Research in Veterinary Science 107 (2016) 196–201
Contents lists available at ScienceDirect
Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc
Zoonotic Enterocytozoon bieneusi genotypes found in brazilian sheep Vagner Ricardo da Silva Fiuza a,b, Carlos Wilson Gomes Lopes b, Rachel Ingrid Juliboni Cosendey c, Francisco Carlos Rodrigues de Oliveira d, Ronald Fayer a, Monica Santín a,⁎ a Environmental Microbial and Food Safety Laboratory, Agricultural Research Service, United States Department of Agriculture, 10300 Baltimore Avenue, BARC-East, Building 173, Beltsville, MD 20705, USA b Departamento de Parasitologia Animal, Instituto de Veterinária, UFRRJ, BR-465 km 7, 23897-970, Seropédica, Rio de Janeiro, Brazil c Laboratório Multiusuário de Apoio à Pesquisa em Nefrologia e Ciências Médicas, HUAP, UFF, 24033-900, Niterói, Rio de Janeiro, Brazil d Laboratório de Sanidade Animal, UENF, 28013-602, Campos dos Goytacazes, Rio de Janeiro, Brazil
a r t i c l e
i n f o
Article history: Received 12 April 2016 Received in revised form 26 May 2016 Accepted 6 June 2016 Available online xxxx Keywords: E. bieneusi Genotyping Microsporidia PCR Public health Zoonosis
a b s t r a c t The presence of Enterocytozoon bieneusi in sheep has been reported in only three countries worldwide. The present study has found E. bieneusi in Brazilian sheep for the first time; in 24/125 (19.2%) fecal samples by PCR and on 8/10 (80%) farms from three diverse locations. A significantly greater number of lambs (34.1%) were found infected than older sheep (11.1%) (P = 0.0036); most of the lambs were less than 6 months of age. Farms with an intensive production system had a lower infection rate (10.5%) of infection than semi-intensive farms (23%), but this difference was not statistically significant. Sequencing analysis of the internal transcribed spacer (ITS) region of the rRNA gene revealed four known E. bieneusi genotypes (BEB6, BEB7, I, and LW1) and two novel genotypes (BEB18 and BEB19). Genotypes LW1 and BEB19 clustered within designated zoonotic Group 1 while genotypes BEB6, BEB7, I, and BEB18, and clustered within Group 2. BEB6 was the most prevalent (45.8%), followed by BEB7 (33.3%). Genotypes BEB6, I, and LW1 are zoonotic and can pose a risk to human health for immunocompromised individuals. Published by Elsevier Ltd.
1. Introduction Microsporidia is a nontaxonomic name for a diverse group of obligate intracellular parasites that includes over 1200 species with a wide host range that includes invertebrates and vertebrates, including humans (Didier, 2005). Of the 17 species of microsporidia known to infect humans, Enterocytozoon bieneusi is the most frequently reported. It is associated with diarrheal syndrome (Matos et al., 2012; Fayer and Santín, 2014). Clinical symptoms, observed mainly in immunocompromised patients, include chronic diarrhea, malabsorption, and wasting diathesis (Didier and Weiss, 2006). Although infections in immunocompetent individuals are usually asymptomatic, they shed spores that could contaminate the enviroment and represent an epidemiological concern (Sak et al., 2011a; Nkinin et al., 2007). E. bieneusi infections result from fecal-oral transmission of spores from infected humans or animals through contaminated food and water (Didier and Weiss, 2011).
⁎ Corresponding author. E-mail address:
[email protected] (M. Santín).
http://dx.doi.org/10.1016/j.rvsc.2016.06.006 0034-5288/Published by Elsevier Ltd.
Spores of E. bieneusi have been detected in surface, wastewater, drinking, and recreational waters and in food (Fayer and Santín, 2014). Current typing of E. bieneusi relies on molecular methods because differences among E. bieneusi genotypes cannot be discriminated morphologically. Most of the genotyping studies have been based on the polymorphisms in the nucleotide sequence of the internal transcribed spacer (ITS) region of the rRNA gene, that is at present the standard for detection and identification of E. bieneusi genotypes (Santín and Fayer, 2009a). To date, over 200 distinct E. bieneusi genotypes have been described. Some genotypes have been identified only in humans or in animals but many others have been identified in both humans and animals (Santín, 2015). There is very little information about the distribution and prevalence of E. bieneusi in sheep worldwide. There are only seven documented studies, six from Asia (China and Iran) (Li et al., 2014a; Askari et al., 2015; Jiang et al., 2015; Ye et al., 2015; Zhao et al., 2015a; Shi et al., 2016), and one from Europe (Sweden) (Stensvold et al., 2014). The presence of E. bieneusi in sheep in the Americas is unknown, and therefore any risk these animals may pose in transmitting microsporidiosis to humans is also unknown. Therefore, the present study was undertaken to determine if E. bieneusi is present in sheep in Brazil, and if so, to
V.R.S. Fiuza et al. / Research in Veterinary Science 107 (2016) 196–201
identify E. bieneusi genotypes using nucleotide sequence analysis of the ITS and thereby determine if any had zoonotic potential.
2. Material and methods 2.1. Samples collected A total of 125 fecal specimens were collected from the Santa Inês breed of sheep on ten farms from three municipalities (Carapebus, São João da Barra, and São Francisco do Itabapoana) in the Rio de Janeiro State in Southeast Brazil (Table 1). Specimens included 44 fecal samples collected from lambs b 6 months of age and 81 samples from sheep N1 year of age. Gender was also recorded for each animal. Farms were categorized based on their production sytem as semi-intensive if animals grazed in natural vegetation during the day and were supplemented with feed concentrates at night or as intensive if fed only with cut forage and concentrates without outdoor grazing. Information on the presence or absence of regular veterinary support and overall hygienic condition of the facilities (good or poor) was also recorded at the time fecal samples were collected. Facilities were considered to have good overall hygienic conditions when the animals have brief contact with the feces due to the fenestrated floors and constant cleaning and disinfection of beds and facilities or poor when the cleaning and disinfection of facilities happened sporadically. All sheep appeared healthy at the time of sampling. Individual fecal specimens (approximately 20–30 g) were collected directly from the rectum using sterile disposal latex gloves that were inverted after feces were collected, stored in insulated boxes at 4 °C, and immediately transferred to the laboratory to be processed within 1–3 days of collection. Each fecal specimen was sieved and the filtrate was concentrated to purify spores by centrifugation with sucrose (1.1 g/ml) as previously described (Fiuza et al., 2009). Genomic DNA was directly extracted from each sucrose-concentrated fecal sample using the DNeasy Bood & Tissue Kit (Qiagen, Valencia, California) according to manufacturer's directions with minor exceptions. Modifications included overnight incubation with proteinase K and elution in 100 μl of AE buffer to increase the quantity of recovered DNA (Santín et al., 2004). DNA was stored at −20 °C prior to PCR analysis.
197
2.2. PCR and sequencing To detect E. bieneusi, a nested PCR protocol was used to amplify the entire ITS (243 bp) as well as portions of the flanking large and small subunits of the rRNA gene. The outer primers were EBITS3 (5′ GGTCATAGGGATGAAGAG 3′) and EBITS4 (5′ TTCGAGTTCTTTCGCGCTC 3′), and the inner primers were EBITS1 (5′ GCTCTGAATATCTATGGCT 3′) and EBITS2.4 (5′ ATCGCCGACGGATCCAAGTG 3′) (Buckholt et al., 2002). The reaction mixture (50 μl) contained 1.5 mM MgCl2, 50 mM KCl, 20 mM Tris–HCl (pH 9), 0.2 mM dNTPs, 1 μM of each primer, 2.5 U of Taq (MP Biomedicals, Solon, Ohio), and 2.5 μl of BSA (0.1 g/10 ml). After denaturation at 94 °C for 3 min, the first PCR samples were subjected to 35 cycles of amplification (denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, and elongation at 72 °C for 40 s), followed by a final extension at 72 °C for 10 min. Conditions for the secondary PCR were identical to the primary PCR except only 30 cycles were repeated at an annealing temperature of 55 °C. These reactions produced fragments of 435 and 390 bp, respectively. Negative and positive controls were included in all PCR sets. PCR products were subjected to electrophoresis in the QIAxcel Advanced system (Qiagen, Valencia, California). All positive PCR products were purified using ExoSAP-IT (USB Corporation; Cleveland, Ohio) and sequenced in both directions using the inner PCR primers in 10 μl reactions, with BigDye 3.1v Chemistries, in an ABI 3130 sequencer analyzer (Applied Biosystems, Foster City, California). The sequences of each strand were aligned and examined with Lasergene software (DNASTAR, Madison, Wisconsin). Sequences obtained were aligned with reference sequences downloaded from GenBank using the program MegAlign (DNASTAR, Madison, Wisconsin) to determine genotypes. The established nomenclature system was used in naming E. bieneusi genotypes (Santín and Fayer, 2009a). The nucleotide sequences obtained in the present study were deposited in the GenBank database under accession numbers KX008322-KX008327. 2.3. Phylogenetic analyses Sequences obtained in this study as well as nucleotide sequences from E. bieneusi genotypes previously identified in sheep and humans were aligned with the Clustal W algorithm using the MEGA version 6
Table 1 Prevalence and genotypes of Enterocytozoon bieneusi found in sheep in the State of Rio de Janeiro, Brazil.
Municipality
No. E. bieneusi postives/No. of Farm specimens (%)
Gender: No. E. bieneusi postives/No. of specimens (%)
Age: No. E. bieneusi postives/No. of specimens (%)
Carapebus
A
4/7 (57.1)
B
0/8 (0)
C
3/10 (30)
E
1/10 (10)
F
0/10 (0)
G
4/10 (40)
D
1/20 (5)
H
5/20 (25)
I
3/15 (20)
J
3/15 (20)
Male: 1/2 (50) Female: 3/5 (60) Male: 0/3 (0) Female: 0/5 (0) Male: 2/4 (50) Female: 1/6 (16.7) Male: 1/2 (50) Female: 0/8 (0) Male: 0/1 (0) Female: 0/9 (0) Male: 0/3 (0) Female: 4/7 (57.1) Male: 0/7 (0) Female: 1/13 (7.7) Male: 2/4 (50) Female: 3/16 (18.7) Male: 3/8 (37.5) Female: 0/7 (0) Male: 1/2 (50) Female: 2/13 (15.4) Male: 10/36 (27.8) Female: 14/89 (15.7)
Adult: 0/1 (0) Lamb: 4/6 (66.7) Adult: 0/4 (0) Lamb: 0/4 (0) Adult: 1/6 (16.7) Lamb:2/4 (50) Adult: 0/9 (0) Lamb: 1/1 (100) Adult: 0/9 (0) Lamb: 0/1 (0) Adult: 2/5 (40) Lamb: 2/5 (40) Adult: 1/9 (11.1) Lamb: 0/11 (0) Adult: 3/16 (18.7) Lamb: 2/4 (50) Adult: 0/8 (0) Lamb: 3/7 (42.9) Adult: 2/14 (14.3) Lamb: 1/1 (100) Adult: 9/81 (11.1) Lamb: 15/44 (34.1)
São João da Barra
São Francisco do Itabapoana Total
24/125 (19.2)
Production system
Regular veterinary support
Overall hygiene condition
E. bieneusi genotypes (n)
Semi-intensive
No
Poor
BEB6 (4)
Intensive
No
Poor
–
Intensive
No
Poor
BEB7 (2), BEB19 (1)
Intensive
No
Good
BEB6 (1)
Intensive
No
Poor
–
Semi-intensive
No
Good
BEB6 (3), I (1)
Semi-intensive
Yes
Good
I (1)
Semi-intensive
Yes
Good
BEB7 (5)
Semi-intensive
Yes
Poor
Semi-intensive
Yes
Poor
BEB7 (1), BEB18 (1), LW1 (1) BEB6 (3)
Semi-intensive: 20/87 (23) Intensive: 4/38 (10.5)
Yes: 12/70 (17.1) No: 12/55 (21.8)
Good: 11/60 (18.3) Poor: 13/65 (20)
BEB6 (11), BEB7 (8), I (2), BEB18 (1), BEB19 (1), LW1 (1)
198
V.R.S. Fiuza et al. / Research in Veterinary Science 107 (2016) 196–201
(Tamura et al., 2013). Clustal W determines that when a gap is inserted it can be removed only by editing, so final alignment adjustments were made manually to remove artificial gaps. Phylogenetic and molecular evolutionary analyses were made using MEGA 6 (Tamura et al., 2013). Phylogenetic inference was done by the Neighbor-Joining (NJ) method of Saitou and Nei (1987). Genetic distance was calculated with the Kimura 2-parameter model. 2.4. Statistical analysis Statistical analyses were performed using the Fisher's exact test, with 95% confidence intervals (GraphPad Software, La Jolla, California). 3. Results 3.1. Presence of E. bieneusi Of the 125 fecal specimens collected 24 (19.2%) were PCR positive for E. bieneusi. Positive sheep were found in eight of the ten farms examined (80%) with a infection rate that ranged from 5 to 57.1% (Table 1). Infection rate in the municipalities of São João da Barra, Carapebus, and São Francisco do Itabapoana were 15, 21.8, and 20%, respectively. No statistical difference was observed among municipalities: (P = 0.4404). Infection rate based on age differences was statistically significant (P = 0.0036), with a higher infection rate observed in lambs (34.1%) than in adult sheep (11.1%) (Table 1). Males showed a higher infection rate (27.8%) than females (15.7%), however, differences in infection rate based on gender was not statistically significant (P = 0.1373) (Table 1). Similarly, although overall infection rate was lower in farms with an intensive production system (10.5%) than in farms with a semi-intensive production system (23%), the difference was not statistically significant (P = 0.1395). Regular veterinary support and good hygiene conditions at the farm had no correlation with infection rate of E. bieneusi (P = 0.6480 and P = 0.8249, respectively). 3.2. E. bieneusi genotypes Sequence analysis of the ITS region for the 24 PCR positive samples revealed the presence of four previously reported E. bieneusi genotypes (BEB6, BEB7, I, and LW1) and two novel genotypes named BEB18 and BEB19 (Table 1). Genotype BEB18 nucleotide sequence differs in two nucleotides at the ITS region with genotype BEB6 (EU153584) and clustered within previously designated Group 2 (data not shown), a group that includes genotypes mostly isolated from cattle. Genotype BEB19 nucleotide sequence differs only in one nucleotide at the ITS region with genotype EbPig2 (KP318003) and clustered within previously designated zoonotic Group 1 (data not shown). Genotypes LW1 clustered within Group 1 while genotypes BEB6, BEB7, and I clustered within Group 2. The most prevalent genotype, BEB6, was identified in 11 of the 24 positive specimens (45.8%), followed by BEB7 that was found in 8 specimens (33.3%). Genotypes I, BEB18, BEB19, and LW1 were identified in 2, 1, 1, and 1 specimens, respectively. Infections with multiple genotypes were not detected. 4. Discussion Enterocytozoon bieneusi was identified in 19.2% (24/125) of the sheep examined at 80% of farms included in this study and constitutes the first report of any zoonotic microsporidian parasite in sheep in Brazil and the Americas. However, E. bieneusi has been reported in Brazil in humans, cattle, pigs, and birds (Feng et al., 2011; Lallo et al., 2012; Fiuza et al., 2015, 2016; Cunha et al., 2016). There are few other reports of E. bieneusi in sheep wordwide and little is known about the role that sheep could play on the epidemiology of E. bieneusi. The majority of the studies are from China where E. bieneusi was found in sheep, from pre-
weaned lambs to adult sheep, with a prevalence that ranged from 4.4 to 69.3% (Li et al., 2014a; Jiang et al., 2015; Ye et al., 2015; Zhao et al., 2015a; Shi et al., 2016). In Sweden, only lambs were found E. bieneusi positive with a prevalence of 68.1% while all adult sheep examined were negative (Stensvold et al., 2014). In Iran, a prevalence of 10% was found in sheep (age was not indicated) (Askari et al., 2015). In the present study, E. bieneusi was found in both lambs and adult sheep with a statistically significant higher infection rate in lambs. Similar results with higher prevalences in lambs were reported in China (Jiang et al., 2015; Ye et al., 2015; Shi et al., 2016). In Northeast China, a higher prevalence was observed in animals less than one year of age in the cities of Daqing (20.1%) and Qiqihar (16.2%), than in sheep older than one year of age in Qiqihar (8.3%) (Jiang et al., 2015). In Inner Mongolia, a higher prevalence was also observed in pre-weaned (74.7%) and post-weaned lambs (81.3%) in comparison to ewes examined one week before parturition (61%) and during parturition (64.7%) (Ye et al., 2015). Additionally, another study that included samples collected in various parts of the China showed a decreased prevalence with age, with prevalences of 52, 52.3, 38.5 and 39.4% reported in sheep less than 3 months, 3–6 months, 6–12 months, and older than one year, respectively (Shi et al., 2016). Two other studies, one in Sweden (Stensvold et al., 2014) and one in China (Li et al., 2014a), reported E. bieneusi only in lambs but not in adults. Our findings suggest that gender seems to have no influence on the infection rate of E. bieneusi. The only other study in sheep than included gender information found no significant difference between prevalence in males (39.9%) and females (46.9%) (Shi et al., 2016). Similarly, in cattle in Brazil, a recent large study involving 452 cattle found no correlation between E. bieneusi infection and gender (Fiuza et al., 2016). However, in other animals such as dogs, cats and wild mammals E. bieneusi was found to be more prevalent in males than in females (Sulaiman et al., 2003a; Santín et al., 2006, 2008). Nucleotide sequence analysis of the ITS from the 24 E. bieneusi positive specimens allowed the identification of 6 genotypes, 4 previously reported (BEB6, BEB7, I, and LW1) as well as two novel genotypes (BEB18 and BEB19). The two novel genotypes will add to the 37 genotypes already reported in sheep (Table 2). All genotypes identified in
Table 2 Reports of Enterocytozoon bieneusi genotypes in sheep. Bold denotes genotypes found in this study. Genotype (synonyms) a
BEB6 (SH5)
Host (location)
Reference
Sheep (Brazil, China, Sweden)
Li et al. (2014a); Stensvold et al. (2014); Jiang et al. (2015); Ye et al. (2015); Zhao et al. (2015a); Shi et al. (2016); This study Wang et al. (2013a) Fayer et al. (2007) Feng et al. (2011); Ye et al. (2015); Zhao et al. (2015a); Shi et al. (2016) Zhao et al. (2014a) Karim et al. (2014a) Karim et al. (2014b) Jiang et al. (2015) Sulaiman et al. (2003b); Bern et al. (2005); Leelayoova et al. (2006); Cama et al. (2007); Espern et al. (2007); Wang et al. (2013a,b) Zhao et al. (2015a); Shi et al. (2016) Del Coco et al. (2014); Jiang et al. (2015) Deplazes et al. (1996); Breitenmoser et al. (1999); Leelayoova et al. (2009); Reetz et al. (2009); Abe and Kimata
Human (China) Cattle (USA) Goat (China, Peru)
EbpCa (EbpC, E, WL13, Peru4, WL17)
Sika deer Cat (China) Primate (China) Sheep (China) Human (China, Peru, Thailand, Vietnan)
Goat (China) Cattle (Argentina, China) Pig (China, Germany, Japan, Peru, Switzerland, Tailand)
V.R.S. Fiuza et al. / Research in Veterinary Science 107 (2016) 196–201 Table 2 (continued) Genotype (synonyms)
Table 2 (continued) Host (location)
Wild boar (Austria, Poland) Beaver (USA) Otter (USA) Muskrat (USA) Raccon (USA) Fox (China, USA) Dog (China) Non-human primates (China) Oa
Peru6a
Sheep (China) Human (Tailand) Cattle (China) Pig (Brazil, China, Germany,Thailand) Dog (China) Sheep (China) Human (Portugal, Peru)
Goat (China) Cattle (USA) Birds (Brazil, Portugal)
Da (WL8, Peru9, CebC, PtEb VI, PigEBITS9)
199
Dog (Portugal) Sheep (China) Human (Brazil, Cameroon, China, Congo Democratic Republic of São Tomé and Príncipe, England, Gabon, India,Iran, Malawi, Netherlands, Niger, Nigeria, Poland, Portugal, Peru, Russia, Spain, Thailand, Tunisia, Vietnan)
Goat (China) Cattle (Argentina, Brazil, China, Korea, South Africa)
Pig (China, Czech Republic, Japan, USA)
Wild boar (Czech Republic, Slovak Republic) Cat (China) Dog (China, Portugal) Horse (Colombia, Czech Republic) Rabbit (Spain) Mouse (Czech Republic, Germany) Takin (China) Beaver (USA) Fox (China, Spain, USA)
Muskrat (USA) Otter (USA) Raccoon (China, USA) Non-human primates (China;
Reference (2010); Feng et al. (2011); Li et al. (2014a); Wan et al. (2016) Němejc et al. (2014) Sulaiman et al. (2003a) Sulaiman et al. (2003a) Sulaiman et al. (2003a) Sulaiman et al. (2003a) Sulaiman et al. (2003a); Zhao et al. (2015b) Karim et al. (2014a) Ye et al. (2012); Karim et al. (2014b) Zhao et al. (2015a) Leelayoova et al. (2006) Zhao et al. (2015c) Li et al. (2014b); Zhao et al. (2014b); Fiuza et al. (2015); Wan et al. (2016) Karim et al. (2014a) Zhao et al. (2015a) Sulaiman et al. (2003b); Bern et al. (2005); Cama et al. (2007); Lobo et al. (2012) Zhao et al. (2015a) Santín et al. (2005) Lobo et al. (2006a); Cunha et al. (2016) Lobo et al. (2006b) Zhao et al. (2015a) Sadler et al. (2002); Sulaiman et al. (2003b); Bern et al. (2005); Leelayoova et al. (2006); Breton et al. (2007); Cama et al. (2007); Espern et al. (2007); Saksirisampant et al. (2009); ten Hove et al. (2009); Ayinmode et al. (2011); Feng et al. (2011); Galván et al. (2011); Sokolova et al. (2011); Akinbo et al. (2012); Chabchoub et al. (2012); Lobo et al. (2012); Maikai et al. (2012); Wumba et al. (2012); Agholi et al. (2013a,b); Li et al. (2013); Wang et al. (2013a,b) Lobo et al. (2014); Kicia et al. (2014) Zhao et al. (2015a); Shi et al. (2016) Lee (2007, 2008); Abu Samra et al. (2012); Del Coco et al. (2014); Zhao et al. (2015c); Fiuza et al. (2016) Buckholt et al. (2002); Sak et al. (2008); Abe and Kimata (2010); Li et al. (2014b); Zhao et al. (2014b) Němejc et al. (2014) Karim et al. (2014a) Lobo et al. (2006b); Karim et al. (2014a) Santín et al. (2010); Wagnerova et al. (2012) Galvan-Diaz et al. (2014) Sak et al. (2011b) Zhao et al. (2015d) Sulaiman et al. (2003b) Sulaiman et al. (2003b); Galvan-Diaz et al. (2014); Yang et al. (2015); Zhao et al. (2015b) Sulaiman et al. (2003b) Guo et al. (2014) Sulaiman et al. (2003b); Yang et al. (2015); Zhao et al. (2015b) Chalifoux et al. (2000); Li et al.
Genotype (synonyms)
a
I (BEB2, CEbE)
Host (location)
Reference
Kenya, USA)
(2011); Karim et al. (2014b); Ye et al. (2014) Muller et al. (2008); Pirestani et al. (2013); Cunha et al. (2016) This study Zhang et al. (2011) Rinder et al. (2000); Dengjel et al. (2001); Sulaiman et al. (2004); Santín et al. (2005); Fayer et al. (2007); Lee (2007, 2008); Santín and Fayer (2009b); Zhang et al. (2011); Abu Samra et al. (2012); Fayer et al. (2012); Santín et al. (2012); Jurankova et al. (2013); Del Coco et al. (2014); Jiang et al. (2015); Ma et al. (2015); Zhao et al. (2015c); Fiuza et al. (2016) Ma et al. (2015) Santín and Fayer (2015) Galvan-Diaz et al. (2014) Karim et al. (2014a) Karim et al. (2014b) This study Wang et al. (2013a,b) Santín and Fayer (2015) Li et al. (2014a,b); Zhao et al. (2014b) Němejc et al. (2014) This study Fayer et al. (2007) This study This study Stensvold et al. (2014); Jiang et al. (2015) Stensvold et al. (2014) Jiang et al. (2015) Jiang et al. (2015) Jiang et al. (2015) Jiang et al. (2015) Jiang et al. (2015) Jiang et al. (2015) Jiang et al. (2015) Jiang et al. (2015) Li et al. (2014a,b); Wan et al. (2016) Shi et al. (2016) Karim et al. (2014b) Jiang et al. (2015); Ye et al. (2015) Ye et al. (2015) Karim et al. (2014b) Zhao et al. (2015a); Shi et al. (2016) Shi et al. (2016) Zhao et al. (2015a) Zhao et al. (2015a) Zhao et al. (2015a) Zhao et al. (2015a) Zhao et al. (2015a) Zhao et al. (2015a) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016) Shi et al. (2016)
Birds (Abu Dhabi, Brazil, China, Iran) Sheep (Brazil) Human (China) Cattle (Argentina, Brazil, China, Czech Republic, Germany, Korea, South Africa USA)
Yak (China) White-tailed deer (USA) Pig (Spain) Cat (China) Non-human primates (China) Sheep (Brazil) LW1a (SH7, Henan-I) Human (China) White-tailed deer (USA) Pig (China)
BEB7 BEB18 BEB19 OEB1
Wild boar (Austria) Sheep (Brazil) Cattle (USA) Sheep (Brazil) Sheep (Brazil) Sheep (China, Sweden)
OEB2 NESH1 NESH2 NESH3 NESH4 NESH5 NESH6 CS-4
Sheep (Sweden) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Cattle (China) Pig (China)
CM4 CM7
Sheep (China) Non-human primates (China) Sheep (China)
COS-I
Goat (China) Non-human primates (China) Sheep (China)
COS-II COS-III COS-IV COS-V COS-VI COS-VII CHG3 CHS3 CHS4 CHS5 CHS6 CHS7 CHS8 CHS9 CHS10 CHS11 CHS12 a
Goat (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Goat (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China) Sheep (China)
Genotypes identified in humans.
200
V.R.S. Fiuza et al. / Research in Veterinary Science 107 (2016) 196–201
this study with the exception of genotype I, recently found in cattle in Rio de Janeiro (Fiuza et al., 2016), constitutes the first report of those genotypes in Brazil. The identification of genotypes BEB7, I and LW1 in sheep constitutes the first report of these genotypes in sheep. Genotype BEB6, the most prevalent genotype found in the present study, has been commonly reported in sheep and it has also been found in humans and other animal hosts (Table 2). The second most prevalent genotype (BEB7) has been described previously only in a milking cow from Florida, USA, and was thought to be cattle specific (Table 2). However, the identification of BEB7 in lambs and adults in farms at the three municipalities included in this study, suggest a wide distribution of this genotype in this region. However, it is interesting that BEB7 was not found in a study that examined 452 cattle samples obtained from the same region as this study (Fiuza et al., 2016). Genotype I, found in two ewes from different farms, has commonly been reported in cattle in several countries, and has also been found in other hosts, including humans (Table 2). Genotype LW1 identified in one animal in a farm in São Francisco do Itabapoana has been previously detected in humans, deer, pigs, and wild board (Table 2) as well as detected in water samples in China (Ye et al., 2012). In conclusion, our results demonstrate that E. bieneusi is present and common in sheep in Brazil. The identification of zoonotic genotypes demonstrates the potential role of sheep as a source of human infection and environmental contamination.
References Abe, N., Kimata, I., 2010. Molecular survey of Enterocytozoon bieneusi in a Japanese porcine population. Vector Borne Zoonotic Dis. 10, 425–427. Abu Samra, N., Thompson, P.N., Jori, F., Zhang, H., Xiao, L., 2012. Enterocytozoon bieneusi at the wildlife/livestock interface of the Kruger National Park, South Africa. Vet. Parasitol. 190, 587–590. Agholi, M., Hatam, G.R., Motazedian, M.H., 2013a. HIV/AIDS-associated opportunistic protozoal diarrhea. AIDS Res. Hum. Retrovir. 29, 35–41. Agholi, M., Hatam, G.R., Motazedian, M.H., 2013b. Microsporidia and coccidia as causes of persistence diarrhea among liver transplant children: incidence rate and species/genotypes. Pediatr. Infect. Dis. J. 32, 185–187. Akinbo, F.O., Okaka, C.E., Omoregie, R., Dearen, T., Leon, E.T., Xiao, L., 2012. Molecular epidemiologic characterization of Enterocytozoon bieneusi in HIV-infected persons in Benin City, Nigeria. Am.J.Trop. Med. Hyg. 86, 441–445. Askari, Z., Mirjalali, H., Mohebali, M., Zarei, Z., Shojaei, S., Rezaeian, T., Rezaeian, M., 2015. Molecular detection and identification of zoonotic microsporidia spore in fecal samples of some animals with close-contact to human. Iran. J. Parasitol. 10, 381–388. Ayinmode, A.B., Ojuromi, O.T., Xiao, L., 2011. Molecular identification of Enterocytozoon bieneusi isolates from Nigerian children. J. Parasitol. Res. 2011, 129542. Bern, C., Kawai, V., Vargas, D., Rabke-Verani, J., Williamson, J., Chavez-Valdez, R., Xiao, L., Sulaiman, I., Vivar, A., Ticona, E., Navincopa, M., Cama, V., Moura, H., Secor, W.E., Visvesvara, G., Gilman, R.H., 2005. The epidemiology of intestinal microsporidiosis in patients with HIV/AIDS in Lima, Peru. J. Infect. Dis. 191, 1658–1664. Breitenmoser, A.C., Mathis, A., Burgi, E., Weber, R., Deplazes, P., 1999. High prevalence of Enterocytozoon bieneusi in swine with four genotypes that differ from those identified in humans. Parasitology 118 (Pt 5), 447–453. Breton, J., Bart-Delabesse, E., Biligui, S., Carbone, A., Seiller, X., Okome-Nkoumou, M., Nzamba, C., Kombila, M., Accoceberry, I., Thellier, M., 2007. New highly divergent rRNA sequence among biodiverse genotypes of Enterocytozoon bieneusi strains isolated from humans in Gabon and Cameroon. J. Clin. Microbiol. 45, 2580–2589. Buckholt, M.A., Lee, J.H., Tzipori, S., 2002. Prevalence of Enterocytozoon bieneusi in swine: an 18-month survey at a slaughterhouse in Massachusetts. Appl. Environ. Microbiol. 68, 2595–2599. Cama, V.A., Pearson, J., Cabrera, L., Pacheco, L., Gilman, R., Meyer, S., Ortega, Y., Xiao, L., 2007. Transmission of Enterocytozoon bieneusi between a child and guinea pigs. J. Clin. Microbiol. 45, 2708–2710. Chabchoub, N., Abdelmalek, R., Breton, J., Kanoun, F., Thellier, M., Bouratbine, A., Aoun, K., 2012. Genotype identification of Enterocytozoon bieneusi isolates from stool samples of HIV-infected Tunisian patients. Parasite 19, 147–151. Chalifoux, L.V., Carville, A., Pauley, D., Thompson, B., Lackner, A.A., Mansfield, K.G., 2000. Enterocytozoon bieneusi as a cause of proliferative serositis in simian immunodeficiency virus-infected immunodeficient macaques (Macaca mulatta). Arch. Pathol. Lab. Med. 124, 1480–1484. Cunha, M.J.R., Cury, M.C., Santín, M., 2016. Widespread presence of human-pathogenic Enterocytozoon bieneusi genotypes in chickens. Vet. Parasitol. 217, 108–112. Del Coco, V.F., Cordoba, M.A., Bilbao, G., de Almeida Castro, P., Basualdo, J.A., Santín, M., 2014. First report of Enterocytozoon bieneusi from dairy cattle in Argentina. Vet. Parasitol. 199, 112–115. Dengjel, B., Zahler, M., Hermanns, W., Heinritzi, K., Spillmann, T., Thomschke, A., Löscher, T., Gothe, R., Rinder, H., 2001. Zoonotic potential of Enterocytozoon bieneusi. J. Clin. Microbiol. 39, 4495–4499.
Deplazes, P., Mathis, A., Muller, C., Weber, R., 1996. Molecular epidemiology of Encephalitozoon cuniculi and first detection of Enterocytozoon bieneusi in faecal samples of pigs. J. Eukaryot. Microbiol. 43, 93s. Didier, E.S., 2005. Microsporidiosis: an emerging and opportunistic infection in humans and animals. Acta Trop. 94, 61–76. Didier, E.S., Weiss, L.M., 2006. Microsporidiosis: current status. Curr. Opin. Infect. Dis. 19, 485–492. Didier, E.S., Weiss, L.M., 2011. Microsporidiosis: not just in AIDS patients. Curr. Opin. Infect. Dis. 24, 490–495. Espern, A., Morio, F., Miegeville, M., Illa, H., Abdoulaye, M., Meyssonnier, V., Adehossi, E., Lejeune, A., Cam, P.D., Besse, B., Gay-Andrieu, F., 2007. Molecular study of microsporidiosis due to Enterocytozoon bieneusi and Encephalitozoon intestinalis among human immunodeficiency virus-infected patients from two geographical areas: Niamey, Niger, and Hanoi, Vietnam. J. Clin. Microbiol. 45, 2999–3002. Fayer, R., Santín, M., 2014. Epidemiology of Microsporidia in Human Infections. Microsporidia. John Wiley & Sons, Inc., pp. 135–164. Fayer, R., Santín, M., Trout, J.M., 2007. Enterocytozoon bieneusi in mature dairy cattle on farms in the eastern United States. Parasitol. Res. 102, 15–20. Fayer, R., Santín, M., Macarisin, D., 2012. Detection of concurrent infection of dairy cattle with Blastocystis, Cryptosporidium, Giardia, and Enterocytozoon by molecular and microscopic methods. Parasitol. Res. 111, 1349–1355. Feng, Y., Li, N., Dearen, T., Lobo, M.L., Matos, O., Cama, V., Xiao, L., 2011. Development of a multilocus sequence typing tool for high-resolution genotyping of Enterocytozoon bieneusi. Appl. Environ. Microbiol. 77, 4822–4828. Fiuza, V.R.S., Cosendey, R.I.J., Pimentel, F.F., Oliveira, F.C.R., 2009. Cryptosporidium spp. em suínos de granjas familiares e tecnificadas das regiões norte e noroeste do Estado do Rio de Janeiro. Rev. Bras. Saúde Prod. Anim. 10, 356–365. Fiuza, V.R.S., Oliveira, F.C.R., Fayer, R., Santín, M., 2015. First report of Enterocytozoon bieneusi in pigs in Brazil. Parasitol. Int. 64, 18–23. Fiuza, V.R.S., Lopes, C.W.G., Oliveira, F.C.R., Fayer, R., Santín, M., 2016. New findings of Enterocytozoon bieneusi in beef and dairy cattle in Brazil. Vet. Parasitol. 216, 46–51. Galván, A.L., Martín Sánchez, A.M., Pérez Valentín, M.A., Henriques-Gil, N., Izquierdo, F., Fenoy, S., del Aguila, C., 2011. First cases of microsporidiosis in transplant recipients in Spain and review of the literature. J. Clin. Microbiol. 49, 1301–1306. Galvan-Diaz, A.L., Magnet, A., Fenoy, S., Henriques-Gil, N., Haro, M., Gordo, F.P., Millan, J., Miro, G., del Aguila, C., Izquierdo, F., 2014. Microsporidia detection and genotyping study of human pathogenic E. bieneusi in animals from Spain. PLoS One 9, e92289. Guo, Y., Alderisio, K.A., Yang, W., Cama, V., Feng, Y., Xiao, L., 2014. Host specificity and source of Enterocytozoon bieneusi genotypes in a drinking source watershed. Appl. Environ. Microbiol. 80, 218–225. Jiang, Y., Tao, W., Wan, Q., Li, Q., Yang, Y., Lin, Y., Zhang, S., Li, W., 2015. Zoonotic and potentially host-adapted Enterocytozoon bieneusi Genotypes in sheep and cattle in Northeast China and an increasing concern about the zoonotic importance of previously considered ruminant-adapted genotypes. Appl. Environ. Microbiol. 81, 3326–3335. Jurankova, J., Kamler, M., Kovarcik, K., Koudela, B., 2013. Enterocytozoon bieneusi in Bovine Viral Diarrhea Virus (BVDV) infected and noninfected cattle herds. Res. Vet. Sci. 94, 100–104. Karim, M.R., Dong, H., Yu, F., Jian, F., Zhang, L., Wang, R., Zhang, S., Rume, F.I., Ning, C., Xiao, L., 2014a. Genetic diversity in Enterocytozoon bieneusi isolates from dogs and cats in China: host specificity and public health implications. J. Clin. Microbiol. 52, 3297–3302. Karim, M.R., Wang, R., Dong, H., Zhang, L., Li, J., Zhang, S., Rume, F.I., Qi, M., Jian, F., Sun, M., Yang, G., Zou, F., Ning, C., Xiao, L., 2014b. Genetic polymorphism and zoonotic potential of Enterocytozoon bieneusi from nonhuman primates in China. Appl. Environ. Microbiol. 80, 1893–1898. Kicia, M., Wesolowska, M., Jakuszko, K., Kopacz, Z., Sak, B., Kvetonova, D., Krajewska, M., Kvac, M., 2014. Concurrent infection of the urinary tract with Encephalitozoon cuniculi and Enterocytozoon bieneusi in a renal transplant recipient. J. Clin. Microbiol. 52, 1780–1782. Lallo, M.A., Calabria, P., Milanelo, L., 2012. Encephalitozoon and Enterocytozoon (Microsporidia) spores in stool from pigeons and exotic birds: microsporidia spores in birds. Vet. Parasitol. 190, 418–422. Lee, J.H., 2007. Prevalence and molecular characteristics of Enterocytozoon bieneusi in cattle in Korea. Parasitol. Res. 101, 391–396. Lee, J.H., 2008. Molecular detection of Enterocytozoon bieneusi and identification of a potentially human-pathogenic genotype in milk. Appl. Environ. Microbiol. 74, 1664–1666. Leelayoova, S., Subrungruang, I., Suputtamongkol, Y., Worapong, J., Petmitr, P.C., Mungthin, M., 2006. Identification of genotypes of Enterocytozoon bieneusi from stool samples from human immunodeficiency virus-infected patients in Thailand. J. Clin. Microbiol. 44, 3001–3004. Leelayoova, S., Piyaraj, P., Subrungruang, I., Pagornrat, W., Naaglor, T., Phumklan, S., Taamasri, P., Suwanasri, J., Mungthin, M., 2009. Genotypic characterization of Enterocytozoon bieneusi in specimens from pigs and humans in a pig farm community in Central Thailand. J. Clin. Microbiol. 47, 1572–1574. Li, W., Kiulia, N.M., Mwenda, J.M., Nyachieo, A., Taylor, M.B., Zhang, X., Xiao, L., 2011. Cyclospora papionis, Cryptosporidium hominis, and human-pathogenic Enterocytozoon bieneusi in captive baboons in Kenya. J. Clin. Microbiol. 49, 4326–4329. Li, W., Cama, V., Akinbo, F.O., Ganguly, S., Kiulia, N.M., Zhang, X., Xiao, L., 2013. Multilocus sequence typing of Enterocytozoon bieneusi: lack of geographic segregation and existence of genetically isolated sub-populations. Infect. Genet. Evol. 14, 111–119. Li, W., Li, Y., Li, W., Yang, J., Song, M., Diao, R., Jia, H., Lu, Y., Zheng, J., Zhang, X., Xiao, L., 2014a. Genotypes of Enterocytozoon bieneusi in livestock in China: high prevalence and zoonotic potential. PLoS One 9, e97623.
V.R.S. Fiuza et al. / Research in Veterinary Science 107 (2016) 196–201 Li, W., Diao, R., Yang, J., Xiao, L., Lu, Y., Li, Y., Song, M., 2014b. High diversity of humanpathogenic Enterocytozoon bieneusi genotypes in swine in Northeast China. Parasitol. Res. 113, 1147–1153. Lobo, M.L., Xiao, L., Cama, V., Magalhaes, N., Antunes, F., Matos, O., 2006a. Identification of potentially human-pathogenic Enterocytozoon bieneusi genotypes in various birds. Appl. Environ. Microbiol. 72, 7380–7382. Lobo, M.L., Xiao, L., Cama, V., Stevens, T., Antunes, F., Matos, O., 2006b. Genotypes of Enterocytozoon bieneusi in mammals in Portugal. J. Eukaryot. Microbiol. 53 (Suppl. 1), S61–S64. Lobo, M.L., Xiao, L., Antunes, F., Matos, O., 2012. Microsporidia as emerging pathogens and the implication for public health: a 10-year study on HIV-positive and -negative patients. Int. J. Parasitol. 42, 197–205. Lobo, M.L., Augusto, J., Antunes, F., Ceita, J., Xiao, L., Codices, V., Matos, O., 2014. Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi and other intestinal parasites in young children in Lobata Province, Democratic Republic of São Tomé and Principe. PLoS One 9, e97708. Ma, J., Li, P., Zhao, X., Xu, H., Wu, W., Wang, Y., Guo, Y., Wang, L., Feng, Y., Xiao, L., 2015. Occurrence and molecular characterization of Cryptosporidium spp. and Enterocytozoon bieneusi in dairy cattle, beef cattle and water buffaloes in China. Vet. Parasitol. 207, 220–227. Maikai, B.V., Umoh, J.U., Lawal, I.A., Kudi, A.C., Ejembi, C.L., Xiao, L., 2012. Molecular characterizations of Cryptosporidium, Giardia, and Enterocytozoon in humans in Kaduna State, Nigeria. Exp. Parasitol. 131, 452–456. Matos, O., Lobo, M.L., Xiao, L., 2012. Epidemiology of Enterocytozoon bieneusi infection in humans. J. Parasitol. Res. 2012, 981424. Muller, M.G., Kinne, J., Schuster, R.K., Walochnik, J., 2008. Outbreak of microsporidiosis caused by Enterocytozoon bieneusi in falcons. Vet. Parasitol. 152, 67–78. Němejc, K., Sak, B., Kvetonova, D., Hanzal, V., Janiszewski, P., Forejtek, P., Rajsky, D., Kotkova, M., Ravaszova, P., McEvoy, J., Kvac, M., 2014. Prevalence and diversity of Encephalitozoon spp. and Enterocytozoon bieneusi in wild boars (Sus scrofa) in Central Europe. Parasitol. Res. 113, 761–767. Nkinin, S.W., Asonganyi, T., Didier, E.S., Kaneshiro, E.S., 2007. Microsporidian infection is prevalent in healthy people in Cameroon. J. Clin. Microbiol. 45, 2841–2846. Pirestani, M., Sadraei, J., Forouzandeh, M., 2013. Molecular characterization and genotyping of human related microsporidia in free-ranging and captive pigeons of Tehran, Iran. Infect. Genet. Evol. 20, 495–499. Reetz, J., Nockler, K., Reckinger, S., Vargas, M.M., Weiske, W., Broglia, A., 2009. Identification of Encephalitozoon cuniculi genotype III and two novel genotypes of Enterocytozoon bieneusi in swine. Parasitol. Int. 58, 285–292. Rinder, H., Thomschke, A., Dengjel, B., Gothe, R., Loscher, T., Zahler, M., 2000. Close genotypic relationship between Enterocytozoon bieneusi from humans and pigs and first detection in cattle. J. Parasitol. 86, 185–188. Sadler, F., Peake, N., Borrow, R., Rowl, P.L., Wilkins, E.G., Curry, A., 2002. Genotyping of Enterocytozoon bieneusi in AIDS patients from the north west of England. J. Infect. 44, 39–42. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sak, B., Kvac, M., Hanzlikova, D., Cama, V., 2008. First report of Enterocytozoon bieneusi infection on a pig farm in the Czech Republic. Vet. Parasitol. 153, 220–224. Sak, B., Brady, D., Pelikánová, M., Květoňová, D., Rost, M., Kostka, M., Tolarová, V., Hůzová, Z., Kváč, M., 2011a. Unapparent microsporidial infection among immunocompetent humans in the Czech Republic. J. Clin. Microbiol. 49, 1064–1070. Sak, B., Kvac, M., Kvetonova, D., Albrecht, T., Pialek, J., 2011b. The first report on natural Enterocytozoon bieneusi and Encephalitozoon spp. infections in wild East-European house mice (Mus musculus musculus) and West-European house mice (M. m. domesticus) in a hybrid zone across the Czech Republic-Germany border. Vet. Parasitol. 178, 246–250. Saksirisampant, W., Prownebon, J., Saksirisampant, P., Mungthin, M., Siripatanapipong, S., Leelayoova, S., 2009. Intestinal parasitic infections: prevalences in HIV/AIDS patients in a Thai AIDS-care centre. Ann. Trop. Med. Parasitol. 103, 573–581. Santín, M., 2015. Enterocytozoon Bieneusi. In: Xiao, L., Ryan, U., Feng, Y. (Eds.), Biology of Foodborne Parasites. CRC Press, United States of America, pp. 149–174. Santín, M., Fayer, R., 2009a. Enterocytozoon bieneusi genotype nomenclature based on the internal transcribed spacer sequence: a consensus. J. Eukaryot. Microbiol. 56, 34–38. Santín, M., Fayer, R., 2009b. A longitudinal study of Enterocytozoon bieneusi in dairy cattle. Parasitol. Res. 105, 141–144. Santín, M., Fayer, R., 2015. Enterocytozoon bieneusi, Giardia, and Cryptosporidium infecting white-tailed deer. J. Eukaryot. Microbiol. 62, 34–43. Santín, M., Trout, J.M., Fayer, R., 2004. Prevalence of Enterocytozoon bieneusi in postweaned dairy calves in the eastern United States. Parasitol. Res. 93, 287–289. Santín, M., Trout, J.M., Fayer, R., 2005. Enterocytozoon bieneusi genotypes in dairy cattle in the eastern United States. Parasitol. Res. 97, 535–538. Santín, M., Trout, J.M., Vecino, J.A.C., Dubey, J.P., Fayer, R., 2006. Cryptosporidium, Giardia and Enterocytozoon bieneusi in cats from Bogota (Colombia) and genotyping of isolates. Vet. Parasitol. 141, 334–339. Santín, M., Cortes Vecino, J.A., Fayer, R., 2008. Enterocytozoon bieneusi genotypes in dogs in Bogota, Colombia. Am.J.Trop. Med. Hyg. 79, 215–217. Santín, M., Vecino, J.A., Fayer, R., 2010. A zoonotic genotype of Enterocytozoon bieneusi in horses. J. Parasitol. 96, 157–161. Santín, M., Dargatz, D., Fayer, R., 2012. Prevalence and genotypes of Enterocytozoon bieneusi in weaned beef calves on cow-calf operations in the USA. Parasitol. Res. 110, 2033–2041.
201
Shi, K., Li, M., Wang, X., Li, J., Karim, M.R., Wang, R., Zhang, L., Jian, F., Ning, C., 2016. Molecular survey of Enterocytozoon bieneusi in sheep and goats in China. Parasit. Vectors 9, 23. Sokolova, O.I., Demyanov, A.V., Bowers, L.C., Didier, E.S., Yakovlev, A.V., Skarlato, S.O., Sokolova, Y.Y., 2011. Emerging microsporidian infections in Russian HIV-infected patients. J. Clin. Microbiol. 49, 2102–2108. Stensvold, C.R., Beser, J., Ljungström, B., Troell, K., Lebbad, M., 2014. Low host-specific Enterocytozoon bieneusi genotype BEB6 is common in Swedish lambs. Vet. Parasitol. 205, 371–374. Sulaiman, I.M., Fayer, R., Lal, A.A., Trout, J.M., Schaefer III, F.W., Xiao, L., 2003a. Molecular characterization of microsporidia indicates that wild mammals Harbor host-adapted Enterocytozoon spp. as well as human-pathogenic Enterocytozoon bieneusi. Appl. Environ. Microbiol. 69, 4495–4501. Sulaiman, I.M., Bern, C., Gilman, R., Cama, V., Kawai, V., Vargas, D., Ticona, E., Vivar, A., Xiao, L., 2003b. A molecular biologic study of Enterocytozoon bieneusi in HIV-infected patients in Lima, Peru. J. Eukaryot. Microbiol. 50, 591–596. Sulaiman, I.M., Fayer, R., Yang, C., Santín, M., Matos, O., Xiao, L., 2004. Molecular characterization of Enterocytozoon bieneusi in cattle indicates that only some isolates have zoonotic potential. Parasitol. Res. 92, 328–334. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. ten Hove, R.J., Van Lieshout, L., Beadsworth, M.B., Perez, M.A., Spee, K., Claas, E.C., Verweij, J.J., 2009. Characterization of genotypes of Enterocytozoon bieneusi in immunosuppressed and immunocompetent patient groups. J. Eukaryot. Microbiol. 56, 388–393. Wagnerova, P., Sak, B., Kvetonova, D., Bunatova, Z., Civisova, H., Marsalek, M., Kvac, M., 2012. Enterocytozoon bieneusi and Encephalitozoon cuniculi in horses kept under different management systems in the Czech Republic. Vet. Parasitol. 190, 573–577. Wan, Q., Lin, Y., Mao, Y., Yang, Y., Li, Q., Zhang, S., Jiang, Y., Tao, W., Li, W., 2016. High Prevalence and Widespread Distribution of Zoonotic Enterocytozoon bieneusi genotypes in swine in Northeast China: implications for public health. J. Eukaryot. Microbiol. 63, 162–170. Wang, L., Xiao, L., Duan, L., Ye, J., Guo, Y., Guo, M., Liu, L., Feng, Y., 2013a. Concurrent infections of Giardia duodenalis, Enterocytozoon bieneusi, and Clostridium difficile in children during a cryptosporidiosis outbreak in a pediatric hospital in China. PLoS Negl. Trop. Dis. 7, e2437. Wang, L., Zhang, H., Zhao, X., Zhang, L., Zhang, G., Guo, M., Liu, L., Feng, Y., Xiao, L., 2013b. Zoonotic Cryptosporidium species and Enterocytozoon bieneusi genotypes in HIV-positive patients on antiretroviral therapy. J. Clin. Microbiol. 51, 557–563. Wumba, R., Jean, M., Benjamin, L.M., Madone, M., Fabien, K., Josue, Z., Jean, S., Eric, K., A. C.G., Marc, T., 2012. Enterocytozoon bieneusi identification using real-time polymerase chain reaction and restriction fragment length polymorphism in HIV-infected humans from Kinshasa Province of the Democratic Republic of Congo. J. Parasitol. Res. 2012, 278028. Yang, Y., Lin, Y., Li, Q., Zhang, S., Tao, W., Wan, Q., Jiang, Y., Li, W., 2015. Widespread presence of human-pathogenic Enterocytozoon bieneusi genotype D in farmed foxes (Vulpes vulpes) and raccoon dogs (Nyctereutes procyonoides) in China: first identification and zoonotic concern. Parasitol. Res. 114, 4341–4348. Ye, J., Xiao, L., Ma, J., Guo, M., Liu, L., Feng, Y., 2012. Anthroponotic enteric parasites in monkeys in public park, China. Emerg. Infect. Dis. 18, 1640–1643. Ye, J., Xiao, L., Li, J., Huang, W., Amer, S.E., Guo, Y., Roellig, D., Feng, Y., 2014. Occurrence of human-pathogenic Enterocytozoon bieneusi, Giardia duodenalis and Cryptosporidium genotypes in laboratory macaques in Guangxi, China. Parasitol. Int. 63, 132–137. Ye, J., Xiao, L., Wang, Y., Guo, Y., Roellig, D.M., Feng, Y., 2015. Dominance of Giardia duodenalis assemblage A and Enterocytozoon bieneusi genotype BEB6 in sheep in Inner Mongolia, China. Vet. Parasitol. 210, 235–239. Zhang, X., Wang, Z., Su, Y., Liang, X., Sun, X., Peng, S., Lu, H., Jiang, N., Yin, J., Xiang, M., Chen, Q., 2011. Identification and genotyping of Enterocytozoon bieneusi in China. J. Clin. Microbiol. 49, 2006–2008. Zhao, W., Zhang, W., Wang, R., Liu, W., Liu, A., Yang, D., Yang, F., Karim, M.R., Zhang, L., 2014a. Enterocytozoon bieneusi in sika deer (Cervus nippon) and red deer (Cervus elaphus): deer specificity and zoonotic potential of ITS genotypes. Parasitol. Res. 113, 4243–4250. Zhao, W., Zhang, W., Yang, F., Cao, J., Liu, H., Yang, D., Shen, Y., Liu, A., 2014b. High prevalence of Enterocytozoon bieneusi in asymptomatic pigs and assessment of zoonotic risk at the genotype level. Appl. Environ. Microbiol. 80, 3699–3707. Zhao, W., Zhang, W., Yang, D., Zhang, L., Wang, R., Liu, A., 2015a. Prevalence of Enterocytozoon bieneusi and genetic diversity of ITS genotypes in sheep and goats in China. Infect. Genet. Evol. 32, 265–270. Zhao, W., Zhang, W., Yang, Z., Liu, A., Zhang, L., Yang, F., Wang, R., Ling, H., 2015b. Genotyping of Enterocytozoon bieneusi in farmed blue foxes (Alopex lagopus) and raccoon dogs (Nyctereutes procyonoides) in China. PLoS One 10, e0142611. Zhao, W., Zhang, W., Yang, F., Zhang, L., Wang, R., Cao, J., Shen, Y., Liu, A., 2015c. Enterocytozoon bieneusi in dairy cattle in the Northeast of China: genetic diversity of ITS gene and evaluation of zoonotic transmission potential. J. Eukaryot. Microbiol. 62, 553–560. Zhao, G.H., Du, S.Z., Wang, H.B., Hu, X.F., Deng, M.J., Yu, S.K., Zhang, L.X., Zhu, X.Q., 2015d. First report of zoonotic Cryptosporidium spp., Giardia intestinalis and Enterocytozoon bieneusi in golden takins (Budorcas taxicolor bedfordi). Infect. Genet. Evol. 34, 394–401.
