University. Quimio, T.H., Chang, S.T. & Royse, D.J. 1990 Technical guidelines for mushroom growing in the tropics. F.A.O. Plant production and Protection 106, 62–70. Remtulla, A. 1993 Utilization of lignocellulosic residues for the cultivation of Pleurotus sajor-caju. McIlvainea 11, 40–43. Royse, D.J. 1992 Recycling of spent shiitake substrate for production of the oyster mushroom Pleurotus sajor-caju. Applied Microbiology and Biotechnology 38, 179–182. Sanchez, A., Ysunza, F., Beltran-Gracia, M. & Esqueda, M. 2002 Biodegradation of viticulture wastes by Pleurotus: a source of microbial and human food and its potential use in animal feeding. Journal of Agricultural and Food Chemistry 50, 2537–2542. Saxena, S. & Rai, R.D. 1992 Effect of nitrogen on production of extracellular degradative enzymes by Pleurotus sajor-caju (Fr.) Singer on wheat straw. Mushroom Research 1, 45–48. Sharma, S. & Madan, M. 1993 Microbial protein from leguminous and non-leguminous substrates. Acta Biotechnologica 13, 131–139. Singh, A.K. 1998 Cultivation of oyster mushroom (Pleurotus spp.) on sugarcane residues. Journal of Mycology and Plant Pathology 28, 24–245. Soto-Velazco, C. & Alvarez, I. 1995 Fruit body production of Pleurotus spp. on sugarcane bagasse after treatment with sodium hydroxide. African Journal of Mycology and Biotechnology 3, 61–66. Thomas, G.V., Prabhu, S.R., Reeny, M.Z. & Bopaiah, B.M. 1998 Evaluation of lignocellulosic biomass from coconut palm as substrate for cultivation of Pleurotus sajor-caju (Fr.) Singer. World Journal of Microbiology and Biotechnology 14, 879–882. Zadrazil, F. & Kurtzman, Jr. R.H. 1982 The biology of Pleurotus cultivation in the tropics. In Tropical Mushrooms, Biology, Nature and Cultivation Methods, ed. Chang, S.T. & Quimio, T.H. pp. 277–298. Hong Kong: The Chinese University Press. ISBN 9622012647.

Springer 2005


Production of tannase by Aspergillus niger HA37 growing on tannic acid and Olive Mill Waste Waters H. Aissam1, F. Errachidi1, M.J. Penninckx2,*, M. Merzouki1 and M. Benlemlih1 1 Universite´ Sidi Mohamed Ben Abdellah, Laboratoire de Microbiologie de l’Environnement, Faculte´ des Sciences Dhar El Mehraz B.P : 1796 Atlas-Fe`s, Maroc 2 Universite´ Libre de Bruxelles, Laboratoire de Physiologie et Ecologie Microbienne, Ecole Interfacultaire de Bioingeńieurs, c/o Institut Pasteur 642, Rue Engeland B-1180 Bruxelles, Belgium *Author for correspondence: Tel.: 32-2-3733303, Fax: 32-2-3733309, E-mail: [email protected] Keywords: Aspergillus niger, Olive Mill Waste Waters, tannase, tannic acid

Summary Production of tannase (tannin acyl hydrolase, EC 3.1.1.20) by Aspergillus niger HA37 on a synthetic culture medium containing tannic acid at different concentrations has been studied. Maximal enzymatic activity increased according to the initial concentration of tannic acid; respectively 0.6, 0.9 and 1.5 enzyme activity units (EU) ml)1 medium in the presence of 0.2%, 0.5% and 1% of tannic acid. Tannase production by A. niger HA37 on fourfold diluted olive mill waste waters (OMWW) as substrate, was between 0.37 and 0.65 EU ml)1. Enzyme production on the diluted OMWW remained globally stable during more than 30 h. Growth of A. niger HA37 on OMWW was correlated with about 70% degradation of phenolic compounds present in the waste. This strain has therefore the capacity to degrade complex wastewaters which cause environmental damage to aquatic streams.

Introduction Olive Mill Waste Water (OMWW) is a major waste produced around the Mediterranean basin. OMWW contains a large amount of hydrolysable tannins that can be degraded by tannase (tannin acyl hydrolase, EC 3.1.1.20), an extracellular enzyme produced by bacteria and fungi (Lane et al. 1997; Osawa et al. 2000; Mondal et al. 2001b; Bhardwaj et al. 2003; Nishitani et al. 2004; Saxena & Saxena 2004). This enzyme catalyses the hydrolysis of the ester link of the hydrolysable tannins (Lekha & Lonsane 1997; Kumar et al. 1999). Tannase has found application in various domains, for example as inhibitor of foam in tea and as a clarifying agent in the production of beer and fruits juices (Masschelein & Batum 1981; Cantarelli et al. 1989; Lane et al. 1997; Boadi & Neufeld 2001). It also plays an important role in the pharmaceutical industry, especially in the manufacture of Trimethoprim, an antibiotic derived from gallic acid (Bajpai & Patil 1997). This enzyme was also proposed for use in environmental biotechnology, as for example in the treatment of the tannery effluents (Suseela & Nandy 1985). Several micro-organisms are potential sources of tannase (Bajpai & Patil 1997; Bradoo et al. 1997; Sharma et al. 1999; Mondal et al. 2001b; Bhardwaj et al. 2003; Mukherjee & Banerjee 2004). Nevertheless in consideration owing to obvious industrial potentialities

presented by this enzyme, in particular in remediation of environmental pollution, a search for new competent micro-organisms for production of tannase, capable of challenging drastic industrial conditions, is important (Ramirez-Coronel et al. 2003; Yu et al. 2004). Tannins can be classified into two categories: hydrolysable and non-hydrolysable (condensed). Tannic acid is an important gallotannin belonging to the hydrolysable class and consist of esters of gallic acid and a polyol, usually glucose (Spencer et al. 1988; Kumar et al. 1999; Mondal et al. 2000). The strain Aspergillus niger HA37 was previously isolated from OMWW, a substrate containing an important amount of hydrolysable tannins acting as inducers for tannase production (Aissam et al. 2002). The present paper report on a study of the physiological parameters of tannase production and OMWW degradation by this strain. We conclude that A. niger HA37 has the faculty to degrade complex wastewaters which cause environmental damage to aquatic streams. Materials and methods Strain and culture conditions Aspergillus niger HA37, isolated at the OMWW evaporation pond in Fez city (Morocco), was used in the present study (Aissam et al. 2002). The strain was

610 maintained on malt extract agar slants, stored at 4 C and subcultured every month. Erlenmeyer flasks of 250 ml, containing 50 ml of the basal AT medium (0.065% K2HPO4, 0.35% (NH4)2SO4 (w/v)) were sterilized by autoclaving at 120 C for 20 min. Tannic acid (Gallotannin: Farco Chemical Supplies) sterilized by filtration was added aseptically to the flasks at respective concentrations of 0.2%, 0.5% and 1% (w/v). The AT medium solidified by 2% (w/v) of agar, and supplemented with 1% (w/v) of tannic acid (ATA medium), was used for cultivation on Petri dishes. For growing on OMWW, 50 ml of fourfold water diluted OMWW (v/v) was supplemented with 0.065% of K2HPO4 and 0.35% of (NH4)2SO4 in Erlenmeyer’s flasks of 250 ml. The flasks were sterilized by autoclaving at 120C during 20 min. The OMWW produced by an industrial mill unit situated in the city of Fez was sampled during the 2001– 2002 olive milling campaign. The main characteristics of the OMWW used in this study were pH 5.0 ± 0.2 ; COD 82 ± 5 g l)1; phenolic content 3.2 ± 0.3 g l)1; suspended solids 2.8 ± 0.3 g l)1; total solids )1 20 ± 3.2 g l and volatile solids 18 ± 2.5 g l)1 (Aissam et al. 2002). Aspergillus niger HA37 was first cultivated at 30 C for 7 days on the solid ATA medium in order to induce sporulation. Fresh conidiospores were inoculated in each Erlenmeyer flask to attain a final concentration of 107 conidiospores · ml)1 (numbered with a Thoma cell). The liquid culture media were incubated at 30 C on a rotary shaker (120 rev min)1). One millilitre of supernatant samples were withdrawn at intervals of 3 h and were used for the estimation of tannase and phenolic compounds. COD evolution of the medium of was measured out according to Knechtel (1978). The growth rate of the strain A. niger HA37 was estimated by the measure of CO2 liberated from the culture medium according to the gravimetric method of Pochon & Tardieux (1962). Tannic acid and phenolic compounds Tannic acid and phenolic compounds were measured according to Maestro-Duran et al. (1991). Biomass estimation Biomass produced during cultivation of A. niger HA37 on the OMWW media was estimated by filtration of the culture medium on glass microfibres (GF/A Whatman, Inc.). The retained biomass was washed twice with 5 ml distilled water and dried overnight at 105 C. Growth yield was expressed as gram of dry weight per litre of culture. Estimation of tannase activity Tannase was estimated by the spectrophotometric assay of Bajpai & Patil (1996). One unit of enzyme activity

H. Aissam et al. (EU) was defined as the amount of enzyme catalysing the hydrolysis of 1 lmol tannic acid per minute. The results are expressed in EU ml)1. Chromatographic separation of phenolic compounds Gel filtration Sephadex G-50 was used to analyse the phenolic compounds present in treated and untreated OMWW. A volume of 200 ml of Sephadex G-50 gel was placed in a quartz column (2.5 · 50 cm). After stabilization and equilibration with the buffer (NaOH 0.05 M, LiCl 0.025 M) 1 ml of the sample was layered on the top of the column and eluted at 0.6 ml min)1 by fraction of 3 ml. The optical density of these fractions was monitored at k 280 nm. Chemicals Suppliers of chemicals and materials used in the present study are identified in the text. All other items were of highest purity grade. Data presentation All the experiments were performed in triplicate. Data are presented as means ± SEM (n ¼ 3). Results and discussion Tannase production by A. niger HA37 on tannic acid as carbon and energy source A previous study of the growth pattern of 11 microbial strains isolated from OMWW revealed the efficiency of A. niger HA37 for tannic acid degradation (Aissam et al. 2002). Before considering OMWW as a substrate we first used a defined medium containing tannic acid as single carbon and energy source to delimit the basic physiological parameters of growth and enzyme production by A. niger HA37. This strain can apparently assimilate tannic acid at least up to 1% initial concentration in the growth medium (Figure 1a). Higher concentrations may cause growth inhibition of A. niger HA37 (not shown). Gallotannin tolerance limits for A. niger, Aspergillus fischerii, Fusarium solani and Trichoderma viride, determined by progressively increasing the substrate concentration, were found to be around 20%, 4%, 3% and 3% respectively (Bajpai & Patil 1997). As far as we know the mechanism of toxicity of tannins against fungal strains is not at this time resolved. Yet, tannins were reported as antimicrobial agents that may induce membrane damage, complexation with extracellular enzymes and/or metals ions, in particular iron (Scalbert 1991; Chung et al. 1998). The extracellular tannase activity peaked during the 20 h latency phase (Figure 1b). This phase included an initial 6–9 h period required for spores germination, as observed by optical microscopy (not illustrated), and

Tannase from A. niger growing on wastewater

611

(a) 12

5 4.5 4

-1

3.5 -1

8

3 6

2.5 2

4

CO2 (g l )

Tannic acid (gl )

10

1.5 1

2

0.5 0

0 0

3

6

9

12 15 18 21 24 27 30 33 36 39 41 44 47

Time (hours)

(b)

1.6

-1

Tannase (UE ml )

1.4 1.2 1 0.8 0.6 0.4 0.2 0 0

6

12

18

24

30

36

42

48

54

Time (hours)

Figure 1. Growth pattern and tannase production by A. niger HA37 at different initial concentrations of tannic acid. (a) Variation of phenolic content expressed in term of tannic acid (TA) concentration [ (n) 0.2% TA; (d) 0.5% TA; (m) 1% initial TA concentration], and of CO2 liberated during growth [(h) 0.2% TA; () 0.5% TA; (n) 1% TA] . (b): Tannase activity excreted by A. niger HA37 [(n) 0.2% TA; (d) 0.5% TA; (m) 1% TA].

1

0.8

0.7

0.7

0.6

0.6

0.5

0.5

0.4

0.4

0.3

0.3

0.2

0.2

0.1

0.1

0

-1

0.9

0.8

Tannase (U ml )

-1

Phenolic compounds (g l )

1 0.9

0 0

9

18

27

36

45

54

63

72

81

90

Time (hours)

Figure 2. Variation of phenolic compounds (PC) content and tannase activity produced by A. niger HA37 growing on OMWW [(d) PC control in the absence of the strain; (m) PC treated; (n) tannase].

was completed at the onset of growth (Figure 1a). A similar result was obtained by Suseela & Nandy (1985) with Penicillium chrysogenum. No detectable carbon dioxide was released by A. niger HA37 within the latency phase (Figure 1a). Therefore, the strain was apparently not actively growing during that interval but produced tannase. Yet, although RNA and protein synthesis are active during the latency phase, the titration or the gravimetric procedures used here to estimate respiratory CO2 are not sufficiently sensitive to

measure any metabolic activity during this period (Sussman & Douthit 1973). In fine, a germination step most probably associated with tannase biosynthesis appears to prevail for A. niger HA37. Different mechanisms of tannase production depending on strain may however be operative. For example, Bacillus cereus a tannase-producing soil bacterium produced maximal enzyme activity during the stationary phase of growth (Mondal et al. 2001a). Moreover, Aspergillus aculeatus and Bacillus licheniformis also showed maximal tannase production during the exponential phase (Mondal et al. 2000; Banerjee et al. 2001). The mechanism of regulation of microbial tannase production is currently not deciphered although the inducing effects of the gallic acid fraction of tannic acid (or a derivative) have been suggested (Bajpai & Patil 1997). Production of tannase increased with the initial concentration of the tannic acid (Figure 1b); maximal enzyme activities attaining 0.6, 0.9 and 1.5 EU ml)1 in the culture medium containing, respectively, 0.2%, 0.5% and 1% tannic acid. This suggest that the concentration of the inducing fraction derived from tannic acid (possibly gallic acid or a derivative) increased according the initial concentration of the substrate. A similar result has been observed with Aspergillus japonicus where also strong end-product inhibition of tannase with gallic acid was shown (Bradoo et al. 1997). In AT medium containing 0.2% tannic acid, tannase activity peaked after 9 h of incubation, whereas maximal level was observed after 12 h in the AT culture media containing, respectively, 0.5% and 1% of tannic acid (Figure 1b). Afterwards, the enzyme activity declined gradually. This could be due to a combined effect of catabolite repression and enzyme inactivation or, enzyme inactivation alone. Catabolite repression of tannase production, associated with the release of glucose in the culture medium, has been suggested for Penicillium chrysogenum (Suseela & Nandy 1985). On the other hand, kinetic results indicated that low tannase activity titres in submerged cultures of Aspergillus niger Aa-20 could be associated with an enzyme degradation process, possibly mediated by proteolytic action (Aguilar et al. 2001). Regulation of enzyme level by proteolysis has been reported as a widespread mechanism among fungi, as for example for lignin peroxidase in the white-rot fungus Phanerochaete chrysosporium (Dass et al. 1995). Although tannase production peaked at about 9–12 h (Figure 1b), tannic acid was apparently not utilized for about 20 h (Figure 1a). The procedure used for estimating tannic acid however quantifies only the total phenolic content, including free gallic acid and also gallic acid engaged in ester bonds with the polyol fraction of gallotannin. Therefore a plausible scenario would be that most of tannic acid was hydrolysed into its constituents during the latency phase and that gallic acid consumption started at the onset of growth. This was supported by a gel chromatography experiment as reported in Figure 3.

612

H. Aissam et al. 0.6

Absorbance (280 nm)

0.5 0.4 0.3 0.2 0.1 0 0

6

12

18

24

30

36

42

48

54

60

Fraction

Figure 3. Profile of elution of phenolic compounds of OMWW before (m) and after (n) treatment by A. niger HA37. [(m) control; (n) treated].

Oxidases, in particular laccase for which gallic acid is a substrate (Faure et al. 1995), might be involved in the metabolism of this aromatic. It is noteworthy to mention that several fungal species including Aspergillus strains are able to produce laccase (Bajpai & Patil 1996, 1997; Scherer & Fischer 1998; Kiiskinen et al. 2004). On the other hand there are evidences that tannic acid is able to induce laccase activity in some basidiomycetes fungi (Carbajo et al. 2002), where a role for oxidative ligninolytic enzymes in the degradation of phenolic fraction of OMWW was proposed (Sayadi & Ellouz 1995; Jaouani et al. 2003). Confirmation of the presence of laccase in A. niger HA37 still awaits further investigation. A weak, but significant laccase activity, was however recently detected in ion-exchange chromatographic fractions of a culture supernatant of the strain growing on tannic acid (Aissam et al. unpublished). Biomass produced by A. niger HA37 after 48 h of cultivation was around 0.9 ± 0.07, 2 ± 0.2, and 3.3 ± 0.3 g l)1 dry weight for respective 0.2%, 0.5% and 1% initial tannic acid concentration. The quantity of biomass produced by A. niger HA37 increased thus proportionally with the initial concentration of tannic acid, at least in this range, as was observed by Bradoo et al. (1997) for Aspergillus japonicus. Tannase production by A. niger HA37 growing on OMWW Figure 2 shows the evolution of the content of phenolic compounds and tannase produced during growth of A. niger HA37 on fourfold-diluted OMWW. Growth and enzyme production on higher concentrations of OMWW corresponding to a twofold or less dilution of the waste was seriously hampered (not shown). Degradation of the phenolic compounds, including tannins, by A. niger HA37 was preceded by a 24 h latency phase corresponding to the time necessary for the germination of spores (Figure 2). After this adaptation phase, the content in phenolic compounds decreased progressively from 0.9 ± 0.07 to 0.26 ± 0.03 g l)1 after 72 h of incubation to remain steady at least until 96 h cultivation. COD reduction was 71 ± 2% during that period

and was accompanied by a biomass production of 5.3 ± 0.05 g l)1 dry weight. Therefore, the concentration of phenolic compounds in fourfold-diluted OMWW did not apparently limit the capacity of spore germination of A. niger HA37. However, as compared to cultures on tannic acid (Figure 1a) the latency phase on OMWW was slightly longer, which could probably be assigned to the complex nature of the OMWW containing different organic compound types (Balice & Cera 1984). Tannase production on OMWW started during the first hour of incubation to culminate around 0.55– 0.65 EU ml)1 between 8 and 28 h of cultivation (Figure 2). The enzyme level decreased subsequently to become non-detectable after 54 h of incubation, nevertheless, the content of phenolic compounds keep on decreasing for more 18 h. This could be explained by the involvement of other complementary enzymes in the degradation process, as discussed above. As compared to the sharp peaks of tannase production on tannic acid (Figure 1b), the enzyme production on OMWW showed a plateau profile for about 20 h (Figure 2). This sustained production of tannase could result from the presence in OMWW of various compounds, all of them putative substrates of the enzyme, and acting as inducers. In contrast, in the AT medium there is only one compound (tannic acid) and this could be the reason of the sharp profile of tannase production (Figure 1b). Taken together, these results suggest that tannins and phenolic compounds present in OMWW induce the production of tannase. A similar conclusion could be probably reached for the induction of the ligninolytic system in Phanerochaete chrysosporium, and other fungal strains, in presence of OMWW (Sayadi et al. 2000; Kissi et al. 2001; Jaouani et al. 2003). As another consequence it can be reasonably assumed that A. niger HA37 tannase is concerned with the process of degradation of phenolic compounds present in OMWW. The maximal tannase activity of 0.65 EU ml)1, obtained on fourfold-diluted OMWW was comparable to the value of 0.6 EU ml)1 found in the artificial medium containing 0.2% of tannic acid (Figures 1b and 2). Assessment of the treatment efficiency by gel chromatography of OMWW Figure 3 show how a treatment with A. niger HA37 may affect the molecular mass distribution of polyphenolic compounds including tannins. Before treatment, a OMWW elution chromatogram showed two main peaks, representing respectively aromatics of more than 30 kDa and less 2 kDa. After 72 h incubation with the strain, the amplitude of the first peak decreased considerably whereas no more than 50% decrease was shown for the low molecular weight (MW) peak. This result is indicative of a depolymerization of high MW aromatics among which gallotannins, followed by

Tannase from A. niger growing on wastewater assimilation of low MW aromatics not entirely consumed at the end of the growth cycle.

Conclusion Aspergillus niger HA37, a strain isolated from OMWW produced tannase on an artificial laboratory medium containing tannic acid as carbon and energy source, but also on OMWW. Most probably, tannase participates in an initial hydrolytic step of tannins, liberating monomeric constituents entering further into the metabolic network of the fungus. Yet, this supposed hydrolytic activity remain to be strictly demonstrated, for example with a purified enzyme preparation. The experiments reported in this paper were conducted on fourfold diluted OMWW. In the perspective of a use in environmental pollution remediation, it would be interesting to select new active strains able to grow on more concentrated OMWW or trying to acclimate existing strains including for example A. niger HA37 to those conditions. Acknowledgements The authors wish to thank the Morocco Government and Walloon Region of Belgium for their support.

References Aguilar, C.N., Augur, C., Favela-Torres, E. & Viniegra-Gonzalez, G. 2001 Production of tannase by Aspergillus niger Aa-20 in submerged and solid-state fermentation: influence of glucose and tannic acid. Journal of Industrial Microbiology and Biotechnology 26, 296–302. Aissam, H., Errachidi, F., Merzouki, M. & Benlemlih, M. 2002 Identification des levures isoleés des margines et e´tude de leur activite´ catalase. Cahiers de l’Association Scientifique Europeénne pour l’Eau et la Sante´ 7, 23–30. Bajpai, B. & Patil, S. 1996 Tannin acyl hydrolase activity of Aspergillus, Penicillium, Fusarium and Trichoderma. World Journal of Microbiology and Biotechnology 12, 217–220. Bajpai, B. & Patil, S. 1997 Induction of tannin acyl hydrolase (EC 3.1.1.20) activity in some members of fungi imperfecti. Enzyme and Microbial Technology 20, 612–614. Balice, V. & Cera, O. 1984 Acidic phenolic fraction of the olive vegetation water determined by a gas chromatography method. Grasas Y Aceites 35, 178–180. Banerjee, D., Mondal, K.C. & Pati, B.R. 2001 Production and characterization of extracellular and intracellular tannase from newly isolated Aspergillus aculeatus DBF9 Journal of Basic Microbiology 41, 313–318. Bhardwaj, R., Singh, B. & Bhat, T.K. 2003 Purification and characterization of tannin acyl hydrolase from Aspergillus niger MTCC 2425. Journal of Basic Microbiology 43, 449–461. Boadi, D.K. & Neufeld, R.J. 2001 Encapsulation of tannase for the hydrolysis of tea tannins. Enzyme and Microbial Technology 28, 590–595. Bradoo, S., Gupta, R. & Saxena, R.K. 1997 Parametric optimization and biochemical regulation of extracellular tannase from Aspergillus Japonicus. Process Biochemistry 32, 135–139.

613 Cantarelli, C., Brenna, O., Giovanelli, G. & Rossi, M. 1989 Beverage stabilization through enzymatic removal of phenolics. Food Biotechnology 3, 203–213. Carbajo, J.M., Junca, H., Terron, M.C., Gonzales, T., Yague, S., Zapico, E. & Gonzales, A.E. 2002 Tannic acid induces transcription of laccase gene cglcc1 in the white rot fungus Coriolopsis gallica. Canadian Journal of Microbiology 48, 1041–1047. Chung, K.T., Wong, T.Y., Wei, C.I., Huang, Y.W. & Lin, Y. 1998 Tannins and human health: a review. CRC Critical Reviews in Food Science and Nutrition 38, 421–464. Dass, S.B., Dosoretz, C.G., Reddy, C.A. & Grethlein, H.E. 1995 Extracellular proteases produced by the wood-degrading fungus Phanerochaete chrysosporium under lignolytic and non-lignolytic conditions. Archives of Microbiology 163, 254–258. Faure, D., Bouillant, M.L. & Bally, R. 1995 Comparative study of substrates and inhibitors of Azospirillum lipoferum and Pyricularia oryzae laccases. Applied and Environmental Microbiology 61, 144– 1146. Jaouani, A., Sayadi, S., Vanthournhout, M. & Penninckx, M.J. 2003 Potent fungi for decolourisation of olive mill wastewaters. Enzyme and Microbial Technology 33, 802–809. Kiiskinen, L.L., Ratto, M. & Kruus, K. 2004 Screening for novel laccase-producing microbes. Journal of Applied Microbiology 97, 640–646. Kissi, M., Mountadar, M., Assobhei, O., Gargiulo, E., Palmieri, G., Giardina, P. & Sannia, G. 2001 Roles of two white-rot basidiomycete fungi in decolorisation and detoxification of olive mill waste water. Applied Microbiology and Biotechnology 57, 221–226. Knechtel, R.J. 1978 A more economical method for the determination of chemical oxygen demand. Water Pollution Control 25–29. Kumar, R.A., Gunasekaran, P. & Lakshmanan, M. 1999 Biodegradation of tannic acid by Citrobacter freundii isolated from a tannery effluent. Journal of Basic Microbiology 39, 161–168. Lane, R.W., Yamakoshi, J., Kikuchi, M., Mizusawa, K., Henderson, L. & Smith, M. 1997 Safety evaluation of tannase enzyme preparation derived from Aspergillus oryzae. Food and Chemical Toxicology 35, 207–212. Lekha, P.K. & Lonsane, B.K. 1997 Production and application of tannin acyl hydrolase: state of the art. Advances in Applied Microbiology 44, 215–260. Maestro-Duran, R., Borja, R., Martin, A., Fiestas Ros de Ursinos, J.A. & Alba Mendoza, J. 1991 Biodegradacion de los compuestos fenolicos presentes en el alpechin. Grasas Y Aceites 42, 271–276. Masschelein, C.A. & Batum, M.S. 1981 Enzymic degradation and participation of ester linked beer polyphenols in chill haze formation. Proceedings of the Congress of the European Brewing Convention 18th, Copenhagen, 359–370. Mondal, K.C., Banerjee, R. & Pati, B.R. 2000 Tannase production by Bacillus licheniformis. Biotechnology Letters 22, 767–769. Mondal, K.C., Banerjee, D., Banerjee, R. & Pati, B.R. 2001a Production and characterization of tannase from Bacillus cereus KBR9. Journal of General and Applied Microbiology 47, 263– 267. Mondal, K.C., Samanta, S., Giri, S. & Pati, B.R. 2001b Distribution of tannic acid degrading microorganisms in the soil and comparative study of tannase from two fungal strains. Acta Microbiologica Polonica 50, 75–82. Mukherjee, G. & Banerjee, R. 2004 Biosynthesis of tannase and gallic acid from tannin rich substrates by Rhizopus oryzae and Aspergillus foetidus. Journal of Basic Microbiology 44, 42– 48. Nishitani, Y., Sasaki, E., Fujisawa, T. & Osawa, R. 2004 Genotypic analyses of lactobacilli with a range of tannase activities isolated from human feces and fermented foods. Systematic and Applied Microbiology 27, 109–117. Osawa, R., Kuroiso, K., Goto, S. & Shimizu, A. 2000 Isolation of tannin-degrading lactobacilli from humans and fermented foods. Applied and Environmental Microbiology 66, 3093–3097.

614 Pochon, J.P. & Tardieux, C. 1962 Techniques d’analyse en microbiologie du sol. p. 101 Collection Technique de base, France. Ramirez-Coronel, M.A., Viniegra-Gonzalez, G., Darvill, A. & Augur, C. 2003 A novel tannase from Aspergillus niger with beta-glucosidase activity. Microbiology 149, 2941–2946. Saxena, S. & Saxena, R.K. 2004 Statistical optimization of tannase production from Penicillium variable using fruits (chebulic myrobalan) of Terminalia chebula. Biotechnology and Applied Biochemistry 39, 99–106. Sayadi, S. & Ellouz, R. 1995 Roles of lignin peroxidases and manganese peroxidases from Phanerochaete chrysosporium in the decolorization of olive mill wastewaters. Applied and Environmental Microbiology 61, 1098–1103. Sayadi, S., Allouche, N., Jaoua, M. & Aloui, F. 2000 Detrimental effects of high molecular-mass polyphenols on olive mill wastewater biotreatment. Process Biochemistry 35, 725–735. Scalbert, A. 1991 Antimicrobial properties of tannins. Phytochemistry 30, 3875–3883.

H. Aissam et al. Scherer, M. & Fischer, R. 1998 Purification and characterization of laccase II of Aspergillus nidulans. Archives of Microbiology 170, 78–84. Sharma, S., Bhat, T.K. & Dawra, R.K. 1999 Isolation, purification and properties of tannase from Aspergillus niger van Tieghem. World Journal of Microbiology and Biotechnology 15, 673–677. Spencer, C.M., Cai, Y., Martin, J.D., Graffney, S.H., Goulding, P.N., Magnolato, D., Lilley, T.H. & Haslam, E. 1988 Polyphenol complexation-some thoughts and observations. Phytochemistry 27, 2397–2409. Suseela, R.G. & Nandy, S.C. 1985 Decomposition of tannic acid and gallic acid by Penicillium chrysogenum. Leather Science 32, 278– 280. Sussman, A.S. & Douthit, H.A. 1973 Dormancy in microbial spores. Annual Review of Plant Physiology 24, 311–352. Yu, X.W., Li, Y.Q., Wang, C.X. & Wu, D. 2004 Microencapsulation of tannase by chitosan–alginate complex coacervate membrane: synthesis of antioxidant propyl gallate in biphasic media. Journal of Chemical Technology and Biotechnology 79, 475–479.

Ó Springer 2005


Short commmunication

The influence of tapioca on the growth, the activity of glucoamylase and pigment production of Monascus purpureus UKSW 40 in soybean-soaking wastewater Kris H. Timotius Satya Wacana Christian University, Salatiga, Indonesia, Tel.: 0062-298-321212, Fax: 0062-298-321433, E-mail: [email protected] Keywords: Food pigments, glucoamylase, Monascus purpureus, SSW, tapioca starch

Summary The present study evaluates the usefulness of tapioca starch as additional carbon source for the growth of Monascus purpureus in soybean-soaking wastewater (SSW). The result revealed that M. purpureus grown on 2.0% (w/v) tapioca starch in SSW produced significantly (P < 0.05) higher amounts of biomass and production of the pigments (OD400 and OD500) when compared to those grown on glucose-or maltose-containing media. However, the glucoamylase activity of M. purpureus grown on the tapioca-SSW medium was not significantly increased when compared to those from the glucose-containing medium.

Introduction Tapioca starch and soybean-soaking wastewater (SSW) are potentially cheap source of carbon and nitrogen for bioindustries in Java. These substrates are also available in large amounts throughout the year in Java (Handayani & Timotius 1998; Yongsmith 1998). Combinatory use of these substrates as growth medium for M. purpureus has never been reported. It is for these reasons that the present project was conducted to evaluate the effectiveness of this substrate on enzyme and pigment production by M. purpureus. SSW from tempe industries is not yet used as substrate for any kind of bio-based industry in Indonesia. At present SSW is only discarded into the rivers. Furthermore, on preliminary investigation has revealed that soybean waste has a high nutrient content. It is estimated that over 3000 l of SSW is produced per day in Java. Thus, utilization of this substrate will reduced the level of pollution created by these discharges (Timotius & Utomo 1997; Timotius 1998). M. purpureus is a mould usually isolated from ‘‘Angkak’’ which is traditionally used as a food colorant in Asian Countries. A lot of work has been done on the chemistry and production aspects on solid and liquid culturing of ‘‘Angkak’’. This mould produces six pigments along with other secondary metabolites. Its pigments show considerable potential as food colorants (Lee et al. 1995; Sheu et al. 2000). The present study investigates the possible use of tapioca starch and SSW as substrates for the growth of

M. purpureus and its production of glucoamylase and pigments.

Materials and methods Source and growth of M. purpureus M. purpureus UKSW 40 was isolated from local ‘‘Angkak’’ and maintained on malt extract agar (MEA) slopes. Medium SSW was obtained from local tempe producers, and cooked for 10 min at 120 °C and then filtered to separate the insoluble materials before sterilization. The cooked and filtered SSW was diluted to 1.5% (v/v) Brix using a viscometer and adjusted to pH 6. The media was then sterilized by heating to 121 °C for 15 min. Test substrate Tapioca starch was obtained from the local manufacturer (Salatiga). Glucose and maltose were obtained from Merck Chemical Company. Cultivation method Inoculum was prepared by culturing the mould in MEA. The spores were then harvested in physiological saline

616

K.H. Timotius

Table 1. Matrix of correlation coefficient among parameters of SSW. Parameter

Soluble solid

Viscosity 0.98 Free N-amino Protein content Total acid pH

Free N-amino

Protein content

Total acid

pH

0.98 0.96

0.94 0.91 0.97

0.88 0.94 0.88 0.84

0.00 0.02 0.10 0.01 0.00

(NaCl, 9 g/l). The harvested spores in buffer were shaken on an orbital shaker (150 rev/min) in 250 ml erlenmeyer flasks, containing 100 ml of medium for 5 days. At the end of the incubation time, pigments, glucoamylase and biomass production were measured as explained below. Growth experiments were performed using a one-litre working volume airlift fermenter at 550 ml air/min. Analytical procedure The harvested mycelium was placed in double volume of absolute methanol and the pigments extracted by shaking. After extraction of the pigments, the mycelium was dried at 80 °C for 24 h and weighed to determine the dry cell weight (DCW). The determination of soluble solids, free N-amino, protein and total acid were done according to Sudarmadji et al. (1984). The concentrations of extracellular red and yellow pigments were determined using a

Figure 1. The influence of SSW viscosity on the production of biomass (–h–), pigments OD400 (–d–); and OD500 (–n–) after 7 days incubation with 5.0% tapioca starch.

spectrophotometer measuring absorbance at 500 and 400 nm, respectively, using a 1.0 cm light path. The uninoculated medium was used as the blank. Glucoamylase activity was measured based on the amount of reducing Sugar formed according to the method of Yangsmith et al. (2000).

Results and discussion The nutrient profiles of SSW from tempe industries varies because of the lack of standard procedures. This

Figure 2. The comparison of biomass production (a), glucoamylase activity (b) and pigment production (c) and (d) with glucose (–d–); maltose (–h–); or tapioca starch (–n–) after 7 days incubation.

Submerged production for Monascus pigments variability in nutrient quality is attributed to several factors, such as the soybean washing process, the ratio of soybean to water used in the washing process and the steaming period or time. Except for pH, all parameters measured i.e. viscosity, soluble solids, free N-amino, total protein and total acid varied significantly. The viscosity of SSW varied 2–8% Brix. Its soluble solids, free N-amino, protein content, total acid, and pH were 17.2–65.0 mg/l, 0.76–2.52 g/l, 0.029–0.178%, 0.44–2.16%, and 4.3–4.8%, respectively. From the data presented in Table 1, it is evident that the quality of SSW varies, however it would appear that viscosity measured as % of Brix could be also useful indicator for the levelling of soluble solids, free Namino, protein content and total acid of the SSW. This means that its level of viscosity is correlated with or influenced by soluble solids, free N-amino, protein content, and total acid. The correlation with pH was very low for all other parameters from the data presented in Figure 1, the levels of biomass and pigment production increased with increasing viscosity. These results further indicate that maximum biomass occured from 2.5 to 5.0% Brix and then reduced rapidly. Pigment production was higher at 2.5–3.0% witha value of 7.0 g/l above 4.0% Brix the pigment concentration reduced rapidly to 2.0 g/l. Further analyses of the data presented in Figure 1 revealed that above 6% Brix the pigment concentration increased to 7.0 g/l. This increase in pigment concentration could be attributed to increasing lysis of the mycelial cell, which is reflected as a reduction in the biomass value. Careful analyses of the data presented in Figure 2 revealed that tapioca starch produced the higher levels of biomass, glucoamylase activity and pigment production. The data also revealed that biomass production and glucoamylase activity increased with increasing concentration of tapioca starch, unlike maltose and glucose. The optimum concentration for pigment A400 and A500 were 2–4% for both pigments. From these experiments, it would appear that SSW could be a useful substrate for biomass and pigment production in M. purpureus. It is also interesting to note that tapioca starch, which is a cheap source of carbon, also enhanced biomass and pigment production in a manner similar to glucose. The lower concentration of

617 pigment produced as compared to other publication data which used synthetic substrates will be explored further since the growth conditions in this experiment were not fully optimized.

Acknowledgements The research was supported by the American Society for Microbiology, Washington. I also expressed my gratitude to Dr. Lawrent Williams from Jamaica for his comments.

References Handayani, D. & Timotius, K.H. 1998 Pertumbuhan, produksi pigmen dan aktivitas glukoamilase dari Monascus purpureus UKSW 40 pacta berbagai medium pertumbuhan (The growth, pigments production and glucoamylase activity of Monascus purpureus on different growth media). Buletin Implementasi dan Pemanfaatan Teknologi 4, 15–17. Lee, Y.K., Chen, D.C., Lim, B.L., Tay, H.S. & Chua, J. 1995 Fermentative production of natural food colorants by the fungus Monascus. Icheme Symposium Series 137, 19–23. Sheu, F., Wang, C.L. & Shyu, Y.T. 2000 Fermentation of monascus purpureus on bacterial cellulose-nata and the color stability of Monascus-nata complex. Journal of Food Science 65, 342–345. Sudarmadji, S., Haryono, B. & Suhardi. 1984 Prosedur Analisa Untuk Bahan Makanan dan Pertanian (Analytical Procedure For Food and Agriculture). pp.7–8; 10–13; 70–73; 85–86. Liberty: Yogyakarta. ISBN 979-499-227-5. Timotius, K.H. & Utomo, O.R. 1997 Pengaruh Zn terhadap pembentukan biomass dan pigmen oleh Monascus purpureus UKSW 40 pada medium yang mengandung air rendaman kedelai (The influence of Zn on the biomass and pigments formation by Monascus purpureus on soy-soaking). Buletin Teknologi dan lndustri Pangan 2, 1–6. Timotius, K.H. 1998 Production of Monascus pigments using soysoaking water as substrate. The symposium on Monascus culture and application. Institut National des Sciences Appliquee de Toulouse, Toulouse. Yongsmith, B. 1998 Production of yellow pigments by Monascus mutant growing on cassava. The symposium on Monascus culture and application. Institute National de Sciences Appliquees de Toulouse, Toulouse. Yongsmith B., Kitprechavanich, V., Chitradon, L., Chaisrisook, C. & Budda, N. 2000 Color mutants of Monascus sp. KB9 and their comparative glucoamylases on rice solid culture. Journal of Molecular Catalysis B: Enzymatic 10, 263–272.